Application of soybean GmSUC2 gene in improving protein content of soybean seeds

Abstract

The invention discloses an application of a soybean GmSUC2 gene in improving the protein content of soybean seeds, and the nucleotide sequence of the soybean GmSUC2 gene is shown as SEQ ID NO. 1; the amino acid sequence of the soybean GmSUC2 protein is as shown in SEQ ID NO. 2. According to the invention, a function deletion mutant strain of GmSUC2 is created by using a gene editing method, and compared with a wild type, the seed protein content of the gmsuc2 mutant is obviously improved. Therefore, the knockout of the GmSUC2 gene in the soybean is one of the effective modes for improving the protein content of the soybean seeds, and the method has important production and theoretical significance on breeding of soybean dominant varieties and development of germplasm resources.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the GmSUC2 gene in increasing the protein content of soybean seeds. Background Technology

[0002] Soybeans are a crucial global source of plant protein, and the water-soluble protein content of their seeds directly determines the nutritional quality and processing performance of soy products. Simultaneously increasing soybean protein content and yield is one of the core goals in the breeding field. However, regulating soybean protein content is controlled by multiple genes and influenced by environmental factors, making it a significant challenge. Furthermore, as an ancient tetraploid, soybeans have multiple copies of genes, which are subject to genetic redundancy limitations. Transgenic technology plays a vital role in addressing the challenges of improving yield, quality, and other phenotypic aspects that are difficult to overcome with conventional breeding techniques.

[0003] Sucrose is the primary form of carbohydrate transport from source tissues to sink tissues in most plants, playing a crucial role in plant growth and development. Sucrose transporters (SUTs / Sucrose carriers, SUCs), with their typical 12 α-helical transmembrane domains, are responsible for loading sucrose into the phloem and mediating its long-distance transport. Knockout of AtSUC2 in Arabidopsis thaliana prevents the normal transport of sucrose from leaves to other parts of the plant, leading to a large accumulation of starch and soluble sugars in the leaves and hindering plant growth and development. Overexpression of spinach SoSUT1 in potato promotes sucrose export from leaves and significantly increases the soluble sugar content in tubers. In maize, inhibiting ZmSUT1 expression leads to a large accumulation of soluble sugars in leaves, causing premature leaf senescence and delayed flowering. However, there are no publicly reported cases of SUCs participating in the regulation of grain protein content in soybeans.

[0004] Therefore, identifying key members of the soybean SUC family that regulate seed protein content, clarifying their functions, and applying them to molecular breeding is of great significance for enriching the genetic resources for high-protein soybean breeding and improving breeding efficiency. It can also provide new technical pathways for breeding high-quality and high-yield soybean varieties. Summary of the Invention

[0005] In view of the shortcomings of the existing technology, the purpose of this invention is to provide an application of the soybean GmSUC2 gene to increase the protein content of soybean seeds.

[0006] To achieve the objectives of this invention, the following technical solutions can be used:

[0007] In a first aspect, the present invention protects the application of inhibiting or knocking out the gene encoding soybean GmSUC2 protein in increasing the protein content of soybean seeds or in breeding soybeans with high protein content, wherein the amino acid sequence of the soybean GmSUC2 protein is as follows (A1) or (A2) or (A3):

[0008] (A1) A protein consisting of the amino acid sequence described in SEQ ID NO. 2 of the sequence listing;

[0009] (A2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence described in SEQ ID NO. 2 in the sequence listing;

[0010] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0011] Preferably, the nucleotide sequence of the gene encoding soybean GmSUC2 protein is shown in SEQ ID NO. 1.

[0012] Those skilled in the art will understand that proteins obtained by replacing one or more conserved amino acids (such as between amino acids with similar properties) in the sequence shown in SEQ ID NO.2 should be included within the scope of protection of this invention, as long as they can still be knocked out and result in an increase in the content of seed protein.

[0013] Secondly, this invention protects the application of inhibiting or knocking out the gene encoding soybean GmSUC2 protein in the preparation of products that increase the protein content of soybean seeds or in the preparation of products for breeding soybeans with high protein content, wherein the amino acid sequence of the soybean GmSUC2 protein is as follows (A1) or (A2) or (A3):

[0014] (A1) A protein consisting of the amino acid sequence described in SEQ ID NO. 2 of the sequence listing;

[0015] (A2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence described in SEQ ID NO. 2 in the sequence listing;

[0016] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0017] Preferably, the nucleotide sequence of the gene encoding soybean GmSUC2 protein is shown in SEQ ID NO. 1.

[0018] Preferably, the inhibition or knockout of the gene encoding soybean GmSUC2 protein is achieved by editing the GmSUC2 gene using the CRISPR / Cas9 system.

[0019] Thirdly, the present invention protects the use of substances that inhibit or knock out the gene encoding soybean GmSUC2 protein in increasing the protein content of soybean seeds or in breeding soybeans with high protein content, wherein the amino acid sequence of the soybean GmSUC2 protein is as follows (A1) or (A2) or (A3):

[0020] (A1) A protein consisting of the amino acid sequence described in SEQ ID NO. 2 of the sequence listing;

[0021] (A2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence described in SEQ ID NO. 2 in the sequence listing;

[0022] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0023] Fourthly, this invention protects the use of substances that inhibit or knock out the gene encoding soybean GmSUC2 protein in the preparation of products that increase the protein content of soybean seeds or in the preparation of products for breeding soybeans with high protein content, wherein the amino acid sequence of the soybean GmSUC2 protein is as follows (A1) or (A2) or (A3):

[0024] (A1) A protein consisting of the amino acid sequence described in SEQ ID NO. 2 of the sequence listing;

[0025] (A2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence described in SEQ ID NO. 2 in the sequence listing;

[0026] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0027] Preferably, the substance used to inhibit or knock out the gene encoding soybean GmSUC2 protein is selected from siRNA or gene editing systems targeting the gene encoding soybean GmSUC2 protein.

[0028] More preferably, the gene editing system targets the sites shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, or SEQ ID NO.6.

[0029] More preferably, the gene editing system is obtained by inserting double strands obtained by annealing SEQ ID NO.7 and SEQ ID NO.8, double strands obtained by annealing SEQ ID NO.9 and SEQ ID NO.10, double strands obtained by annealing SEQ ID NO.11 and SEQ ID NO.12, or double strands obtained by annealing SEQ ID NO.13 and SEQ ID NO.14 into the pCas9 (EF1A2 promoter) vector.

[0030] More preferably, the sequence of the siRNA can be designed according to existing technology, and there are no specific limitations.

[0031] Fifthly, the present invention provides a method for increasing the protein content of soybean seeds, the method comprising reducing the content and / or activity of the GmSUC2 protein, or reducing the expression level of the GmSUC2 gene.

[0032] In a sixth aspect, the present invention provides a method for breeding soybeans with high protein content, the method comprising reducing the content and / or activity of the GmSUC2 protein, or reducing the expression level of the GmSUC2 gene.

[0033] Preferably, the reduction of the content and / or activity of the GmSUC2 protein is achieved by reducing the expression level of the GmSUC2 gene.

[0034] Preferably, the expression level of the GmSUC2 gene is reduced by transferring a gene editing vector targeting the GmSUC2 protein-coding gene into soybean; the gene editing vector is specifically constructed by the following method: the GmSUC2 gene is edited using the CRISPR / Cas9 system, and primers targeting the GmSUC2 gene are ligated to the pCas9 (EF1A2promoter) vector to obtain a recombinant plant expression vector.

[0035] More preferably, the primers are selected from any one of the following:

[0036] (I) SEQ ID NO.7 and SEQ ID NO.8;

[0037] (II) SEQ ID NO.9 and SEQ ID NO.10;

[0038] (III) SEQ ID NO.11 and SEQ ID NO.12;

[0039] (IV) SEQ ID NO.13 and SEQ ID NO.14.

[0040] Seventhly, the present invention protects the primers described above.

[0041] The significant advantages of this invention are:

[0042] This invention provides, for the first time, the application of the protein encoded by the GmSUC2 gene in regulating the protein content of soybean seeds. By creating mutant soybean lines using the GmSUC2 gene, it was found that the protein content in the seeds of the gmsuc2 mutant soybeans was significantly increased compared to the wild type. Therefore, this invention can yield soybean lines with high protein content, and has significant application value. Attached Figure Description

[0043] Figure 1 This is a schematic diagram of the edited form of the soybean gmsuc2 mutant line of the present invention.

[0044] Figure 2 The results show the protein and oil content of the soybean gmsuc2 mutant strain of this invention. Detailed Implementation

[0045] To facilitate understanding of the present invention, the technical solutions described below are further illustrated with specific embodiments, but the present invention is not limited thereto. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores. The determination of vector sequencing in the following embodiments was performed by conventional sequencing companies.

[0046] The soybean (Glycine max) variety Wm 82 was provided by the National Center for Soybean Improvement at Nanjing Agricultural University.

[0047] Example 1: Construction of soybean GmSUC2 knockout vector

[0048] The GmSUC2 gene number was entered into the CRISPR2-p v2.0 online website.

[0049] Target design was performed using (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), resulting in four targets: CGCTGTCTCGTCAATCGCCG, as shown in SEQ ID NO. 3;

[0050] CCACCCGAATTGAATTCCCG, as shown in SEQ ID NO. 4;

[0051] ACCTGAAGAGACGACGAAGG, as shown in SEQ ID NO. 5;

[0052] CCGTCCCTTCATCTTAGCCG, as shown in SEQ ID NO. 6.

[0053] Design primers according to the following:

[0054] Upper Primer: 5'-GGATT-G (N19)-3';

[0055] Lower Primer: 5'-AAAC-(N19) CA-3';

[0056] They are respectively:

[0057] GmSUC2-1-F: GGATTGGCTGTCTCGTCAATCGCCG, as shown in SEQ ID NO. 7;

[0058] GmSUC2-1-R: AAACCGGCGATTGACGAGACAGCCA, as shown in SEQ ID NO. 8;

[0059] GmSUC2-2-F: GGATTGCACCCGAATTGAATTCCCG, as shown in SEQ ID NO. 9;

[0060] GmSUC2-2-R: AAACCGGGAATTCAATTCGGGTGCA, as shown in SEQ ID NO. 10;

[0061] GmSUC2-3-F: GGATTGCCTGAAGAGACGACGAAGG, as shown in SEQ ID NO. 11;

[0062] GmSUC2-3-R: AAACCCTTCGTCGTCTCTTCAGGCA, as shown in SEQ ID NO. 12;

[0063] GmSUC2-4-F: GGATTGCGTCCCTTCATCTTAGCCG, as shown in SEQ ID NO. 13;

[0064] GmSUC2-4-R: AAACCGGCTAAGATGAAGGGACGCA, as shown in SEQ ID NO. 14.

[0065] 1. Annealing and Joining

[0066] (1) Annealing reaction system. Reaction system 1 consisted of 10 μL of 1 μL of forward and reverse primers (GmSUC2-1-F and GmSUC2-1-R, GmSUC2-2-F and GmSUC2-2-R, GmSUC2-3-F and GmSUC2-3-R, GmSUC2-4-F and GmSUC2-4-R, respectively) and 8 μL of Anneal Buffer. The mixture was placed in a PCR instrument and the temperature was reduced from 95 ℃ to 16 ℃ in a decrease of 0.1 ℃ / s. The annealing products obtained were GmSUC2-1, GmSUC2-2, GmSUC2-3 and GmSUC2-4, respectively.

[0067] (2) The pUC19 vector was digested with restriction endonuclease Bsa I.

[0068] (3) Connecting the reaction system. The reaction system consisted of 20 μL of annealing reaction products (GmSUC2-1, GmSUC2-2, GmSUC2-3 and GmSUC2-4), 1 μL of linearized support pUC19, 2 μL of 10 x T4 buffer, 1 μL of T4 ligase (TAKARA), and 6 μL of H2O; the reaction was carried out at 25℃ for 2 h.

[0069] 2. The ligation product was transformed into *E. coli* DH5α competent cells (Zhuangmeng International Biotechnology Co., Ltd.) to obtain several single clones. Each single clone was used as a template for colony PCR amplification and detection. The colonies were then sequenced to obtain positive clones.

[0070] 3. Inoculate positive monoclonal antibodies into LB liquid medium and culture to obtain bacterial culture; then extract plasmids from the bacterial culture, namely recombinant plasmids pUC19-GmSUC2-1, pUC19-GmSUC2-2, pUC19-GmSUC2-3 and pUC19-GmSUC2-4.

[0071] 4. Golden Gate ligation. The reaction system consisted of 20 μL of the following: 100 ng of plasmids pUC19-GmSUC2-1, pUC19-GmSUC2-2, pUC19-GmSUC2-3, and pUC19-GmSUC2-4 obtained in step 3; 50 ng of pCas9 (EF1A2 promoter) plasmid; 1 μL of Aar I; 0.4 μL of 50 x Oligo; 2 μL of 10 x T4 buffer; 1 μL of T4 ligase; and H2O to a final volume of 20 μL. The PCR reaction was performed using the following program: 37 ℃ for 5 min, 25 ℃ for 10 min, 15 cycles; 50 ℃ for 5 min; and 80 ℃ for 10 min.

[0072] 5. The ligation product was transformed into *E. coli* DH5α competent cells (Zhuangmeng International Biotechnology Co., Ltd.) to obtain several single clones. Each single clone was used as a template for colony PCR amplification and detection. The colonies were then sequenced, yielding four positive clones with target sites SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6 all inserted into the pCas9 (EF1A2 promoter) vector.

[0073] 6. Inoculate positive monoclonal antibodies into LB liquid medium and culture to obtain bacterial culture; then extract plasmid from the bacterial culture, namely recombinant plasmid pCas9 (EF1A2 promoter)-GmSUC2.

[0074] Example 2: Obtaining transgenic soybean plants

[0075] 1. The constructed recombinant plasmid was transformed into Agrobacterium tumefaciens EHA105 for stable genetic transformation of soybean.

[0076] 2. The recombinant plasmid was transformed into soybean variety Wm 82 (hereinafter referred to as soybean). After screening, differentiation, and rooting, T0 generation transgenic soybean plants were obtained. The specific steps are as follows:

[0077] (1) Sterilize soybeans for 3 hours with chlorine gas produced by the reaction of 15 mL concentrated hydrochloric acid and 100 mL sodium hypochlorite. Remove the soybeans and dry them in a clean bench.

[0078] (2) Seed germination: Sow soybeans evenly in the germination medium, about 20-30 seeds per dish.

[0079] (3) Agrobacterium infection: Cut the soybean in half, remove part of the embryo tip, and make a wound in the meristematic area. This is the target for infection: soybean explants. Place them in the OD. 600nm The recombinant Agrobacterium bacterial suspension was prepared at approximately 0.6 and shaken at room temperature for 30 min. The explants were then removed and blown under sterile conditions for 10 min, and then spread evenly on the co-culture medium and incubated in the dark for 5 days.

[0080] (4) Wash the embryo 4-5 times with sterile water and liquid induction medium containing hormones to ensure that Agrobacterium is thoroughly cleaned. Cut off the elongated embryo, leaving only 3-4 mm. Insert the embryo downwards into the solid bud induction medium and incubate for 2 weeks in a 16 h light / 8 h dark incubator at 25 ℃.

[0081] (5) After 15 days, some explants began to sprout. Those with sprouts were cut off from the stump and transferred to a new solid bud induction medium. Those without sprouts were discarded and continued to be cultured under light in the greenhouse.

[0082] (6) After 15 days, the explants that have sprouted were subcultured into a new solid bud induction medium. The explants that have not sprouted were discarded. The explants were cultured in the greenhouse for 15 days. The explants were cultured in the solid bud induction medium for a total of 30 days.

[0083] (7) Separate the well-grown callus from the bean, discard the explant, scrape off the black surface of the callus, and transfer it to a solid shoot elongation medium. Replace the solid elongation medium every 15 days, and generally subculture 4-5 times, for a total of 60-80 days. The callus is being screened while it is elongating, and seedlings will grow during the screening process.

[0084] (8) When the seedlings grow to about 4-5 cm, cut them off from the callus and transfer them to the rooting medium.

[0085] (9) After culturing in the rooting medium for about 20-30 days, the seedlings that have grown strong and developed root systems can be transferred to a pure vermiculite environment in a disposable cup and placed in a low-light hardening environment. Use another disposable plastic cup to cover the seedlings to achieve the purpose of moisturizing. Generally, hardening takes 5 days.

[0086] (10) After a few days of adaptation, when you observe obvious root growth, remove the disposable cup used for moisturizing. Transfer it to a large pot containing nutrient soil and continue to cultivate it.

[0087] Example 3: Obtaining and Genotyping Mutant Lines

[0088] To identify positive plants, DNA was extracted from fresh leaves of the T0 generation for genotyping.

[0089] For gene-edited mutant lines, we first detected the presence of the Cas9 gene and designed specific primers based on the target site location to detect the editing effect of approximately 500 bp before and after the target site in T0 generation plants. After harvesting T1 generation, we further identified the genotype, screened for single plants without the Cas9 gene, and detected the editing pattern of the target site. We found that only target sites 1 and 2 were effective, while no genome editing occurred at target sites 3 and 4. Two homozygous Cas9-free mutant lines with two editing patterns were obtained: gmsuc2-1 (-10 bp) and gmsuc2-2 (-4 bp).

[0090] Example 4. Phenotypic identification of gmsuc2 mutant soybean plants.

[0091] The homozygous mutant line of gmsuc2 obtained in Example 3 and seeds of the wild-type soybean variety Wm82 were planted at the Nanjing Liuhe transgenic planting base. After harvesting, the protein and oil content of the soybean seeds were determined using a near-infrared analyzer. The results showed that the protein content of the homozygous mutant line of gmsuc2 increased significantly by 1.6%, while the oil content decreased significantly by 1.5%. The test results are as follows: Figure 2 As shown.

[0092] The present invention has been described in detail above. The scope of protection of the present invention is not limited to the embodiments described above. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in the present invention and are protected by the appended claims.

Claims

1. The application of inhibiting or knocking out the gene encoding soybean GmSUC2 protein in increasing the protein content of soybean seeds or breeding soybeans with high protein content, characterized in that, The amino acid sequence of the soybean GmSUC2 protein is as follows (A1) or (A2) or (A3): (A1) A protein consisting of the amino acid sequence described in SEQ ID NO. 2 of the sequence listing; (A2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence described in SEQ ID NO. 2 in the sequence listing; (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2); Preferably, the nucleotide sequence of the gene encoding soybean GmSUC2 protein is shown in SEQ ID NO.

1.

2. The application of inhibiting or knocking out the gene encoding soybean GmSUC2 protein in the preparation of products with increased soybean seed protein content or in the preparation of products for breeding soybeans with high protein content, wherein the amino acid sequence of the soybean GmSUC2 protein is as follows (A1) or (A2) or (A3): (A1) A protein consisting of the amino acid sequence described in SEQ ID NO. 2 of the sequence listing; (A2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence described in SEQ ID NO. 2 in the sequence listing; (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2); Preferably, the nucleotide sequence of the gene encoding soybean GmSUC2 protein is shown in SEQ ID NO.

1.

3. The application according to claim 1 or 2, characterized in that, The inhibition or knockout of the gene encoding soybean GmSUC2 protein is achieved by editing the GmSUC2 gene using the CRISPR / Cas9 system.

4. The application of substances that inhibit or knock out the gene encoding soybean GmSUC2 protein in increasing the protein content of soybean seeds or in breeding high-protein soybeans, characterized in that... The amino acid sequence of the soybean GmSUC2 protein is as follows (A1) or (A2) or (A3): (A1) A protein consisting of the amino acid sequence described in SEQ ID NO. 2 of the sequence listing; (A2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence described in SEQ ID NO. 2 in the sequence listing; (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

5. The application of a substance that inhibits or knocks out the gene encoding soybean GmSUC2 protein in the preparation of products that increase the protein content of soybean seeds or in the preparation of products for breeding soybeans with high protein content, wherein the amino acid sequence of the soybean GmSUC2 protein is as follows (A1) or (A2) or (A3): (A1) A protein consisting of the amino acid sequence described in SEQ ID NO. 2 of the sequence listing; (A2) A protein derived from (1) with the same function by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence described in SEQ ID NO. 2 in the sequence listing; (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

6. The application according to claim 4 or 5, characterized in that, The substance used to inhibit or knock out the gene encoding soybean GmSUC2 protein is selected from siRNA or gene editing systems targeting the gene encoding soybean GmSUC2 protein. Preferably, the gene editing system targets SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.

6. More preferably, the gene editing system is obtained by inserting double strands obtained by annealing SEQ ID NO.7 and SEQ ID NO.8, double strands obtained by annealing SEQ ID NO.9 and SEQ ID NO.10, double strands obtained by annealing SEQ ID NO.11 and SEQ ID NO.12, or double strands obtained by annealing SEQ ID NO.13 and SEQ ID NO.14 into the pCas9 (EF1A2 promoter) vector.

7. A method for increasing the protein content of soybean seeds, characterized in that, The method includes reducing the content and / or activity of the GmSUC2 protein as described in claim 1, or reducing the expression level of the GmSUC2 gene.

8. A method for breeding soybeans with high protein content, characterized in that, The method includes reducing the content and / or activity of the GmSUC2 protein, or reducing the expression level of the GmSUC2 gene.

9. The method according to claim 7 or 8, characterized in that, The expression level of the GmSUC2 gene is reduced by transferring a gene editing vector targeting the GmSUC2 protein-coding gene into soybean. The gene editing vector is specifically constructed by the following method: the GmSUC2 gene is edited using the CRISPR / Cas9 system, and primers targeting the GmSUC2 gene are linked to the pCas9 (EF1A2 promoter) vector to obtain a recombinant plant expression vector. Preferably, the primers are selected from any one of the following: (I) SEQ ID NO.7 and SEQ ID NO.8; (II) SEQ ID NO.9 and SEQ ID NO.10; (III) SEQ ID NO.11 and SEQ ID NO.12; (IV) SEQ ID NO.13 and SEQ ID NO.

14.

10. The primer as described in claim 9.

Images