Gene for regulating and controlling flowering transformation and agronomic traits of wheat and application of gene
By knocking out the wheat VRN3 gene and using CRISPR-Cas9 technology, changes in wheat spike structure and adventitious root production were achieved, solving the problem of limited application of the VRN3 gene in existing technologies, improving wheat yield and perennial reproductive capacity, and expanding its application boundaries in the regulation of agronomic traits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SPRING VALLEY AGRISCIENCE CO LTD
- Filing Date
- 2026-04-02
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies have failed to fully explore the potential of the VRN3 gene in regulating multiple agronomic traits in wheat breeding, resulting in limited application in regulating wheat flowering transition and agronomic traits, especially in improving yield, plant structure and reproductive methods.
By using reverse genetics, the wheat VRN3 gene is knocked out or inactivated, and CRISPR-Cas9 gene editing technology is used to achieve changes in spike structure, adventitious root production, and the creation of perennial reproductive materials, including the cultivation of adventitious roots and multiple florets and spikelets at stem nodes.
It significantly improves the application efficiency and value of the VRN3 gene, breaks through the traditional spikelet type limitation, increases the number of grains per spikelet, realizes the asexual reproduction and perennial ecological greening of wheat, provides a new hybrid seed production system and genetic sterility source, and adapts to the growth period regulation of different ecological zones.
Smart Images

Figure CN122012601A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a gene that regulates wheat flowering transition and agronomic traits and its applications. Background Technology
[0002] The transition of wheat from vegetative to reproductive growth is the result of joint regulation by genes and the environment. Flowering time plays a crucial role in plant reproduction. Among the three types of genes (vernalization genes, photoperiod genes, and early maturity genes), vernalization genes account for 70%-75% of the control over the entire wheat growth cycle, participating in processes such as heading and flowering, and thus holding a pivotal position. Currently, four main genes are known to control vernalization in wheat: VRN1 , VRN2 , VRN3 , VRN4 Wheat materials carrying different near-isogenic lines of the vernalization gene showed significant differences in the time they reached the two-ridge stage, indicating that different genotypes of the vernalization gene have a certain influence on the flowering time of wheat, regulating the heading period and winter-spring nature of wheat, and controlling the flowering time of wheat.
[0003] Studying the interactions between vernalization genes is of great significance for breeding, introduction, cultivation, production, and utilization. Salina E et al.'s study of heading-related genes in 95 common wheat varieties found that... VRN-B1 , VRN-B3 Wheat varieties containing different alleles contribute the most to wheat genetic diversity and can serve as a potential source of natural variation for creating materials with suitable heading dates (Berezhnaya et al., 2021). Chen et al. found that vernalization genes and their copy number variations have important effects on flowering and maturity, which is significant for breeding early-maturing varieties and avoiding the impact of hot and dry winds on wheat yield reduction (Chen et al., 2013). Studies have shown that... VRN-A3 Alleles are the main reason why cultivated emmer wheat can flower under low-latitude, short-day conditions (Nishimura et al., 2021).
[0004] The seed production and selection system is a crucial step in wheat breeding. Spin-transfer (SPT) technology was the earliest proposed hybrid seed production and selection system. This technology uses the addition of fluorescent protein genes to screen offspring seeds and obtain materials with target traits. In agricultural production, the use of gene-edited crops may pose safety risks, requiring regulatory approval and involving complex procedures. However, obtaining wheat materials that cannot produce seeds through gene editing can solve the hidden safety issues associated with gene editing. Currently, SPT technology mainly relies on utilizing and mining sterile genes to maintain and propagate sterile lines. Compared to cytoplasmic male sterility and nucleocytoplasmic interaction male sterility, utilizing and developing genetically stable nuclear male sterility genes can solve problems such as the failure of self-crossing in F1 from cytoplasmic maternal parents and the low purity and yield of hybrid seeds due to cytoplasmic homogeneity.
[0005] Like many annual crops, cultivated wheat is an annual or biennial herbaceous plant. Unlike perennial crops, which have well-developed root systems that prevent soil erosion and better absorb and utilize soil nutrients, annual crops have lower water and nitrogen fertilizer utilization rates (Glover et al., 2010; Randall & Mulla, 2001). Perennial growth habit is a quantitative trait controlled by multiple genes, with a complex genetic mechanism. Zhai et al. discovered three MADS-box genes in Arabidopsis that determine perenniality. FLOWERING LOCUS C ( FLC ), FLOWERING LOCUS M ( FLM )and MADS AFFECTING FLOWERING ( MAF By introducing any one of these genes into annual materials, the materials can be transformed into perennials (Zhai et al., 2024). Madrid et al., through genetic, transgenic, and genomic methods, studied annual and perennial Arabidopsis materials and found that... AmMAR1 It is an important flowering inhibitor, indirectly affecting the life cycle of perennial and annual wheat (Madrid et al., 2021). Perennial wheat can not only provide valuable resources for variety breeding and quality improvement, but also be used for grassland ecological management, forage cultivation, and increasing green coverage, making it an important direction for future wheat research.
[0006] The discovery and application of genes controlling desirable traits in wheat are of great significance for breeding new wheat varieties, expanding wheat applications, and protecting food security. Wheat is an important food crop in my country. Although wheat genes and varieties have been studied extensively, there is relatively little research on reusing located and cloned genes to enhance their practical value. Summary of the Invention
[0007] In view of the above-mentioned prior art, the purpose of this invention is to provide a gene that regulates wheat flowering transition and agronomic traits, and its application. This invention is not limited to... VRN3 Instead of focusing on the gene's known flowering-promoting function, reverse genetics has systematically revealed its multiple new functions in controlling spike organ differentiation, stem-root development conversion, and plant architecture. This greatly expands the application boundaries of this gene, transforming a single "flowering time gene" into a multi-functional breeding tool that can be used to synergistically improve yield, reproductive methods, and plant architecture, significantly improving the utilization efficiency and value of known genetic resources.
[0008] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides wheat VRN3 The application of genes in any of the following (1)-(3): (1) It produces adventitious spikelets or compound spikelets, resulting in changes in spike structure; (2) Adventitious roots are produced at the nodes of the stem; (3) Cultivate wheat varieties with many small flowers and spikelets; (4) Cultivating perennial or asexually reproducing plant materials; The wheat VRN3 The genes are TraesCS7A02G115400.1, TraesCS7B02G013100.1, or TraesCS7D02G111600.1.
[0009] The TraesCS7A02G115400.1 gDNA sequence is shown in SEQ ID NO.1, and is as follows:
[0010] The TraesCS7A02G115400.1 cDNA sequence is as shown in SEQ ID NO.2, specifically as follows: ATGGCCGGGAGGGACAGGGACCCGCTGGTGGTTGGCAGGGTTGTGGGAGACGTGCTGGACCCCTTTGTCCGGACCACCAACCTCAGGGTGACCTTCGGGAACAGGACCGTGTCCAACGGCTGCGAGCTCAAGCCGTCCATGGTCGCCCAGCAGCCCAGGGTTGAGGTGGGCGGCAATGAGATGAGGACCTTCTACACACTCGTGATGGTAGACCCAGATGCTCCAAGTCCAAGCGATCCCAACCTTAGGGAGTATCTCCACCTTGTGACAGATATCCCCGGTACAACTGGTGCCTCGTTCGGGCAGGAAGTGATGTGCTATGAGAGCCCTCGTCCGACCATGGGGATCCACCGCTTCGTGCTCGTGCTCTTCCAGCAGCTCGGCCGGCAGACGGTGTACGCCCCCGGGTGGCGCCAGAACTTCAACACCAGGGACTTCGCCGAGCTCTACAACCTTGGCCCGCCCGTCGCCGCCGTCTACTTCAACTGCCAGCGTGAGGCCGGCTCCGGTGGCAGGAGGATGTACAATTGA。
[0011] The TraesCS7B02G013100.1 gDNA sequence is as shown in SEQ ID NO.3, specifically as follows:
[0012] The TraesCS7B02G013100.1 cDNA sequence is as shown in SEQ ID NO.4, specifically as follows: ATGGCCGGTAGGGATAGGGACCCGCTGGTGGTTGGCAGGGTTGTGGGGGACGTGCTGGACCCCTTCGTCCGGACCACCAACCTCAGGGTGACCTTCGGGAACAGGACCGTGTCCAACGGCTGCGAGCTCAAGCCGTCCATGGTCGCCCAGCAGCCCAGGGTTGAGGTGGGCGGCAATGAGATGAGGACCTTCTACACACTCGTGATGGTAGACCCAGATGCTCCAAGTCCAAGCGATCCCAACCTTAGGGAGTATCTCCACTGGCTTGTGACAGATATCCCCGGTACAACTGGTGCGTCGTTCGGGCAGGAGGTGATGTGCTACGAGAGCCCTCGTCCGACCATGGGGATCCACCGCTTCGTGCTCGTACTCTTCCAGCAGCTCGGGCGGCAGACGGTGTACGCCCCCGGGTGGCGCCAGAACTTCAACACCAGGGACTTCGCCGAGCTCTACAACCTCGGCCCGCCTGTCGCCGCCGTCTACTTCAACTGCCAGCGTGAGGCCGGCTCCGGCGGCAGGAGGATGTACAATTGA。
[0013] The TraesCS7D02G111600.1 gDNA sequence is as shown in SEQ ID NO.5, specifically as follows:
[0014] The cDNA sequence of TraesCS7D02G111600.1 is shown in SEQ ID NO.6, and is as follows: .
[0015] The adventitious roots generated at the stem nodes can be transplanted and the resulting tillers can survive and develop into new independent plants.
[0016] Preferred, by knocking out VRN3 Genes that alter the spike structure of wheat plants and / or produce adventitious roots at stem nodes.
[0017] The knockout VRN3 Genes include those that cause frameshift mutations or loss-of-function mutations in at least one allele.
[0018] In a second aspect, the present invention provides wheat VRN3 The application of the gene-encoded protein in the following (1) or (2): (1) It produces adventitious spikelets or compound spikelets, resulting in changes in spike structure; (2) Adventitious roots are produced at the nodes of the stem.
[0019] Preferably, by reducing wheat VRN3 The expression of gene-encoded proteins alters the spike structure of wheat plants and / or produces adventitious roots at stem nodes; Or through inactivated wheat VRN3 Gene-encoded proteins alter the spike structure of wheat plants and / or produce adventitious roots at stem nodes.
[0020] In a third aspect, the present invention provides a method for creating plant materials capable of asexual reproduction or having perennial characteristics, comprising the steps of: (1) Constructing a system for wheat VRN3 The CRISPR-Cas9 gene editing vector was introduced into plant recipient cells, and transgenic plants were regenerated and obtained. (2) Screening positive plants that produce adventitious root phenotypes at stem nodes during the vegetative growth stage.
[0021] Preferably, the method is used to create asexually propagated wheat, perennial wheat, forage wheat, or wheat materials for landscaping.
[0022] In a fourth aspect, the present invention provides a method for asexual reproduction of wheat, comprising: obtaining a positive wheat plant that produces an adventitious root phenotype at the stem node during the vegetative growth stage, cutting off the tillers with adventitious roots at the stem node, and transplanting the tillers for cultivation, so as to obtain offspring plants with the same genetic background through asexual reproduction.
[0023] In a fifth aspect, the present invention provides a method for knocking out or inactivating wheat. VRN3 Gene-edited wheat plants obtained by gene editing are characterized by having one or more of the following traits (a) to (e): (a) Produces adventitious spikelets or compound spikelets; (b) Adventitious roots are produced at the stem nodes; (c) Delayed flowering or prolonged vegetative growth stage; (d) Plant height decreased; (e) Reduced pollen fertility or infertility.
[0024] The beneficial effects of this invention are: 1. This invention achieves this by knocking out VRN3 The gene successfully induced the production of adventitious and compound spikelets in wheat ears, breaking through the limitations of traditional ear types. This ear type variation directly led to a significant increase in the number of florets per spikelet, with a maximum of up to 13, far exceeding that of wild-type varieties. This trait lays the genetic foundation for directly increasing the potential for increasing the number of grains per wheat ear and provides key parental materials for breeding high-yield and ultra-high-yield wheat varieties.
[0025] 2. This invention is the first to utilize gene editing. VRN3 Genes have been successfully induced in common annual wheat to produce the key trait of adventitious roots at stem nodes. These adventitious roots possess complete physiological functions, and the tillers from which they originate can be separated and transplanted, rapidly developing into new independent plants, thus achieving vegetative asexual reproduction of wheat. This breakthrough makes it possible to create perennial wheat, evergreen forage wheat, or wheat for ecological greening, potentially significantly reducing agricultural inputs and improving water and soil resource utilization.
[0026] 3. VRN3 Gene editing can severely delay wheat flowering or even keep it in the vegetative growth stage for an extended period, accompanied by a significant reduction in plant height. This provides a direct technical means for artificially regulating wheat growth stages to adapt to different ecological zones or avoid seasonal stresses. Furthermore, edited materials with delayed flowering and significantly reduced pollen fertility can serve as valuable genetic male sterility sources for constructing novel, cytoplasm-independent wheat hybrid seed production systems. Attached Figure Description
[0027] Figure 1 The image shows the phenotype of the vernalization barrier material obtained by EMS mutagenesis in Example 1.
[0028] Figure 2 The image shown is from Example 1. VRN3 Schematic diagram of gene knockout vector characteristics.
[0029] Figure 3 The image shown is from Example 2. VRN3 A diagram illustrating gene knockout positive screening.
[0030] Figure 4 The image shown is from Example 3. VRN3 Edit the plant structure of wheat; where the scale bar = 10 cm (a1, b1, c1 and d1; scale bar is placed on d1); the scale bar = 1 mm (enlarged views of a2, b2, c2 and b3; scale bar is placed on c2); the scale bar = 1 mm (d2); the scale bar = 1 cm (a3, b3, c3 and d3; scale bar is placed on d3).
[0031] Figure 5 The examples shown are from embodiments 3 and 4. VRN3Edited wheat spike structure and internode growth; where a) edited plants with adventitious spikelets; b) edited plants with paired spikelets; c) wild-type plants with normal spikelets; a1, b1 and c1 are whole plants (scale bar = 10 cm, scale bar placed at c1); a2, b2 and c2 are spikes and single spikelets (scale bar = 1 cm, scale bar placed at c2); d) formation of adventitious buds and roots: original T0 plants (d1) and a branch 0 days (d2), 5 days (d3), 10 days (d4), 20 days (d5) and 5 months after transplanting (d6); scale bars are 10 cm (d1 and d6) and 5 cm (d2-d5, scale bar placed at d5).
[0032] Figure 6 The image shown is from Example 2. VRN3 Gene editing results are categorized and summarized; among them, a) VRN3 a) BSD (Block Spectrum Deletion) at T3; b) Non-BSD type edit at T4; c) Non-BSD type edit at T4. The upper part of the figure shows the original spacer adjacent motif (PAM) and the 20 bp target sites (N1 to N20). NNNNs represent unsequenced bases between T3 and T4. Short red lines in orange cells represent deleted nucleotides, and red bases represent inserted nucleotides. Detailed Implementation
[0033] The following examples are all experiments conducted under the premise of this invention, and the scope of protection includes, but is not limited to, the following results. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0034] As mentioned above, VRN3 Genes, as important florigen signals, play a crucial role downstream of photoperiod and vernalization pathways. Traditional research and breeding applications have largely focused on utilizing... VRN3 While natural allelic variations or expression differences in genes are used to regulate flowering time in order to breed early- or late-maturing varieties adapted to different ecological environments, their pleiotropic regulatory potential has not been fully explored. This invention aims to systematically explore... VRN3 The application value of genes in the synergistic improvement of multiple agronomic traits in wheat.
[0035] To achieve the above objectives, this invention is based on chromosomes 7A, 7B, and 7D of the Chinese Spring chromosome. VRN3 Using the gene as a reference genome, knockout targets are designed in its conserved regions. Edited materials are obtained using gene editing technology, and the results are validated. VRN3 The influence of genes on wheat flowering transition and agronomic traits.
[0036] The transgenic positive seedlings exhibited four significantly different phenotypes due to variations in gene dosage after gene editing: 1) Tillering type TO, this type of plant has no stem elongation and does not flower (Fig. 4a).
[0037] 2) Elongation type EO: This type of plant has slightly elongated stems but does not flower (Fig. 4b).
[0038] 3) Delayed heading and mature dHR: In this type of plant, aerial nodes can form aerial buds, producing mature spikelets and spikelets, but the spikelets are adventitious spikelets, and pollen viability and / or seed setting rate may be reduced (Fig. 4c).
[0039] 4) Normal heading and mature rHR type. This type of plant is also considered as wild-type WT group. The plant growth is similar to non-transgenic wild-type plants (Fig. 4d).
[0040] Over time, some EO-type plants (such as A95, A134, A149, A151 and A661) will eventually produce spikes and bear fruit, and will eventually be classified as dHR (Table 2).
[0041] In the gene-edited material, the plants exhibited a prolonged vegetative growth state and did not elongate. Stem dissection revealed that the young spikelets were in the two-ridge stage, and the plant height was reduced (see attached diagram in the instruction manual). Figure 4 (As shown in Table 2). In the Fielder material, we ultimately obtained 30 T0 plants with distinct phenotypes. A244, A506, and A666 were... VRN3 No editing was performed on these plants; their plant height and flowering time were normal (rHR phenotype), and they were used as wild-type controls. The mean plant height of the rHR group was approximately 79.0 cm (±1.5). In contrast, the other 24 plants... VRN3 The average plant height (excluding A159, A373, and A662) was approximately 61.2 cm (±1.6). Notably, the T0 plants A159 and A662 remained at either the tillering (TO) or jointing (EO) stage in the greenhouse, with heights ranging from approximately 33 to 48 cm. Sixteen JM38 T0 plants were also analyzed in this study (Table 2). The only WT-like plant, A131, was a heterozygote of the WT alleles at both the T3 and T4 loci. A131's plant height was approximately 65 cm. In contrast, the only T3 mutant, A10, had a plant height of 48 cm. The T3T4 double mutant dHR group had a plant height of 51.3 cm (±1.7). The T3T4 double mutant TO and EO group had a plant height of 42 cm (±3.3).
[0042] The above results indicate that VRN3 Loss of gene function has a significant impact on the transition of wheat from vegetative to reproductive growth and on plant height. VRN3 Complete gene deletion can maintain the long-term vegetative growth state of wheat, and this trait can be used to create dwarf wheat and sterile lines. After pruning the leaves above the growth point of the non-jointing material, the plant will continue to grow new leaves, exhibiting the perennial growth habit of turfgrass. This trait can be used to cultivate green wheat or pasture wheat.
[0043] In the Fielder genotype, the flowering time of the wild-type control material was approximately 51.7 days (±0.9), and the fruit set rate was approximately 82.3% (±2.5%); 24 plants VRN3 Edited plants (except A159, A373, and A662) could flower and bear fruit, but flowering was delayed, with a flowering time of approximately 216.8 days (±18.3) and a fruit set rate of approximately 15.5% (±2.3%). Plants A159 and A662 did not flower for over 570 days. In the JM38 material, WT-type plants flowered for 81 days with a fruit set rate of 30%, the T3 mutant A10 flowered for 361 days with a fruit set rate of 9%, the T3T4 double mutant dHR group flowered for 453.5 days (±13.1) with a fruit set rate of 7% (±3.7), and the T3T4 double mutant TO and EO groups remained in a vegetative growth state for up to 563 days without flowering or bearing fruit. In the late-flowering edited materials, we observed phenotypes of adventitious spikelets and compound spikelets (…). Figure 5 The above results indicate that it is possible to utilize... VRN3 By cultivating materials with different genotypes and suitable flowering periods, as well as more small flowers and spikelets, wheat yield can be increased.
[0044] In addition to its effect on flowering, some T0 plants also developed aerial stem branching ( Figure 5 These branches developed from high-level tillers, with adventitious roots forming at their base. We transplanted these branches with adventitious roots into the soil. Five days later, we observed new tillers forming at the adventitious roots and differentiating into new tillers. The transplanted material grew normally in the soil, providing a potential foundation for asexual reproduction of wheat and the cultivation of perennial wheat.
[0045] This invention fully utilizes the above-mentioned phenotypic variations to reveal VRN3 A new direction for the application of genes: This invention provides known VRN3 The application of genes in breeding new varieties. VRN3 Gene deletion increases the number of florets, with up to 13 florets per spikelet. This characteristic can be used to create multiflora varieties.
[0046] This invention provides VRN3 The application of genes in creating hybrid seed production systems. VRN3Gene deletion causes wheat to remain in a prolonged vegetative growth stage, resulting in reduced plant height and failure to head. This trait can be used to produce sterile lines. The phenotype of prolonged vegetative growth described in this invention is... VRN3 This was observed under conditions of complete gene knockout.
[0047] This invention provides VRN3 Application of genes in the cultivation of perennial, asexually propagated materials. VRN3 The material with missing genes remains in the vegetative growth stage for a long time, and new tillers are constantly being generated from the roots. This part of the material can survive for more than a year. VRN3 Adventitious roots are produced at the stem nodes of materials with missing genes. After transplanting, the tillers from these adventitious roots can grow into new plants. Based on this phenotype, perennial or asexually reproduced materials can be created.
[0048] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.
[0049] The experimental materials used in the embodiments of this invention, unless specifically described, are all conventional experimental materials in the art and can be purchased through commercial channels. The experimental procedures not described in detail in this invention are all familiar to those skilled in the art and can be obtained from literature or descriptions. The regenerated seedlings obtained by the Agrobacterium-mediated wheat genetic transformation method used in this invention were all obtained from tissue culture companies.
[0050] Example 1: Targeting VRN3 Construction of CRISPR-Cas9 knockout vector for genes According to the previous period VRN3 Phenotypic results of genes in EMS mutants ( Figure 1 ), based on the wheat Chinese spring genome VRN3 Two sgRNA targets were designed using the genes (TraesCS7A02G115400.1, TraesCS7B02G013100.1, TraesCS7D02G111600.1). Specific primers for constructing the CRISPR-Cas9 knockout vector were synthesized based on the target sequences, and the primer sequences are shown in Table 1.
[0051] Table 1: Used for building VRN3 Primer sequences for gene knockout vectors Nested PCR and "cut-and-ligate" cloning were employed. Using the primer pairs described above (SvfuP138 / SvfuP139 for the first target T3, and SvfuP140 / SvfuP141 for the second target T4), PCR amplification was performed using the SVPC0009 vector as a template to obtain a dual sgRNA expression cassette. Subsequently, the purified and recovered dual sgRNA expression cassette fragment was mixed with the SVPC0008 vector and subjected to cut-and-ligate using BsaI restriction enzyme and NEBridge ligase premix containing T4 DNA ligase to construct the final CRISPR-Cas9 gene editing vector for stable genetic transformation of wheat. The structure of this vector is shown below. Figure 2 As shown.
[0052] Example 2: Wheat genetic transformation and the acquisition of edited plants 1. Genetic transformation and positive seedling screening: The CRISPR-Cas9 gene editing vector prepared in Example 1 was introduced into Agrobacterium strain EHA105 via freeze-thaw method. Using immature embryos of spring wheat variety 'Fielder' and semi-winter wheat variety 'Jimai 38' (JM38) as explants, Agrobacterium-mediated genetic transformation was performed, resulting in 104 T0 generation regenerated seedlings. The regenerated seedlings were then tested by PCR using the positive identification primers SV70 / SV71 listed in Table 1. Figure 3 Transgenic positive plants were selected.
[0053] 2. Editing Efficiency and Genotyping: Eighty seedlings were selected from the positive regenerated seedlings, and their genomic DNA was extracted for PCR amplification and sequencing analysis to accurately analyze the editing type (e.g., base deletion, insertion, or substitution), editing efficiency (biallelic editing, heterozygous editing, etc.), and specific genotype of each plant at the two target sites (T3 and T4). Based on the sequencing results, the plants were classified into the following main mutation types (as shown in Table 2), and representative plants were selected for subsequent phenotypic analysis. Among them: WT: No editing occurred at either target site (wild-type control).
[0054] T3 single-target editing: Effective Indel mutations occur only at the T3 target.
[0055] T4 single-target editing: Effective Indel mutations occur only at the T4 target.
[0056] T3 / T4 dual-target editing: Effective Indel mutations occurred at both T3 and T4 targets.
[0057] Editing occurring simultaneously at both T3 and T4 sites is classified as intersite deletion (BSD), divided into two major groups: BSD1 (19%) and BSD2 (73%), and one rare group: BSDRA. Editing at only the T3 site (Non-BSD) is divided into 10 major groups and 1 rare group. T3In1A, T3In1T, and T3In1C are the major groups that insert bases A, T, and C at the classic cleavage site, accounting for 10%, 14%, and 13% of all Non-BSD mutations, respectively. The other 7 major groups have different base deletions at T3, accounting for 50% of all Non-BSD mutations. Editing at only the T4 site (Non-BSD) is further divided into... There are 11 major groups and 1 rare group. T4In1A and T4In1T have A and T bases inserted at typical cleavage sites, accounting for 10% and 11% of all Non-BSD mutations, respectively. T4InDe0A and T4InDe0T may be formed by a deletion and an insertion, or by a substitution, accounting for 2% and 3% of all Non-BSD mutations, respectively. The other 7 major groups have different deletions at the T4 target site, accounting for 57% of all Non-BSD mutations. Figure 6 ).
[0058] Example 3: VRN3 Synthetic phenotypic analysis of agronomic traits of the edited plants T0 generation edited plants and wild-type controls were grown under the same greenhouse conditions, and their growth, development, and key agronomic traits were systematically observed and recorded. The main results are summarized in Table 2, and detailed analysis follows: 1. Flowering time and reproductive development: Wild-type 'Fielder' plants typically flower and head about 51.7 days after sowing.
[0059] VRN3 Gene editing significantly delayed the flowering time of the vast majority of plants. Plants with single-target editing (such as A498 with T4 editing) had a flowering time extended to 110-188 days; plants with dual-target editing had a more severe delay, with most flowering in 180-552 days (such as A170 and A372).
[0060] Some dual-target edited plants (such as A159 and A662 with the 'Fielder' background and A59 and A49 with the 'Jimai 38' background) remained in the vegetative growth stage throughout the observation period of more than 560 days, without showing jointing or heading.
[0061] 2. Plant height: Compared to the wild type ('Fielder' average plant height 79.0 cm), edited plants generally showed a reduced plant height. The average plant height of edited plants that eventually produced spikelets was approximately 61.2 cm.
[0062] Plants that are in a long-term vegetative growth state (non-jointing type) are significantly shorter, usually between 33-48 cm.
[0063] 3. Ear type variation: Significant changes in spike structure were commonly observed in edited plants that were delayed in flowering but eventually formed spikes (dHR type). Figure 5 The main types of variation include: adventitious spikelets (spickles arising from atypical positions) and compound spikelets (two or more spikelets growing on a single rachis node, arranged in opposite or clustered pairs). Figure 5 a, b). In contrast, wild-type spikelets are typically arranged in a regular, solitary pattern. Figure 5 c).
[0064] Anatomical observation of the spikelet structure revealed that edited plants exhibiting spikelet type variation had a significantly higher number of floret primordia per spikelet compared to the wild type. Statistical data showed that some edited plants had up to 13 florets per spikelet, far exceeding the 3-5 florets in the wild type.
[0065] 4. The generation of adventitious roots: During continuous observation of plants in the vegetative growth stage, adventitious root formation was observed at stem nodes of some plants with dual-target editing and significantly prolonged growth period. Figure 5 d1). These adventitious roots arise directly from the base of the high-level tillers and are aerial roots of the above-ground parts.
[0066] Table 2 VRN3 Genotype and agronomic traits Note: TO (Tillering Only): Plants do not elongate, maintaining a rosette shape throughout, and never produce ears during the observation period. EO (Elongation Only): Stems elongate slightly, but fail to complete spikelet differentiation or emerge from the flag leaf sheath, and do not produce ears during the observation period. dHR (Delayed Heading): Plants complete reproductive growth and produce ears and seeds, but the heading date is significantly delayed (usually >100 days) compared to the wild-type control at the same background. This type may be accompanied by traits such as adventitious spikelets, compound spikelets, or reduced fertility. rHR (Normal Heading): Heading date and agronomic traits are not significantly different from the wild-type control. NA = Not Applicable. A449 This indicates that the single plant is in VRN1 Genetic editing also occurred. NA This indicates that the two plants died between February and July 2025, and it is unknown whether they will be able to produce spikes and flowers.
[0067] Example 4: Verification of asexual reproduction ability based on adventitious roots of stem nodes To prove by knocking out VRN3 The induced adventitious roots have practical potential for asexual reproduction. In this embodiment, robust edited plants capable of producing adventitious roots at the stem nodes were selected as donors. Using a sterilized blade, intact above-ground tillers with well-developed adventitious roots were carefully cut from the stem nodes of the mother plant. The cut "rooted tillers" were directly transplanted into pots filled with sterilized nutrient soil and placed in a greenhouse for routine management.
[0068] Five days after transplanting: Adventitious roots continue to grow and new tillers sprout nearby. Figure 5 d3).
[0069] 10-20 days after transplanting: Newly sprouted tillers grow rapidly, unfold green leaves, and form an independent photosynthetic autotrophic system. Figure 5 d4, d5).
[0070] Five months after transplanting: The transplanted plant has successfully developed into a robust new plant with multiple tillers. Figure 5 (d6), and can produce adventitious roots again at the stem nodes in new growth cycles, showing characteristics of perennial and cyclical reproduction.
[0071] This experiment confirms that VRN3 The adventitious roots generated by the editing-induced stem nodes can support the independent survival and regeneration of the above-ground tillers attached to them into new individuals, providing a practical and feasible technical path for the asexual reproduction of wheat and the cultivation of perennial wheat materials.
[0072] Example 5: Potential application evaluation of spikelet type variant materials The reproductive characteristics of dHR-type edited plants with indeterminate / compound spikelet phenotypes were investigated: 1. Fertility analysis: In the Fielder background material, although these plants eventually flowered, their average seed set rate (15.5%) was significantly lower than that of the wild type (82.3%). Pollen iodine staining analysis showed that their pollen fertility was generally reduced.
[0073] 2. Application areas: High-yield breeding with multiple florets / spikes: The trait of significantly increased number of florets per spikelet can be introduced into superior cultivars through hybridization and backcrossing to breed new wheat lines with greater high-yield potential.
[0074] Hybrid seed production sterile lines: Their characteristics of severely delayed flowering and reduced pollen fertility make them suitable as basic materials for further breeding of photoperiod- and temperature-sensitive or genetically male-sterile lines for wheat hybrid seed production, thereby establishing a new hybrid seed production system using this material.
[0075] The above embodiments illustrate in detail and completely how to knock out wheat using CRISPR-Cas9 technology. VRN3Gene-based methods. Experimental results fully demonstrate that this operation can create two types of novel materials with significant application value: Spike type improvement materials: produce adventitious / compound spikelets, increase the number of florets, and provide new germplasm for high-yield breeding.
[0076] Asexual reproduction / perennial material: Inducing the production of adventitious roots with regenerative capacity at stem nodes lays the material foundation for the realization of asexual reproduction and perennial cultivation of wheat.
[0077] The above description is merely a preferred embodiment of this application and is not intended to limit the application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications made within the spirit and principles of this application are not permitted. Equivalent substitutions and improvements should all be included within the scope of protection of this application.
Claims
1. Wheat VRN3 The application of genes in any of the following (1)-(3): (1) It produces adventitious spikelets or compound spikelets, resulting in changes in spike structure; (2) Adventitious roots are produced at the nodes of the stem; (3) Cultivate wheat varieties with many small flowers and spikelets; (4) Cultivating perennial or asexually reproducing plant materials; The wheat VRN3 The genes are TraesCS7A02G115400.1, TraesCS7B02G013100.1, or TraesCS7D02G111600.
1.
2. The application according to claim 1, characterized in that, The adventitious roots generated at the stem nodes can be transplanted and the resulting tillers can survive and develop into new independent plants.
3. The application according to claim 1, characterized in that, By knocking VRN3 Genes that alter the spike structure of wheat plants and / or produce adventitious roots at stem nodes.
4. The application according to claim 1, characterized in that, The knockout VRN3 Genes include those that cause frameshift mutations or loss-of-function mutations in at least one allele.
5. The wheat according to claim 1 VRN3 The application of the gene-encoded protein in the following (1) or (2): (1) It produces adventitious spikelets or compound spikelets, resulting in changes in spike structure; (2) Adventitious roots are produced at the nodes of the stem.
6. The application according to claim 5, characterized in that, By reducing wheat VRN3 The expression of gene-encoded proteins alters the spike structure of wheat plants and / or produces adventitious roots at stem nodes; Or through inactivated wheat VRN3 Gene-encoded proteins alter the spike structure of wheat plants and / or produce adventitious roots at stem nodes.
7. A method for creating plant materials capable of asexual reproduction or having perennial characteristics, characterized in that, Including the following steps: (1) Constructing a system for wheat VRN3 The CRISPR-Cas9 gene editing vector was introduced into plant recipient cells, and transgenic plants were regenerated and obtained. (2) Screening positive plants that produce adventitious root phenotypes at stem nodes during the vegetative growth stage.
8. The method according to claim 7, characterized in that, The method is used to create asexually propagated wheat, perennial wheat, forage wheat, or wheat materials for landscaping.
9. A method for asexual reproduction of wheat, characterized in that, include: According to the method described in claim 7, wheat positive plants that produce adventitious root phenotypes at stem nodes during the vegetative growth stage are obtained. Tillers with adventitious roots at stem nodes are cut off and transplanted for cultivation to obtain offspring plants with the same genetic background through asexual reproduction.
10. A method for knocking out or inactivating wheat VRN3 Gene-edited wheat plants obtained through gene editing are characterized by: The plant has one or more of the following traits (a) to (e): (a) Produces adventitious spikelets or compound spikelets; (b) Adventitious roots are produced at the stem nodes; (c) Delayed flowering or prolonged vegetative growth stage; (d) Plant height decreased; (e) Reduced pollen fertility or infertility.