Aflatoxin-related liver cancer marker and application thereof

By using the FBXW7 gene chr4:152326101 C>T as a biomarker, combined with TaqMan-PCR kit and PCR kit, the problem of diagnosis and prognostic assessment of aflatoxin-related liver cancer was solved, and specific diagnosis and etiological response of aflatoxin-related liver cancer were achieved.

CN122012708APending Publication Date: 2026-05-12WUHAN SHUANGXUAN BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610083161.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-22
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

The lack of effective molecular subtyping markers in the current technology for the diagnosis and prognostic assessment of aflatoxin-related liver cancer leads to difficulties in clinical treatment and prognosis.

Method used

We provide the FBXW7 gene chr4:152326101 C>T as a biomarker for aflatoxin-associated liver cancer, and detect it using a TaqMan-PCR kit and a PCR kit containing specific primers and probes for amplification and detection of this gene mutation.

Benefits of technology

It enables specific diagnosis of aflatoxin-related liver cancer, improves the refinement of molecular pathological features of liver cancer, provides important clinical data support, and can reflect the etiological differences of liver cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012708A_ABST
    Figure CN122012708A_ABST
Patent Text Reader

Abstract

The invention provides an aflatoxin-related liver cancer marker and application thereof, and belongs to the technical field of molecular diagnosis. According to the invention, through research methods and means of a large-sample high-throughput gene sequencing technology, a TaqMan-PCR technology, a cytological technology, experimental zoology and the like of aflatoxin-related liver cancer, a diagnosis and prognosis judgment marker for aflatoxin-related liver cancer typing, namely an FBXW7 gene chr4: 152326101 Cgt, is obtained; t. It is found through experiments that in aflatoxin related liver cancer cells, aflatoxin is closely related to biological behaviors such as cancer cell proliferation, migration, invasion, cell cycle and drug resistance, and the correlation is affected by the FBXW7 gene chr4: 152326101 Cgt; t). The establishment of the marker and a related evaluation technology system provides important data support for refining pathological characteristics of liver cancer molecules.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic technology, specifically relating to aflatoxin-related liver cancer biomarkers and their applications. Background Technology

[0002] Aflatoxin is a Group 1 chemical carcinogen that can induce liver cancer. Aflatoxin-induced liver cancer (i.e., aflatoxin-associated liver cancer) has a high incidence rate in southeastern coastal areas of my country, such as Guangxi and Guangdong, seriously affecting the health of residents. Epidemiological and toxicological studies have proven that aflatoxin is a metabolite of Aspergillus flavus and Aspergillus parasiticus. Because Aspergillus flavus and Aspergillus parasiticus thrive in hot and humid environments, grains such as peanuts and corn that are not properly stored in such environments contain large amounts of these microorganisms and their metabolite, aflatoxin. Aflatoxin enters the human body through contaminated grains and is primarily metabolized in the liver. After entering the hepatocyte nucleus, aflatoxin often forms aflatoxin-DNA adducts, which can cause DNA damage, lead to genomic instability, and subsequently induce malignant transformation of hepatocytes.

[0003] Studies have shown that specific molecular alterations exist in the development and progression of aflatoxin-associated hepatocellular carcinoma (HCC). For example, a high frequency of point mutations at codon 249 of the TP53 gene is observed in tumor tissue, and these mutations are positively correlated with aflatoxin exposure levels. With the advancement of high-throughput sequencing technology and genome projects, some significant genetic heterogeneity features have been identified in aflatoxin-associated HCC. However, research on molecular subtyping markers for aflatoxin-associated HCC and their application in clinical treatment and prognosis has not yet been reported. Summary of the Invention

[0004] To address the aforementioned problems, the first aspect of this invention provides an aflatoxin-related liver cancer biomarker, using GRCh38 as a reference genome, wherein the biomarker is the FBXW7 gene chr4:152326101 C>T.

[0005] A second aspect of the present invention is to provide the use of the aflatoxin-associated liver cancer marker or its expression product in the preparation of detection products and / or prognostic assessment products for aflatoxin-associated liver cancer typing.

[0006] In a preferred embodiment, the detection product is a test kit.

[0007] A third aspect of the present invention is to provide a TaqMan-PCR kit for detecting the aflatoxin-related liver cancer biomarker, the TaqMan-PCR kit comprising a primer pair for amplifying the FBXW7 gene, a probe T as shown in SEQ ID No. 17, and a probe C as shown in SEQ ID No. 18; the sequences of the primer pair are shown in SEQ ID No. 19 and SEQ ID No. 20.

[0008] In a preferred embodiment, the TaqMan-PCR kit includes a positive control and a standard, the nucleotide sequences of which are shown in SEQ ID No. 21 and SEQ ID No. 22, and the nucleotide sequences of which are shown in SEQ ID No. 23 and SEQ ID No. 24.

[0009] In a preferred embodiment, the TaqMan-PCR kit contains PCR amplification reagents, which consist of the following: 0.08 U / μL Taq deoxyribonucleic acid polymerase, 2 U / μL enzyme buffer, 0.4 μM deoxyribonucleic acid triphosphate, and 4 μM magnesium chloride.

[0010] In a preferred embodiment, the DNA sample to be tested in the TaqMan-PCR kit is derived from liver cancer tumor tissue. The specific extraction method is as follows: take an appropriate amount of tumor tissue, separate the cells using proteinase K, and extract the DNA from the cells using the phenol-chloroform extraction method as the DNA to be tested.

[0011] A fourth aspect of the present invention is to provide a PCR kit for amplifying the aflatoxin-related liver cancer biomarker, the PCR kit comprising an amplicon primer pair; the gene fragment of the amplicon comprising the biomarker of claim 1; the sequences of the amplicon primer pair are shown in SEQ ID No. 25 and SEQ ID No. 26.

[0012] In a preferred embodiment, the PCR kit includes a positive control, the nucleotide sequence of which is shown in SEQ ID No. 27 and SEQ ID No. 28.

[0013] In a preferred embodiment, the PCR kit comprises an amplicon PCR amplification reagent, the components of which are as follows: 0.08 U / μL Taq deoxyribonucleic acid polymerase, 2 U / μL enzyme buffer, 0.4 μM deoxyribonucleic acid triphosphate and 4 μM magnesium chloride.

[0014] In a preferred embodiment, the PCR kit includes an amplicon purification reagent, which consists of the following components: 3M sodium acetate at pH 5.2, anhydrous ethanol, and TE buffer, wherein the concentration of Tris-HCl in the TE buffer is 10 mM and the concentration of sodium ethylenediamine diacetate is 1 mM.

[0015] In a preferred embodiment, the DNA sample to be tested in the PCR kit is derived from liver cancer tumor tissue. The specific extraction method is as follows: take an appropriate amount of tumor tissue, separate the cells using proteinase K, and extract the DNA from the cells using phenol-chloroform extraction as the DNA to be tested.

[0016] The technical solution of the present invention has the following beneficial effects: The aflatoxin-related hepatocellular carcinoma (HCC) biomarker provided by this invention demonstrates the genetic heterogeneity of HCC across different etiologies. Unlike traditional HCC biomarkers such as AFP, which show no difference across HCCs with different etiologies, the biomarker provided by this invention reflects the etiology of HCC. Therefore, the establishment of this biomarker and related assessment technology system provides important data support for refining the molecular pathological characteristics of HCC. Attached Figure Description

[0017] Figure 1 This is the ROC curve for evaluating the diagnostic value of the FBXW7 gene chr4:152326101 C>T mutation for aflatoxin-related hepatocellular carcinoma in Example 1 of this invention. Figure 2 The bar chart shows the hepatocellular carcinoma cell line containing the FBXW7 gene chr4:152326101 C>T mutant established in Example 5 of this invention and its transfection efficiency. Figure 3 This is a graph showing the effect of the FBXW7 gene chr4:152326101 C>T mutation on the cell cycle of liver cancer cells in Example 5 of the present invention. Figure 4 This is a graph showing the effect of the FBXW7 gene chr4:152326101 C>T mutation on the proliferation of liver cancer cells in Example 5 of this study. Figure 5 This is a graph showing the effect of the FBXW7 gene chr4:152326101 C>T mutation on the invasive ability of liver cancer cells in Example 5 of the present invention. Figure 6 This is a graph showing the effect of the FBXW7 gene chr4:152326101 C>T mutation on the clonogenic ability of liver cancer cells in Example 5 of the present invention. Figure 7This is a graph showing the effect of the FBXW7 gene chr4:152326101 C>T mutation on the tumor-bearing ability of liver cancer cells in mice in Example 5 of the present invention. Figure 8 This is a graph showing the effect of whether or not the FBXW7 gene chr4:152326101 C>T mutation is present on the prognosis of sorafenib treatment for aflatoxin-related liver cancer in Example 6 of the present invention. Detailed Implementation

[0018] The following description, in conjunction with embodiments, clearly and completely describes the technical solutions of this application, so that those skilled in the art can fully understand this application. Obviously, the described embodiments are merely some preferred embodiments of this application, and not all embodiments. Any equivalent modifications or substitutions made by those skilled in the art to the following embodiments without creative effort are within the protection scope of this application.

[0019] Example 1: The FBXW7 gene chr4:152326101 C>T mutation is a specific mutation in aflatoxin-associated liver cancer. 1.1 Collection of clinical samples for liver cancer A total of 265 liver cancer tumor tissue specimens meeting the NGS (Next-Generation Sequencing) sequencing criteria were collected from the pathology departments of the Affiliated Hospital of Youjiang Medical University for Nationalities, Guangxi Cancer Hospital, Affiliated Hospital of Guilin Medical University, and Renji Hospital in Shanghai. These specimens were divided into the following four groups based on their known etiologies: (1) Hepatitis virus-related group (hepatitis virus-related liver cancer): 98 cases met the criteria of being positive for known hepatitis virus, negative for AFB1-DNA adduct, negative for alcoholic liver disease, and negative for other known causes of liver cancer.

[0020] (2) Aflatoxin-related group (aflatoxin-related liver cancer): 87 cases met the criteria of negative known hepatitis virus, positive AFB1-DNA adduct, negative alcoholic liver disease, and negative other known causes of liver cancer.

[0021] (3) Alcohol-related group (alcohol-related liver cancer): 24 cases met the criteria of negative known hepatitis virus, negative AFB1-DNA adduct, positive alcoholic liver disease, and negative other known causes of liver cancer.

[0022] (4) Other group (other liver cancer): 56 cases met the criteria of negative hepatitis virus, negative AFB1-DNA adduct, and negative alcoholic liver disease.

[0023] The four groups of liver cancer patients were well comparable in terms of baseline characteristics such as age, gender, and ethnicity.

[0024] 1.2 Extraction of Genomic DNA Tumor cells were isolated from the tumor tissue specimens collected above using proteinase K lysis method, and DNA was extracted from the tumor cells using phenol-chloroform extraction method. The specific operation method is as follows: (1) Take 10 pieces of tissue with a thickness of 10 μm and bake them for later use; (2) Put the tissue into xylene for 20 min, then transfer it into anhydrous ethanol I and anhydrous ethanol II for 5 min each, evaporate the tissue slices, and transfer them into 1.5 mL centrifuge tubes; (3) Add 280 μL of lysis buffer and homogenize thoroughly with a homogenizer (be careful to prevent the generation of air bubbles); (4) Add proteinase K 20 μL, and mix well; (5) Heat in a 90℃ water bath for 1 hour, then add 560 μL of precipitate and mix well; (6) Transfer the above liquid into the adsorption column (place in the collection tube), which can be done in multiple batches; centrifuge at 10000 rpm for 1 min, and discard the waste liquid in the collection tube; (7) Add 500 μL of GW1 (wash buffer 1) (note whether anhydrous ethanol has been added to this solution), centrifuge at 10000 rpm for 1 min, and discard the waste liquid in the collection tube; (8) Add 500 μL of GW2 (wash buffer 2) (note whether anhydrous ethanol has been added to this solution), centrifuge at 10000 rpm for 1 min, and discard the waste liquid in the collection tube; (9) Centrifuge at 10,000 rpm for 1 min and discard the waste liquid in the collection tube; (10) Centrifuge at 10,000 rpm for 2 min and discard the waste liquid in the collection tube; place at room temperature for 5 min; transfer the adsorption column to a new 1.5 mL centrifuge tube; (11) Add 100 μL of elution buffer (GE), place at room temperature for 5 min, and then centrifuge at 10,000 rpm for 1 min; (12) Dilute the sample DNA to 50 ng / μL and use it as the DNA template to be tested. All reagents used in the above operation steps are from the FFPE DNA / RNA extraction kit for centrifugal column (purchased from Kangwei Century Biotechnology Co., Ltd., catalog number CWY118S).

[0025] 1.3 FBXW7 gene amplicon detection system (1) Establish amplicon detection primers. The specific primer sequences are shown in Table 1.

[0026] Table 1 Primers for FBXW7 gene amplicon detection

[0027] (2) Preparation of DNA library containing target sequence: Using the amplicon primers established above, the target sequence is amplified by PCR reaction to obtain amplicon containing the target sequence.

[0028] The PCR reaction system (total volume 25 μL) consisted of the following: PCR amplification reagent (final concentration 1×), upstream primer solution for each target gene fragment (final concentration 0.2 μM), downstream primer solution for each target gene fragment (final concentration 0.2 μM), 50 ng of DNA template, and double-distilled water. The PCR amplification reagent (initial concentration 2×) was a mixture of 0.08 U / μL Taq deoxyribonucleic acid polymerase, 2 U / μL enzyme buffer, 0.4 μM deoxyribonucleic acid triphosphate, and 4 μM magnesium chloride. The aforementioned Taq deoxyribonucleic acid polymerase and its accompanying enzyme buffer were purchased from Promega, catalog number M1661S.

[0029] The PCR amplification program is as follows: after pre-denaturation at 95℃ for 10 minutes, proceed to the following repeated cycles: denaturation at 95℃ for 15 seconds, annealing at 60℃ for 60 seconds, repeat 35 times and then stop.

[0030] (3) Processing, modification, purification, sequencing adapters and identification of DNA library: In accordance with the basic principles of NGS sequencing library construction, the DNA library containing the target sequence established above was repaired at the end, NGS sequencing adapters were added, impurities were removed by purification, and the DNA library was identified by agarose gel electrophoresis. The sample DNA library electrophoresis band was at the 200bp position, indicating that the constructed DNA library had good uniformity, met the research requirements, and could be used for the next step of DNA sequencing.

[0031] (4) NGS sequencing, data processing and analysis of DNA library: The constructed library was sequenced using the Illumina MiniSeq sequencing platform to obtain Fastq format files; the NGS sequencing data was processed and analyzed using Visual Genomics-RS (version: v1.1.0).

[0032] 1.4. Confirm the mutation status of the FBXW7 gene in liver cancer. The FBXW7 gene exhibits a high mutation frequency in aflatoxin-associated hepatocellular carcinoma (HCC), primarily consisting of missense mutations, accounting for approximately 79% (see Table 2). Using GRCh38 as a reference genome, among these mutations, the mutation at position 152326101 on chromosome 4 of the FBXW7 gene, where cytosine (C) is replaced by thymine (T) (described below as: FBXW7 gene chr4:152326101 C>T), accounts for 68.4% of the missense mutations, and this mutation is absent in other HCCs.

[0033] Table 2. Mutation status of the FBXW7 gene in liver cancer tumor tissues.

[0034] 1.5. Validation of the sensitivity and specificity of the FBXW7 gene chr4:152326101 C>T mutation in the diagnosis of aflatoxin-related hepatocellular carcinoma. like Figure 1 As shown, ROC (Receiver Operating Characteristic) curve analysis revealed that the FBXW7 gene chr4:152326101 C>T mutation had a positive predictive value and specificity of 100% and a negative predictive value of 71% for the diagnosis of aflatoxin-associated hepatocellular carcinoma. These results indicate that the FBXW7 gene chr4:152326101 C>T mutation is a characteristic mutation of aflatoxin-associated hepatocellular carcinoma and has specificity for its diagnosis.

[0035] Example 2: Detection of the FBXW7 gene chr4:152326101 C>T mutation In this embodiment, the TaqMan-PCR detection kit was used to detect the C>T mutation in FBXW7 chr4:152326101.

[0036] 2.1 Extraction of Samples and Genomic DNA After obtaining the sample and extracting the sample DNA according to the method described in step 1.2 of Example 1, the sample DNA was uniformly diluted to 50 ng / μL and used as the DNA template to be tested.

[0037] 2.2 Establishing the TaqMan-PCR reaction system and reaction conditions The reaction system (total volume 25 μL) contained PCR amplification reagents (final concentration 1×), FBXW7 gene upstream primer solution (final concentration 0.2 μM), FBXW7 gene downstream primer solution (final concentration 0.2 μM), probe T solution (final concentration 0.2 μM), probe C solution (final concentration 0.2 μM), 50 ng of DNA template to be tested, and double-distilled water. The PCR amplification reagents (initial concentration 2×) consisted of a mixture of 0.08 U / μL Taq deoxyribonucleic acid polymerase, 2 U / μL enzyme buffer, 0.4 μM deoxyribonucleic acid triphosphate, and 4 μM magnesium chloride. The aforementioned Taq deoxyribonucleic acid polymerase and its accompanying enzyme buffer were purchased from Promega (catalog number: M1661S).

[0038] The nucleotide sequence of probe T (SEQ ID No. 17) is 5'-aggagggttgttagtaga-3'. The 5' end of probe T is attached to a fluorescent reporter group FAM (5-carboxyfluorescein or 6-carboxyfluorescein), and the 3' end is attached to MGB (minor groove binder).

[0039] The nucleotide sequence of probe C (SEQ ID No. 18) is: 5'-aggagggttgttagtgga-3'. Probe C is attached with a fluorescent reporter group VIC (6-hydroxypyridine-2-carboxylic acid) and an MGB (minor groove binder) at its 3' end.

[0040] FBXW7 gene upstream primer sequence (SEQ ID No. 19): 5'-cagcagtccgctgtgttcaa-3'; The downstream primer sequence of the FBXW7 gene (SEQ ID No. 20): 5'-tcccacacctttaccataaaatca-3'.

[0041] Reaction conditions: After pre-denaturation at 94℃ for 5 minutes, the following cycle was repeated: denaturation at 94℃ for 45 seconds, annealing at 60℃ for 60 seconds, repeated 50 times and then the cycle ended.

[0042] Simultaneously, positive and negative controls were established. 0.05 μL of probe T positive control solution replaced the DNA sample as the probe T positive control; 0.05 μL of probe C positive control solution replaced the DNA sample as the probe C positive control; 0.05 μL of probe T positive control solution and 0.05 μL of probe C positive control solution replaced the DNA sample as the double positive control; and 0.05 μL of DNA-free double-distilled water replaced the DNA sample as the negative control. PCR amplification was performed under the same conditions.

[0043] The sequences of the positive controls (SEQ ID No. 21 and SEQ ID No. 22) are as follows: SEQ ID No. 21: 5'-catgttgcagcagtccgctgtgttcaatatgatggcaggagggttgttagtagagcatatgattttatggtaaaggtgtggggat-3'; SEQ ID No. 22: 5'-catgttgcagcagtccgctgtgttcaatatgatggcaggagggttgttagtggagcatatgattttatggtaaaggtgtggggat-3'.

[0044] The standards (SEQ ID No. 23 and SEQ ID No. 24) are double-stranded DNA, the sequence of which is inserted into the pcDNA3.0 vector. The nucleotide sequence of the double-stranded DNA standards is as follows: SEQ ID No.23: ttaaaaattctaaacgtgggtttttttgttttgttttgttttctgtttctccctctgcagagttgttagcggttctcgagatgccactcttagggtttgggatattgagacaggccagtgt ttacatgttttgatgggtcatgttgcagcagtccgctgtgttcaatatgatggcaggagggttgttagtagagcatatgattttatggtaaaggtgtgggatccagagactgaaacctgtctacacac; SEQ ID No.24:ttaaaaattctaaacgtgggtttttttgttttgttttgttttctgtttctccctctgcagagttgttagcggttctcgagatgccactcttagggtttgggatattgagacaggccagtgt ttacatgttttgatgggtcatgttgcagcagtccgctgtgttcaatatgatggcaggagggttgttagtggagcatatgattttatggtaaaggtgtgggatccagagactgaaacctgtctacacac.

[0045] 2.3 Test Results and Analysis Quantitative real-time PCR was used to verify probes T and C using artificially synthesized variant FBXW7 gene fragments (nucleotide sequence SEQ ID No. 23) and wild-type FBXW7 gene fragments (nucleotide sequence SEQ ID No. 24), with DNA-free double-distilled water as a control. The results showed that the variant FBXW7 gene fragment specifically reacted with probe T and emitted fluorescence, but did not produce fluorescence with probe C; the wild-type FBXW7 gene fragment specifically reacted with probe C and emitted fluorescence, but did not produce fluorescence with probe T; DNA-free double-distilled water did not emit fluorescence with either probe. Therefore, it was verified that the combination of probes T and C can be used to detect the human FBXW7 gene chr4:152326101 C>T mutation. All samples from Example 1 were tested in this experiment, and the results are shown in Table 3.

[0046] Table 3. Occurrence of the FBXW7 gene chr4:152326101 C>T mutation in liver cancer tissues (TaqMan-PCR)

[0047] As shown in Table 3, among the 87 aflatoxin-associated liver cancer tumor samples, 13 samples tested positive for the FBXW7 gene chr4:152326101 C>T mutation; this mutation was not detected in other liver cancer samples related to other causes.

[0048] Example 3: Detection of the FBXW7 gene chr4:152326101 C>T mutation In this embodiment, a first-generation sequencing (Sanger Sequencing) kit was used to detect the FBXW7 chr4:152326101C>T mutation.

[0049] 3.1 Extraction of Samples and Genomic DNA After obtaining the sample and extracting the sample DNA according to the method described in step 1.2 of Example 1, the sample DNA was uniformly diluted to 50 ng / μL and used as the DNA template to be tested.

[0050] 3.2 Design of Amplicon Sequence Primers and Positive Controls Forward primer sequence of the amplicon (SEQ ID No. 25): 5'-aggtcagggaaccaagcatg-3'; The reverse primer sequence of the amplicon (SEQ ID No. 26): 5'-atcaaagcaaaggggcagct-3'.

[0051] The positive controls (SEQ ID No. 27 and SEQ ID No. 28) are double-stranded DNA sequences inserted into the pcDNA3.0 vector. The sequences of the positive control double-stranded DNA are as follows: SEQ ID No.27:。

[0052] SEQ ID No.28: aggtcagggaaccaagcatgcagcattctaggcttcccaacttcccattcccttattatgtttatataccaaggttttacataggattctctttgaaaaatggttgttgctgtgtaaaaaaaaaaaaaaaagctaaaaaaccttgactaaatctaccatgttttctcatattattaaaaaattctaaacgtgggtttttttgttttgttttgtttttctgtttctccctctgcagagttgttagcggttctcgagatgccactcttagggtttgggatattgagacaggccagtgtttacatgttttgatgggtcatgttgcagcagtccgctgtgttcaatatgatggcagaagggttgttagtggagcatatgattttatggtaaaggtgtgggatccagagactgaaacctgtctacacacgttgcaggggcatactaatagagtctattcattacaggtaagatctcttatctctcccttaaatgctctcctgatgaatcataaggttgttttactcagataatcactgtcaaattgctgatccagtacagtcccaaaaagattaatcagattattctgctgtttttatatacgttaaaattggcatgaagaaagtgtaaatttcaaaattatttaaatgctttcaattttctgtgatctatttctcctctaaatacaaatatttgttttgcaacctgacactttggggctctaagttttgctatgttaattaatggttaaatagtctcataggagagtaacctggattttaagaaactcctttgcagaagattaatatggccaaaagctgcccctttgctttgat。

[0053] 3.3. Amplify the amplicon The DNA template from step 3.1 was amplified by PCR using the primer pair from step 3.2. The PCR reaction system (total volume 25 μL) consisted of the following: PCR amplification reagent (final concentration 1×), forward primer solution for the amplicons (final concentration 0.2 μM), reverse primer solution for the amplicons (final concentration 0.2 μM), 50 ng of the DNA template to be tested, and double-distilled water. The PCR amplification reagent (initial concentration 2×) was a mixture containing Taq deoxyribonucleic acid polymerase (0.08 U / μL), enzyme buffer (2 U / μL), deoxyribonucleic acid triphosphate (0.4 μM), and magnesium chloride (4 μM).

[0054] PCR reaction conditions: After pre-denaturation at 94℃ for 5 minutes, the following repeated cycles were performed: denaturation at 94℃ for 45 seconds, annealing at 60℃ for 60 seconds, extension at 72℃ for 90 seconds, repeated 40 times and then stopped.

[0055] A positive control was set up for each reaction. The sequence of the positive control was the double-stranded DNA shown in SEQ ID No. 27 and SEQ ID No. 28 in step 3.2.

[0056] 3.4 Purification of PCR Amplification Products The PCR amplification products from step 3.3 were purified and recovered using an amplicon purification reagent. The amplicon purification reagent consisted of the following: sodium acetate solution (3M, pH 5.2), anhydrous ethanol, and TE buffer (containing 10mM Tris-HCl and 1mM EDTA).

[0057] The purification process is as follows: (1) Transfer the PCR amplification product from step 3.3 to a 1.5 mL enzyme-free centrifuge tube; (2) Add an equal volume of sodium acetate solution and gently mix by pipetting; (3) Add 2.5 times the volume of anhydrous ethanol and mix until the solution is clear; (4) Let stand at -20℃ for 1 hour, then place the centrifuge tube in a high-speed centrifuge pre-cooled to 4℃ and centrifuge (15000 rpm, 30 min), discarding the supernatant; (5) Slowly add 500 μL of 70% ethanol (pre-cooled to 4℃) along the wall of the centrifuge tube, gently invert the centrifuge tube 3 times, centrifuge (12000 rpm, 10 min), and remove the washing liquid; (6) After opening the cap, invert the centrifuge tube onto clean filter paper and dry at room temperature for 6 min; (7) Add an appropriate amount of TE buffer to dissolve the DNA and dilute the concentration to 50 ng / μL.

[0058] 3.5. Perform Sanger sequencing on the purified product. The purified product was subjected to Sanger sequencing. The specific steps are as follows: (1) Prepare the sequencing reaction system (20 μL system): sequencing buffer (final concentration 1×), sequencing primer pair (SEQ ID No. 25 and SEQ ID No. 26 in step 3.2) (the final concentration of both forward and reverse primers is 0.1 μM), BigDye premix (2 μL), purified product 35 ng, sterile deionized water (to 20 μL). (2) Perform the sequencing reaction. The sequencing reaction conditions are: after pre-denaturation at 96℃ for 1 minute, the following repeated cycle is performed: denaturation at 96℃ for 10 seconds, annealing at 50℃ for 5 seconds, extension at 60℃ for 240 seconds, repeated 25 times and then stopped. (3) The sequencing products were purified by ethanol precipitation, specifically as follows: First, 2 μL of 3 mol / L sodium acetate (pH 4.6), 1 μL of 125 mmol / L EDTA (pH 8.0), and 50 μL of anhydrous ethanol were added to the sequencing product solution. The mixture was vortexed thoroughly and allowed to stand at room temperature for 15 min to allow the DNA to precipitate completely. Next, the mixture was centrifuged at 12,000 rpm for 30 min at 4 °C, the supernatant was discarded, and 100 μL of 70% pre-cooled (4 °C) ethanol was added. The precipitate was gently washed by inverting the mixture. The mixture was then centrifuged at 12,000 rpm for 15 min at 4 °C, the supernatant was discarded, and the washing was repeated once. Finally, the mixture was opened and dried at room temperature for 10-15 min. 10 μL of Hi-Di formamide was added, the mixture was vortexed thoroughly, and the mixture was briefly centrifuged. The mixture was then denatured at 95 °C for 5 min and immediately placed on ice for 2 min. (4) Capillary electrophoresis and data acquisition: The denatured product was transferred to a sequencing-specific 96-well plate, sealed, and placed in a capillary electrophoresis apparatus (ABI 3730XL). Then, the electrophoresis parameters were set, including: capillary length 50 cm, separating gel POP-7 polymer gel, electrophoresis voltage 15 kV, operating temperature 60 °C, and detection wavelength (specifically: A = 525 nm, C = 550 nm, G = 575 nm, T = 600 nm). The electrophoresis program was started, and the instrument automatically completed sample injection, separation, fluorescence signal detection, and data conversion. All reagents used in the aforementioned steps were included with the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, CAT#4337454).

[0059] 3.6 Data Analysis Data analysis was performed using the sequencer's built-in software. All samples from Example 1 were tested in this experiment, and the results are shown in Table 4.

[0060] Table 4. Occurrence of the FBXW7 gene chr4:152326101 C>T mutation in liver cancer tumor tissues (Sanger sequencing)

[0061] As shown in Table 4, the FBXW7 gene chr4:152326101 C>T mutation was not detected in samples from hepatitis virus-associated liver cancer, alcohol-associated liver cancer, and other liver cancer groups. However, the FBXW7 gene chr4:152326101 C>T mutation was detected in 13 samples from aflatoxin-associated liver cancer tumors.

[0062] Example 4: The FBXW7 gene chr4:152326101 C>T mutation is positively associated with aflatoxin exposure levels.

[0063] 4.1 Collection of clinical samples for liver cancer A total of 528 tumor tissue specimens from sporadic aflatoxin-associated hepatocellular carcinoma (HCC) patients were collected from the Affiliated Hospital of Youjiang Medical University for Nationalities, with a mean age of 48.8 ± 10.1 years (standard deviation), including 172 female specimens. 364 tumor tissue specimens from sporadic HCC patients without aflatoxin exposure were also collected from the same hospital, with a mean age of 48.2 ± 10.3 years (standard deviation), including 113 female specimens. The two groups (aflatoxin-associated HCC and non-aflatoxin-associated HCC) were well-comparable in terms of baseline characteristics such as age, sex, and ethnicity.

[0064] 4.2 DNA extraction from tumor tissue samples After extracting sample DNA from tumor cells according to the method in step 1.2 of Example 1, the sample DNA was uniformly diluted to 50 ng / μL and used as the DNA template to be tested.

[0065] 4.3 Detection of FBXW7 gene chr4:152326101 C>T mutation The FBXW7 gene chr4:152326101 C>T mutation was detected in the samples using the TaqMan-PCR detection kit, following steps 2.2-2.3 of Example 2. Each DNA template was amplified in a single well of a 96-well plate with a total volume of 25 μL. The results of testing the DNA samples from step 4.2 were as follows: In 528 DNA samples from aflatoxin-associated hepatocellular carcinoma (HCC) tumor tissues, 101 samples showed the FBXW7 gene chr4:152326101 C>T mutation; while in 364 DNA samples from non-aflatoxin-associated HCC tumor tissues, the FBXW7 gene chr4:152326101 C>T mutation was not detected.

[0066] 4.4 Correlation analysis between FBXW7 gene chr4:152326101 C>T mutation and aflatoxin exposure level Multivariate logistic regression analysis was used to analyze the relationship between aflatoxin exposure level and the FBXW7 gene chr4:152326101 C>T mutation. The results showed a positive correlation between the two. The effect of this correlation was that with the increase of aflatoxin exposure, the risk of FBXW7 gene chr4:152326101 C>T mutation increased by 9.7 times, indicating that FBXW7 gene chr4:152326101 C>T mutation is an important genetic heterogeneity feature of aflatoxin-related hepatocellular carcinoma (see Table 5).

[0067] Table 5. Effects of aflatoxin exposure on the FBXW7 gene chr4:152326101 C>T mutation.

[0068] In Table 5, "*" represents P <0.01, “OR” indicates the odds ratio, and “CI” indicates the confidence interval.

[0069] Example 5: Effects of the FBXW7 gene chr4:152326101 C>T mutation on the biological behavior of liver cancer. 5.1 Establishing a hepatocellular carcinoma cell line with the FBXW7 gene chr4:152326101 C>T mutation. Using the HCCLM3 hepatocellular carcinoma cell line (purchased from the Cell Bank of the Chinese Academy of Sciences), a hepatocellular carcinoma cell line carrying the FBXW7 gene chr4:152326101 C>T mutation and a corresponding control cell line were established via lentiviral stable transformation, defined as OE-WT (wild-type) and OE-MT (mutant), respectively. The established stable cell lines are as follows: Figure 2 As shown. Figure 2 OE-NC represents cell lines transfected with the empty vector, OE-WT represents wild-type FBXW7 gene chr4:152326101 C>T transfected cell lines, and OE-MT represents mutant FBXW7 gene chr4:152326101 C>T transfected cell lines. The bar chart represents transfection efficiency, and differences between groups were analyzed using ANOVA (analysis of variance). Figure 2 As can be seen from the image, the three cell groups, OE-NC (top left), OE-WT (top right), and OE-MT (bottom left), showed fluorescence under a fluorescence microscope, and there was no difference in fluorescence intensity among the three groups (bottom right), indicating that the stable cell lines have been successfully constructed.

[0070] 5.2 Analysis of the effect of the FBXW7 gene chr4:152326101 C>T mutation on the cell cycle of liver cancer cells. The cell lines established above were cultured in vitro (in DMEM medium containing 10% fetal bovine serum, cultured at 5% CO2 and 37℃). The effect of the FBXW7 gene chr4:152326101 C>T mutation on the cell cycle of liver cancer cells was analyzed by flow cytometry. The specific operation is as follows: (1) Take cells in the logarithmic growth phase and in good growth condition, prepare a single cell suspension, centrifuge at 1000g for 5min, precipitate the cells, and discard the supernatant. Rinse the cells once with 1mL of pre-cooled (4℃) PBS buffer (containing NaCl 137mmol / L, KCl 2.7mmol / L, Na2HPO4 10mmol / L and KH2PO4 2mmol / L, pH=7.3), centrifuge, and collect the cell pellet; (2) Resuspend the cell pellet in 1mL of pre-cooled (4℃) 70% ethanol, and fix the cells in a 4℃ refrigerator for more than 2h or overnight. After fixation, the supernatant was discarded, and the cells were rinsed once with 1 mL of pre-cooled (4℃) PBS buffer (containing 137 mmol / L NaCl, 2.7 mmol / L KCl, 10 mmol / L Na2HPO4 and 2 mmol / L KH2PO4, pH=7.3). Then, the cells were centrifuged again at 1000g for 5 min to collect the cells. (3) The cells collected above were processed using a cell cycle and apoptosis detection kit (product of Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number: 40301ES60). The specific operation was as follows: 20 μL of propidium iodide solution and 20 μL of RNase A solution were added to 1000 μL of staining buffer. After mixing, the mixture was added to the cell collection tubes in step (2) of step 5.2, 500 μL in each tube. The cells were gently mixed and resuspended. The cells were incubated at 37℃ in the dark for 30 min. After incubation, the cells were detected by flow cytometry within 5 h. The detection results were as follows. Figure 3 As shown. Figure 3 OE-NC represents cell lines transfected with the empty vector, OE-WT represents wild-type FBXW7 gene chr4:152326101 C>T transfected cell lines, and OE-MT represents mutant FBXW7 gene chr4:152326101 C>T transfected cell lines. Differences between groups were analyzed using ANOVA. Figure 3 It can be seen that the FBXW7 gene chr4:152326101 C>T mutant can promote DNA synthesis and division in liver cancer cells.

[0071] 5.3 Analysis of the effect of the FBXW7 gene chr4:152326101 C>T mutation on the proliferation of liver cancer cells. The cell line established above was cultured in vitro (under the same conditions as in step 5.2). The effect of the FBXW7 gene chr4:152326101 C>T mutation on the proliferation of liver cancer cells was analyzed using the CCK-8 assay. The results are as follows: Figure 4 As shown. Figure 4 OE-NC represents cell lines transfected with the empty vector, OE-WT represents wild-type FBXW7 gene transfected with chr4:152326101 C>T, and OE-MT represents mutant FBXW7 gene transfected with chr4:152326101 C>T. Differences between groups were analyzed using ANOVA. Figure 4 As can be seen above, the FBXW7 gene chr4:152326101 C>T mutant can promote the proliferation of liver cancer cells.

[0072] 5.4. Analysis of the effect of the FBXW7 gene chr4:152326101 C>T mutation on the invasive ability of liver cancer cells. The cell line established above was cultured in vitro (under the same conditions as in step 5.2). The effect of the FBXW7 gene chr4:152326101 C>T mutation on the invasive ability of liver cancer cells was analyzed using the agarose gel invasion assay. The results are as follows: Figure 5 As shown. Figure 5 OE-NC represents cell lines transfected with the empty vector, OE-WT represents wild-type FBXW7 gene chr4:152326101 C>T transfected cell lines, and OE-MT represents mutant FBXW7 gene chr4:152326101 C>T transfected cell lines. Differences between groups were analyzed using ANOVA. Figure 5 As can be seen above, the FBXW7 gene chr4:152326101 C>T mutant can promote the invasion of liver cancer cells.

[0073] 5.5. Analysis of the effect of the FBXW7 gene chr4:152326101 C>T mutation on the clonogenic ability of hepatocellular carcinoma cells. The cell lines established above were cultured in vitro (under the same conditions as in step 5.2). The effect of the FBXW7 gene chr4:152326101 C>T mutation on the colony-forming ability of liver cancer cells was analyzed using the agarose gel colony formation assay. The results are as follows: Figure 6 As shown. Figure 6 OE-NC represents cell lines transfected with the empty vector, OE-WT represents wild-type FBXW7 gene transfected with chr4:152326101 C>T, and OE-MT represents mutant FBXW7 gene transfected with chr4:152326101 C>T. Differences between groups were analyzed using ANOVA. Figure 6As can be seen above, the FBXW7 gene chr4:152326101 C>T mutant can promote the formation of liver cancer cell clones.

[0074] 5.6. Analysis of the tumor-bearing ability of hepatocellular carcinoma cells carrying the FBXW7 gene chr4:152326101 C>T mutant in mice. The aforementioned cell line was subcutaneously implanted in mice to analyze the effect of the FBXW7 gene chr4:152326101 C>T mutant on the tumor-bearing ability of hepatocellular carcinoma cells in mice. Ten male BALB / c-nu mice, aged 42-48 days, were purchased from Guangdong Vital River Laboratory Animal Technology Co., Ltd. The mice were housed in a qualified SPF (Self-Protected Feeding) area of ​​a laboratory animal center, under high-pressure conditions with appropriate temperature, humidity, and light. The nude mice had sufficient space to move around and access to autoclaved drinking water and food at all times. The experimental animals used in this study have been approved by the ethics committee. The specific procedures were as follows: ① Ten male BALB / c-nu mice were randomly divided into two groups: the OE-WT group (mice injected with wild-type hepatocellular carcinoma cells carrying the FBXW7 gene chr4:152326101 C>T) and the OE-MT group (mice injected with mutant hepatocellular carcinoma cells carrying the FBXW7 gene chr4:152326101 C>T), with five mice in each group. Mice were fed SPF-grade normal food for one week to acclimatize. ② Mice from the OE-WT group were subcutaneously injected with the wild-type HCCLM3 hepatocellular carcinoma cell line carrying the FBXW7 gene chr4:152326101 C>T in the right upper arm axilla. Mice from the other group were injected with the mutant HCCLM3 hepatocellular carcinoma cell line carrying the FBXW7 gene chr4:152326101 C>T. The number of cells injected was 5 × 10⁻⁶. 7 Each mouse was then fed an SPF-grade normal diet. During this period, the mice's growth, weight, and changes in subcutaneous tumors were closely monitored. The size of the tumor was measured every 3 days. The tumor volume was calculated using the formula: V (tumor volume) = 0.5 × L (long diameter of the tumor) × W 2 (Square of the short axis of the tumor). ③ After 24 days of feeding, the observation period ended. Nude mice were anesthetized with 3% chloral hydrate, tumor tissue was isolated, and the size and weight of the tumor were measured. The results are as follows: Figure 7 As shown. Figure 7 OE-WT represents the wild-type transfected cell line of the FBXW7 gene chr4:152326101 C>T, and OE-MT represents the mutant transfected cell line of the FBXW7 gene chr4:152326101 C>T. Differences between groups were analyzed using a t-test. Figure 7 As can be seen above, the FBXW7 gene chr4:152326101 C>T mutant can promote the formation of liver cancer cells in vivo.

[0075] Example 6: Research on the application value of FBXW7 gene chr4:152326101 C>T mutation in guiding the efficacy of the targeted anticancer drug sorafenib in the treatment of aflatoxin-related liver cancer. 6.1 Collection of aflatoxin-related liver cancer tumor samples and DNA extraction In the aflatoxin-related hepatocellular carcinoma tumor samples of Example 4, a total of 122 patients belonging to BCLC-C stage were selected. Among them, 64 patients received targeted anticancer drug sorafenib treatment and were defined as the ST group, while the other 78 patients did not receive targeted anticancer drug sorafenib treatment and were defined as the control group. The two groups were well comparable in terms of clinicopathological baseline characteristics such as age, sex, ethnicity, and tumor grade.

[0076] DNA was extracted from tumor cells as a sample to be tested, following the method in step 4.2 of Example 4.

[0077] 6.2 Detection of FBXW7 gene chr4:152326101 C>T mutation The FBXW7 gene chr4:152326101 C>T mutation was detected in the DNA samples to be tested according to the method described in step 4.3 of Example 4. The results showed that the FBXW7 gene chr4:152326101 C>T mutation was detected in the DNA samples of 47 patients.

[0078] 6.3. The effect of FBXW7 gene chr4:152326101 C>T mutation on the efficacy of sorafenib in treating aflatoxin-related hepatocellular carcinoma. Using the Kaplan-Meie survival analysis model, survival curves were plotted to assess the efficacy of sorafenib in treating aflatoxin-related hepatocellular carcinoma based on molecular subtyping of different FBXW7 gene chr4:152326101 genotypes. The results are as follows: Figure 8 As shown. From Figure 8 As can be seen above, for liver cancer patients without the FBXW7 gene chr4:152326101 C>T mutation, sorafenib treatment can effectively improve the overall survival of aflatoxin-related liver cancer. Figure 8 (Figure A) and tumor recurrence-free survival ( Figure 8 (See Figure B). However, for liver cancer patients with the FBXW7 gene chr4:152326101 C>T mutation, sorafenib treatment did not effectively improve overall survival in aflatoxin-associated liver cancer. Figure 8 (Figure C) and tumor recurrence-free survival ( Figure 8(See Figure D). Multivariate Cox regression survival model analysis further confirmed that sorafenib treatment effectively reduced the risk of death and tumor recurrence in patients with aflatoxin-related hepatocellular carcinoma who did not have the FBXW7 gene chr4:152326101 C>T mutation; however, this effect was not observed in patients with the FBXW7 gene chr4:152326101 C>T mutation (see Tables 6 and 7).

[0079] Table 6. Adjusted differences in mortality risk in patients with aflatoxin-related hepatocellular carcinoma treated with sorafenib due to the FBXW7 gene chr4:152326101 C>T mutation.

[0080] In Table 6, the superscript "a" indicates the risk value of the corresponding variable calculated using a multivariate Cox regression survival model; "*" indicates P < 0.01 (significant difference); "HR" indicates the hazard value; "CI" indicates the confidence interval; and "P" indicates the statistical P-value.

[0081] Table 7. Adjusted differences in tumor recurrence risk in patients with aflatoxin-related hepatocellular carcinoma treated with sorafenib due to the FBXW7 gene chr4:152326101 C>T mutation.

[0082] In Table 7, the superscript "a" represents the risk value of the corresponding variable calculated using a multivariate Cox regression survival model; "*" indicates P < 0.01 (significant difference); "HR" represents the hazard value; "CI" represents the confidence interval; and "P" represents the statistical P-value.

[0083] Depend on Figure 8 As shown in Tables 6 and 7, the FBXW7 gene chr4:152326101 C>T mutation is an important molecular marker for guiding the decision on targeted drug therapy for aflatoxin-associated hepatocellular carcinoma. Therefore, detecting the FBXW7 gene chr4:152326101 C>T mutation can enable molecular subtyping diagnosis of aflatoxin-associated hepatocellular carcinoma, thereby assessing the clinical efficacy of targeted anticancer drugs such as sorafenib.

[0084] The embodiments described above are merely preferred embodiments of this application and are not intended to limit the scope of protection of this application. Various modifications and variations can be made to this application by anyone skilled in the art. Any simple equivalent changes and modifications made based on the scope of protection claimed in this application and the content of the specification should be included within the scope of protection of this application.

Claims

1. An aflatoxin-related biomarker for liver cancer, characterized in that, Using GRCh38 as the reference genome, the biomarker is the FBXW7 gene chr4:152326101 C>T.

2. The use of the biomarker of claim 1 or its expressed product in the preparation of a detection product for aflatoxin-related hepatocellular carcinoma subtyping and / or a prognostic assessment product.

3. The use according to claim 2, characterized in that, The testing product is a reagent kit.

4. A TaqMan-PCR kit for detecting aflatoxin-related liver cancer markers as described in claim 1, characterized in that, The TaqMan-PCR kit contains primer pairs for amplifying the FBXW7 gene, probe T as shown in SEQ ID No. 17, and probe C as shown in SEQ ID No. 18; the sequences of the primer pairs are shown in SEQ ID No. 19 and SEQ ID No.

20.

5. The TaqMan-PCR kit according to claim 4, characterized in that, The TaqMan-PCR kit contains a positive control and a standard. The nucleotide sequences of the positive control are shown in SEQ ID No. 21 and SEQ ID No. 22, and the nucleotide sequences of the standard are shown in SEQ ID No. 23 and SEQ ID No.

24.

6. The TaqMan-PCR kit according to claim 4, characterized in that, The TaqMan-PCR kit contains PCR amplification reagents, which consist of the following: 0.08 U / μL Taq deoxyribonucleic acid polymerase, 2 U / μL enzyme buffer, 0.4 μM deoxyribonucleic acid triphosphate, and 4 μM magnesium chloride.

7. A PCR kit for amplifying the aflatoxin-related liver cancer marker as described in claim 1, characterized in that, The PCR kit contains an amplicon primer pair; the gene fragment of the amplicon contains the marker as described in claim 1; the sequences of the amplicon primer pair are shown in SEQ ID No. 25 and SEQ ID No.

26.

8. The PCR kit according to claim 7, characterized in that, The PCR kit contains a positive control, the nucleotide sequence of which is shown in SEQ ID No. 27 and SEQ ID No.

28.

9. The PCR kit according to claim 7, characterized in that, The PCR kit contains amplicon PCR amplification reagent, which consists of the following components: 0.08 U / μL Taq deoxyribonucleic acid polymerase, 2 U / μL enzyme buffer, 0.4 μM deoxyribonucleic acid triphosphate, and 4 μM magnesium chloride.

10. The PCR kit according to claim 7, characterized in that, The PCR kit contains an amplicon purification reagent, which consists of the following components: 3M sodium acetate at pH 5.2, anhydrous ethanol, and TE buffer. The TE buffer contains 10mM Tris-HCl and 1mM sodium ethylenediamine diacetate.