Beef cattle pregnancy duration typing method based on P3H3, GGTA1 and TMEM161B gene SNP (Single Nucleotide Polymorphism) and application of beef cattle pregnancy duration typing method

By detecting SNP sites in the P3H3, GGTA1, and TMEM161B genes, and using SNaPshot technology, early genotyping and genetic prediction of bovine gestation duration traits were achieved. This solved the problems of long breeding cycles and low reproductive efficiency in existing technologies, enabling early screening of individuals with short gestation duration and improving breeding efficiency.

CN122012679APending Publication Date: 2026-05-12SOUTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SOUTHWEST UNIV
Filing Date
2026-01-29
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies struggle to accurately predict bovine gestation duration traits in the early stages, resulting in long breeding cycles, high costs, and low reproductive efficiency. There is a lack of efficient detection and typing methods suitable for production practices.

Method used

Using SNaPshot single-base extension typing technology, by detecting SNP sites in the P3H3, GGTA1, and TMEM161B genes and combining them with fluorescently labeled single-base extension reactions, we can achieve rapid and accurate typing and genetic prediction of bovine gestation duration traits.

Benefits of technology

Genetic prediction can be performed in the early stages of calves without relying on phenotypic records, shortening the breeding cycle, improving selection accuracy and reproductive efficiency, and building a high-reproductive-performance beef cattle breeding population.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012679A_ABST
    Figure CN122012679A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular genetic breeding, and particularly discloses a beef cattle pregnancy duration typing method based on P3H3, GGTA1 and TMEM161B gene SNP and application of the beef cattle pregnancy duration typing method. The method comprises the following steps that 1, cattle genome DNA serves as a template, specific primer pairs P1, P2 and P3 are adopted, and target fragments of the P3H3 gene, the GGTA1 gene and the TMEM161B gene are amplified through PCR; 2) adopting extension primers P4, P5 and P6, combining SNaPshot single base extension reaction, respectively performing typing analysis on targeted SNP sites in the PCR amplification product obtained in the step 1) so as to realize accurate identification of genotypes of the SNP variation sites in the P3H3, GGTA1 and TMEM161B genes, the detection typing method based on the SNP variation of the P3H3, GGTA1 and TMEM161B genes provided by the invention is not limited by individual age and fetal number factors, and can be used for detecting the genotypes of the SNP variation sites in the P3H3, GGTA1 and TMEM161B genes. The method can be implemented in the early stage of the calves, is beneficial to genetic prediction of individual pregnancy duration traits without depending on phenotypic records, and provides effective technical support for early breeding and accurate selection and retention of beef cattle.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular genetic breeding technology, and in particular to a method for genotyping the gestation duration of beef cattle based on SNPs of the P3H3, GGTA1, and TMEM161B genes and its application. Background Technology

[0002] Gestation duration is a crucial biological trait affecting the reproductive efficiency and breeding progress of beef cattle, directly influencing the average number of calves per year, the concentration of calf births, and the health of peripartum calves. Excessive gestation duration not only prolongs breeding intervals and reduces average annual reproductive efficiency but also increases the risk of dystocia and peripartum diseases, thus hindering the propagation speed and production efficiency of superior beef cattle breeds. Therefore, in breeding practice, accurately assessing and prioritizing the selection of breeding individuals with shorter gestation durations is of great significance for improving the reproductive efficiency of the core herd and accelerating breed selection and genetic improvement.

[0003] Gestation duration is a typical quantitative trait, regulated by multiple genes and influenced by a combination of genetic background and environmental factors. Traditional breeding methods rely mainly on long-term phenotypic records and generational selection, which is not only time-consuming and costly, but also makes it difficult to accurately predict and select for gestation duration traits in early calves, severely limiting the efficiency of genetic improvement.

[0004] With the continuous development of molecular biology techniques and genomics research, marker-based genetic selection technology has provided a new technical means for the early prediction of quantitative traits. By identifying molecular markers that are significantly associated with target traits and applying them to breeding practices, early assessment of an individual's genetic potential can be achieved without relying on phenotypic data, thereby significantly shortening the breeding cycle and improving selection accuracy.

[0005] Single nucleotide polymorphisms (SNPs) are the most common and stable form of genetic variation in the genome, referring to a single base difference with a frequency greater than 1% in a population. SNPs have advantages such as wide distribution, genetic stability, and high-throughput detection, and have been widely used in genetic research on traits such as animal growth and development, reproductive performance, and disease resistance. Therefore, screening for SNP loci of functional genes significantly associated with bovine gestation duration and using them as molecular markers for early prediction and selection shows promising application prospects.

[0006] Among existing SNP detection technologies, SNaPshot single-base extension genotyping technology is widely used due to its ease of operation, moderate throughput, and high genotyping accuracy. Based on a fluorescently labeled single-base extension reaction, this technology can accurately genotype multiple SNP sites in a single reaction, making it suitable for rapid, low-cost detection of large-scale population samples. It effectively meets the dual requirements of detection efficiency and accuracy in molecular breeding practices.

[0007] Previous studies have shown that multiple functional genes participate in biological processes such as embryonic development, pregnancy maintenance, and the initiation of labor, and may have a significant impact on gestation duration. Among them, the TMEM161B gene encodes a transmembrane protein with a highly conserved biological function during embryonic nervous system development; abnormal expression of this gene may lead to embryonic developmental disorders, thus affecting pregnancy progress. The GGTA1 gene encodes α1,3-galactosyltransferase, which participates in glycoprotein synthesis and the regulation of inflammation-related signals; its metabolites are closely related to embryo implantation and maternal immune regulation. The P3H3 gene belongs to the protein 3-hydroxylase family and participates in post-translational modification of collagen, potentially playing an important regulatory role in reproductive tissues and embryonic cells. Genetic variations in these genes provide an important molecular basis for understanding the differences in bovine gestation duration.

[0008] However, current research on molecular markers for bovine gestation duration traits remains limited. There is a lack of efficient detection and genotyping methods that can simultaneously integrate multiple key functional gene SNP loci and are applicable to production practices, enabling accurate prediction of an individual's genetic potential for gestation duration at birth or early rearing stages. Therefore, it is necessary to establish an SNaPshot genotyping technology based on P3H3, TMEM161B, and GGTA1 gene SNP loci. This would provide a reliable molecular detection method for early screening of short-gestation-duration beef cattle, effectively shortening the average gestation duration of the herd, improving annual reproductive efficiency, and providing technical support for the rapid propagation and industrialization of superior beef cattle breeds such as Huaxi cattle. Summary of the Invention

[0009] To overcome the shortcomings of existing technologies, the present invention aims to provide a method for detecting and genotyping bovine gestation duration traits based on single nucleotide polymorphisms (SNPs) in the P3H3, TMEM161B, and GGTA1 genes, and its application in selective breeding for reproductive traits. By identifying the genotypes of gestation duration-related SNP sites in the above genes, rapid prediction of bovine gestation duration traits can be achieved at the DNA level. This allows for the selection of breeding individuals with shorter gestation durations and higher reproductive efficiency, thereby shortening the average gestation duration of the herd, increasing annual reproductive efficiency, and accelerating the molecular breeding process of beef cattle.

[0010] To achieve the above-mentioned objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a method for genotyping gestation duration in beef cattle based on SNPs of the P3H3, GGTA1, and TMEM161B genes, comprising the following steps: Genomic DNA was extracted from the cattle to be tested. Genotyping was performed on the SNPs associated with gestational duration traits in the P3H3, GGTA1, and TMEM161B genes located at loci 103620982 on chromosome NC_037332.1, loci 92333432 on chromosome NC_037338.1, and loci 87804249 on chromosome NC_037334.1 in the bovine reference genome ARS-UCD2.0 version. The genetic variations were single nucleotide polymorphisms occurring at the above-mentioned loci.

[0011] The genotyping was performed using SNaPshot single-base extension typing technology, which specifically included: using primers P1, P2, and P3 as PCR amplification primers to amplify gene fragments containing target SNP sites in the P3H3, GGTA1, and TMEM161B genes; subsequently, single-base extension reactions were performed using extension primers P4, P5, and P6, and the SNP sites were genotyped based on the fluorescence signals generated by the extension products, thereby obtaining the SNP genotyping results of the P3H3, GGTA1, and TMEM161B genes.

[0012] The primer pair P1 (P3H3 gene) includes: Upstream primer P1-F: 5'-ACAGGCTCATCCATTGCTTC-3' Downstream primer R1-R: 5'-AGAATGAGGCCTGTCTCTG-3'; The primer pair P2 (GGTA1 gene) includes: Upstream primer P2-F: 5'-CAGAACAAAGAGCCTTCTGG-3' Downstream primer P2-R: 5'-TGATCTCTGATTCCTCTGCC-3'; The primer pair P3 (TMEM161B gene) includes: Upstream primer P3-F: 5'- CAAAGTCCTTAGATCGTTCC -3' Downstream primer P3-R: 5'-TGGCTCTTTTGACCAGCTAC-3'; The extension primer P4 (P3H3 gene) is: 5'- CAGGGCTCCTTCTGTCCTCG -3'; The extension primer P5 (GGTA1 gene) is: 5'- gactgactGCAGCCATTATCACTGAAGCCC-3'; The extension primer P6 (TMEM161B) is: 5'- gactgactgactgacACATTTCTGTCAAAATTCTCAC-3'.

[0013] Among the individuals, those carrying the dominant genotype showed better gestational duration traits than those carrying the suboptimal genotype, exhibiting a significantly shorter gestational duration. Specifically, at the P1 locus corresponding to the P3H3 gene, the G / G genotype was dominant, while the G / T and T / T genotypes were suboptimal; at the P2 locus corresponding to the GGTA1 gene, the A / A genotype was dominant, while the C / A and C / C genotypes were suboptimal; and at the P3 locus corresponding to the TMEM161B gene, the T / T genotype was dominant, while the T / C and C / C genotypes were suboptimal.

[0014] Secondly, this invention provides the application of the above-mentioned beef cattle gestation duration genotyping method based on SNPs of the P3H3, GGTA1, and TMEM161B genes in marker-assisted selection breeding of beef cattle. By detecting and analyzing the SNP genotypes of the P3H3, GGTA1, and TMEM161B genes in the beef cattle individuals to be tested, genetic screening is performed on all individuals to be tested, thereby constructing a core breeding population with shorter gestation duration and higher reproductive efficiency, thus achieving the goal of shortening the reproductive cycle, increasing the average number of calves per year, and improving the overall efficiency of beef cattle breeding.

[0015] The SNP variant sites in the P3H3, GGTA1, and TMEM161B genes, which are associated with bovine gestation duration traits, were identified through the following steps: In this invention, Huaxi cattle were used as the research object to systematically study the discovery process of genetic variations related to gestation duration. First, gestation duration trait records for two consecutive parities were collected from 202 multiparous Huaxi cattle breeding cows, obtaining gestation duration data for the first and second parities. To reduce the influence of environmental factors and individual random errors on the trait assessment results, the average gestation duration of the two parities for the same cow was taken as the phenotypic value of gestation duration for that individual and used for subsequent genetic analysis. Whole-genome deep sequencing technology was used to sequence and analyze the 202 Huaxi cattle individuals with complete phenotypic records and clear pedigrees, with a single sample sequencing data volume of approximately 15 Gb. The sequencing data were aligned and variant detected using the bovine reference genome ARS-UCD2.0 as a reference, and the sequencing data underwent quality control and strict filtering, ultimately obtaining 1,903,967 high-quality single nucleotide polymorphism (SNP) variant sites. Furthermore, genome-wide association analysis (GWAS) methods, including mixed linear models, were used to correlate the obtained high-quality SNP variants with the gestation duration phenotype in West China cattle, identifying 14 genetic variants significantly associated with the gestation duration trait. Among them, SNPs located in the P3H3, GGTA1, and TMEM161B gene regions showed a significant correlation with the gestation duration trait. Specifically: at the P3H3 gene region SNP site (P1) located at position 103620982 bp on chromosome NC_037332.1, the gestation duration of G / G individuals was significantly shorter than that of G / T and T / T individuals (P < 0.05); at the GGTA1 gene region SNP site (P2) located at position 92333432 bp on chromosome NC_037338.1, the gestation duration of A / A individuals was significantly shorter than that of C / A and C / C individuals (P < 0.05); at the TMEM161B gene region SNP site (P3) located at position 87804249 bp on chromosome NC_037334.1, the gestation duration of T / T individuals was significantly shorter than that of C / T and C / C individuals (P < 0.05). It is evident that the three SNP variant sites mentioned above are not only significantly correlated with the gestation duration trait in cattle, but their corresponding dominant genotypes also show good breeding application potential in shortening gestation duration, making them suitable as molecular markers for early selection of beef cattle gestation duration traits.

[0016] Thirdly, the present invention also provides a kit for detecting the genotypes of SNP variant sites in the P3H3, GGTA1, and TMEM161B genes of individual beef cattle. The kit includes: primer pairs P1, P2, and P3 for amplifying bovine pregnancy duration-related SNP markers; primers P4, P5, and P6 for SNaPshot single-base extension typing of the aforementioned SNP sites; and reaction system reagents required for PCR amplification of the target gene fragment and SNaPshot single-base extension typing.

[0017] The primer pair P1 (P3H3 gene) includes: Upstream primer P1-F: 5'-ACAGGCTCATCCATTGCTTC-3' Downstream primer R1-R: 5'-AGAATGAGGCCTGTCTCTG-3'; The primer pair P2 (GGTA1 gene) includes: Upstream primer P2-F: 5'-CAGAACAAAGAGCCTTCTGG-3' Downstream primer P2-R: 5'-TGATCTCTGATTCCTCTGCC-3'; The primer pair P3 (TMEM161B gene) includes: Upstream primer P3-F: 5'- CAAAGTCCTTAGATCGTTCC -3' Downstream primer P3-R: 5'-TGGCTCTTTTGACCAGCTAC-3'; The extension primer P4 (P3H3 gene) is: 5'- CAGGGCTCCTTCTGTCCTCG -3'; The extension primer P5 (GGTA1 gene) is: 5'- gactgactGCAGCCATTATCACTGAAGCCC-3'; The extended primer P6 (TMEM161B gene) is: 5'- gactgactgactgacACATTTCTGTCAAAATTCTCAC -3'.

[0018] The beneficial effects of the present invention are as follows: 1. The detection and typing method based on SNP variations of P3H3, GGTA1 and TMEM161B genes provided by the present invention is not limited by individual age and parity factors, and can be implemented in the early stage of calves. It is beneficial to make genetic prediction of individual gestation duration traits without relying on phenotypic records, and provides effective technical support for early breeding and precise selection of beef cattle. 2. The detection and typing method provided by this invention has a simple operation process, fast detection speed, low detection cost and accurate and reliable results. It can quickly and accurately determine the genotype of the target SNP marker carried by the target individual, thereby realizing the efficient screening and construction of beef cattle individuals or groups with excellent reproductive performance, especially with the potential for short pregnancy duration, effectively shortening the breeding or genetic improvement cycle and significantly improving the efficiency of beef cattle breeding. 3. This invention integrates multiple functional gene SNP loci that are significantly associated with the trait of gestation duration, providing a scientifically sound, technically clear, and practically applicable detection method for molecular marker-assisted selection of bovine gestation duration and related reproductive traits. It has good application prospects and promotional value. Attached Figure Description

[0019] Figure 1 The diagram shows the sequencing criteria for SNaPshot detection of various genotypes at three SNP marker loci. Detailed Implementation

[0020] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art are within the protection scope of the present invention.

[0021] Example This invention provides a method and application for detecting SNP markers related to the gestation duration trait in beef cattle. Using genomic DNA of the cattle as a template, primer pairs P1, P2, and P3 are used to amplify fragments containing target SNP sites in the P3H3, GGTA1, and TMEM161B genes. After purifying the PCR amplification products, SNaPshot single-base extension reactions are performed using extension primers P4, P5, and P6. The genotype of each target SNP site is determined based on the fluorescence signal of the extension products. Individuals carrying the short gestation duration dominant genotype are screened based on the detection results and used to construct a high-fertility beef cattle breeding population, thereby achieving early prediction and marker-assisted selection of the gestation duration trait.

[0022] The specific steps are as follows: 1. Sample Collection This invention uses Huaxi cattle as the testing subject, and blood samples were randomly collected and used from 202 individual Huaxi cattle. All sampled individuals had complete and reliable reproductive records, recording their gestation duration trait data, which is the length of time from successful mating or fertilization to the day of calf delivery. The collected blood samples were used for subsequent genomic DNA extraction and SNP marker detection and analysis.

[0023] 2. Extraction of genomic DNA from blood samples Genomic DNA was extracted from blood samples using the conventional phenol-chloroform method. The specific steps are as follows: (1) Take 400 μL of whole blood sample and place it in a 1.5 mL centrifuge tube. Add 400 μL of STE buffer, 100 μL of 10% SDS and 40 μL of proteinase K, and mix gently. (2) Place the mixture in a 56 ℃ water bath and incubate overnight with shaking to allow the cells to fully lyse; (3) Add 1000 μL of phenol:chloroform:isoamyl alcohol (25:24:1) to the reaction system, gently invert and mix, and centrifuge at 4℃ and 12000 rpm for 10 min; (4) Carefully aspirate the upper aqueous phase and transfer it to a new centrifuge tube. Add an equal volume of chloroform:isoamyl alcohol (24:1) and mix well again. (5) Centrifuge at 4℃ and 12000rpm for 10min, and transfer the supernatant; (6) Add an equal volume of pre-cooled isopropanol (–20 °C) to the supernatant and gently invert to mix; (7) Place the mixture at -20℃ and let it stand for 30 min to 1 h; (8) Centrifuge at 4 ℃ and 12000 rpm for 10 min, and discard the supernatant; (9) Add 1 mL of 75% pre-cooled ethanol to the DNA precipitate for washing, centrifuge and discard the ethanol, then air dry. (10) Add 25 μL of TE buffer to dissolve the DNA precipitate. After the DNA is completely dissolved, store at -80°C for later use.

[0024] 3. Design of target gene and internal reference gene-specific primers Based on the bovine reference genome ARS-UCD2.0, SNP variant sites significantly associated with bovine gestation duration were selected in the P3H3, GGTA1, and TMEM161B genes. These sites are located at: (1) Chromosome NC_037332.1, position 103620982 (P3H3 gene); (2) Chromosome NC_037338.1, position 92333432 (GGTA1 gene); (3) Chromosome NC_037334.1, position 87804249 (TMEM161B gene).

[0025] For the aforementioned SNP sites, PCR-specific primer pairs P1, P2, and P3 were designed to amplify the target SNP sites; simultaneously, SNaPshot single-base extension primers P4, P5, and P6 adjacent to the target SNP sites were designed. The specific sequence information of each primer is as described in the foregoing specification and claims.

[0026] 4. PCR amplification of the target gene fragment Using extracted bovine genomic DNA as templates, PCR amplification of fragments containing target SNP sites in the P3H3, GGTA1, and TMEM161B genes was performed using primer pairs P1, P2, and P3, respectively. The PCR amplification reaction system and procedure followed standard molecular biology methods. After amplification, the PCR products were purified to remove unreacted primers and free nucleotides. The PCR reaction system is shown in Table 1, with a total volume of 10 µL.

[0027] Table 1. Real-time quantitative PCR reaction system The PCR amplification reaction procedure is as follows: (1) Pre-denature at 94℃ for 5 min, then proceed with the amplification reaction as described in (2); (2) 94℃ denaturation for 20s, 60℃ annealing for 30s, 72℃ extension for 30s, for a total of 35 cycles.

[0028] 5. SNaPshot Single Base Extension Typing Using purified PCR amplification products as templates, corresponding extension primers P4, P5, and P6 were added to perform SNaPshot single-base extension reactions. After the extension reaction, the fluorescence signal of the extension products was detected by capillary electrophoresis. Based on the extension results of different fluorescently labeled bases, the genotype of each SNP locus was determined. Figure 1 The diagram shows the sequencing criteria for SNaPshot detection of various genotypes at three SNP marker loci.

[0029] 6. Data Processing Genotype data of SNP loci of the P3H3, GGTA1, and TMEM161B genes obtained by SNaPshot single base extension typing were collected and summarized, and the genotype information of each tested individual was matched with their corresponding pregnancy duration phenotype data. For each locus, the tested individuals were divided into three groups according to three genotypes (e.g., G / G, G / T, and T / T at the P3H3 locus), and the pregnancy duration phenotype values ​​of each group were statistically compared.

[0030] In the statistical analysis, one-way ANOVA was first used to compare whether there were significant differences in the means among the three groups (P<0.05). Based on the overall significance, appropriate multiple comparison methods (such as LSD or Tukey's method) were then used to determine which genotype group had a significantly shorter pregnancy and to identify the dominant genotype. The results of the statistical analysis are shown in Table 2.

[0031] Based on the above statistical analysis results, the dominant genotype exhibiting a significantly shorter gestation period will be used as the molecular marker for screening individuals with shorter gestation periods. Further, based on the genotype-phenotype matching and statistical analysis results, marker-assisted selection will be performed on the test population to construct a core breeding population of beef cattle with a short gestation period and high reproductive efficiency, thereby achieving early prediction and precision breeding of the gestation duration trait.

[0032] Table 2. Comparison of SNP genotypes and gestation duration in P3H3, GGTA1, and TMEM161B genes in West China cattle. Note: The data in the table are the mean ± standard error (days) of gestation duration for different genotypes at each gene locus; significant groups are marked with different letters (a, b, c) by multiple comparison method (LSD or Tukey method), different letters indicate significant differences between groups (P<0.05), and the same letter indicates no significant difference.

[0033] Statistical analysis showed that the SNP loci detected using primer pairs P1, P2, and P3 were significantly associated with the gestation duration trait in West China cattle. Specifically, individuals with dominant genotypes at P1, P2, and P3 loci exhibited significantly shorter gestation durations than those with suboptimal genotypes. Therefore, these SNP loci can serve as effective molecular genetic markers for early screening of breeding cattle with short gestation periods, thereby accelerating beef cattle breeding and improving the reproductive efficiency of the core herd.

[0034] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for genotyping gestation duration in beef cattle based on SNPs of the P3H3, GGTA1, and TMEM161B genes, characterized in that, Includes the following steps: 0) Using bovine genomic DNA as a template, specific primer pairs P1, P2 and P3 were used to amplify the target fragments of the P3H3 gene, GGTA1 gene and TMEM161B gene by PCR. 1) Using extension primers P4, P5, and P6, combined with the SNaPshot single-base extension reaction, the target SNP sites in the PCR amplification products obtained in step 1) were genotyped to achieve accurate identification of the genotypes of SNP variant sites in the P3H3, GGTA1, and TMEM161B genes; among which, The primer pair P1 (P3H3 gene) includes: Upstream primer P1-F: 5'-ACAGGCTCATCCATTGCTTC-3' Downstream primer R1-R: 5'-AGAATGAGGCCTGTCTCTG-3'; The primer pair P2 (GGTA1 gene) includes: Upstream primer P2-F: 5'-CAGAACAAAGAGCCTTCTGG-3' Downstream primer P2-R: 5'-TGATCTCTGATTCCTCTGCC-3'; The primer pair P3 (TMEM161B gene) includes: Upstream primer P3-F: 5'- CAAAGTCCTTAGATCGTTCC -3' Downstream primer P3-R: 5'-TGGCTCTTTTGACCAGCTAC-3'; The extension primer P4 (P3H3 gene) is: 5'- CAGGGCTCCTTCTGTCCTCG -3'; The extension primer P5 (GGTA1 gene) is: 5'- gactgactGCAGCCATTATCACTGAAGCCC-3'; The extended primer P6 (TMEM161B gene) is: 5'- gactgactgactgacACATTTCTGTCAAAATTCTCAC-3'.

2. The method for genotyping gestation duration in beef cattle based on SNPs of P3H3, GGTA1, and TMEM161B genes according to claim 1, characterized in that, The SNP variants in the P3H3, GGTA1, and TMEM161B genes that are significantly associated with the bovine gestation duration trait are located at the following sites in the reference genome ARS-UCD 2.0 version (GCF_002263795.3): site 103620982 on chromosome NC_037332.1, site 92333432 on chromosome NC_037338.1, and site 87804249 on chromosome NC_037334.

1.

3. The method for genotyping gestation duration in beef cattle based on SNPs of P3H3, GGTA1, and TMEM161B genes according to claim 1, characterized in that, The SNP variant types were determined based on the SNaPshot single base extension typing results, wherein: the variant genotype of the P3H3 gene is G / G, G / T, or T / T; the variant genotype of the GGTA1 gene is C / C, C / A, or A / A; and the variant genotype of the TMEM161B gene is T / T, T / C, or C / C.

4. The method for genotyping gestation duration in beef cattle based on SNPs of P3H3, GGTA1, and TMEM161B genes according to claim 1, characterized in that, In step 1), the PCR amplification reaction system includes 1 μL of 20-50 ng / μL template DNA, 0.5 μL each of the upstream and downstream primers corresponding to primer pair P1, primer pair P2, or primer pair P3 (10 μmol / L), 5 μL of 2×Taq PCRMaster Mix, and 10 μL of ddH2O (3 μL).

5. The method for genotyping gestation duration in beef cattle based on SNPs of P3H3, GGTA1, and TMEM161B genes according to claim 1, characterized in that, The PCR amplification reaction program includes the following steps: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 20 s, 60℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 35 cycles.

6. The method for genotyping gestation duration in beef cattle based on SNPs of P3H3, GGTA1, and TMEM161B genes according to claim 1, characterized in that, In step 1), the PCR product fragment size based on primer pair P1 is 278 bp; the PCR product fragment size based on primer pair P2 is 270 bp; and the PCR product fragment size based on primer pair P3 is 256 bp.

7. The application of the method according to any one of claims 1-6 in molecular marker-assisted selection breeding of beef cattle.

8. The application according to claim 7, characterized in that, Individual beef cattle carrying the dominant genotype showed significantly better gestation duration traits than those carrying the inferior genotype, with a significantly shorter gestation duration.

9. The application according to claim 8, characterized in that, The gestation period refers to the length of time a cow experiences from fertilization or successful mating until the birth of a calf.

10. A kit for detecting the genotypes of SNP variant sites in the P3H3, GGTA1, and TMEM161B genes of individual beef cattle, characterized in that... The kit includes: primer pairs P1, P2, and P3 for amplifying bovine pregnancy duration-related SNP markers; primers P4, P5, and P6 for SNaPshot single-base extension genotyping of the SNP sites; and related reaction system reagents required for PCR amplification and SNaPshot genotyping reactions. The primer pair P1 (P3H3 gene) includes: Upstream primer P1-F: 5'-ACAGGCTCATCCATTGCTTC-3' Downstream primer R1-R: 5'-AGAATGAGGCCTGTCTCTG-3'; The primer pair P2 (GGTA1 gene) includes: Upstream primer P2-F: 5'-CAGAACAAAGAGCCTTCTGG-3' Downstream primer P2-R: 5'-TGATCTCTGATTCCTCTGCC-3'; The primer pair P3 (TMEM161B gene) includes: Upstream primer P3-F: 5'- CAAAGTCCTTAGATCGTTCC -3' Downstream primer P3-R: 5'-TGGCTCTTTTGACCAGCTAC-3'; The extension primer P4 (P3H3 gene) is: 5'- CAGGGCTCCTTCTGTCCTCG -3'; The extension primer P5 (GGTA1 gene) is: 5'- gactgactGCAGCCATTATCACTGAAGCCC-3'; The extended primer P6 (TMEM161B gene) is: 5'- gactgactgactgacACATTTCTGTCAAAATTCTCAC-3'.