Promoter region SNP marker combinations, detection reagents and their applications related to chicken egg production performance

By screening for SNP marker combinations that are significantly associated with chicken egg production performance in the promoter region of the CHST8 gene and designing corresponding detection primers, the problem of unclear SNP marker function in the promoter region in the existing technology has been solved, and precise breeding and efficient selection of chicken egg production performance have been achieved.

CN122012753BActive Publication Date: 2026-06-30SHANDONG AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610491543.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-04-15
Publication Date
2026-06-30
Estimated Expiration
2046-04-15

AI Technical Summary

Technical Problem

In the molecular breeding of chicken egg production performance, the functional effects of promoter region SNP markers are unclear, and the breeding value varies significantly, which limits the development of precision molecular breeding. Furthermore, research on the CHST8 gene in poultry is relatively limited.

Method used

A combination of SNP markers containing the promoter region of the CHST8 gene was developed, including the first SNP markers (SNP1, SNP2, SNP3), and corresponding primer pairs A and B were designed for PCR detection. The egg production performance of chickens was predicted by detecting their genotype.

Benefits of technology

It enables precise prediction and selection of chicken egg production performance, improves breeding efficiency, and ensures that superior genotypes perform better in traits such as egg production, thus having significant breeding value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012753B_ABST
    Figure CN122012753B_ABST
Patent Text Reader

Abstract

This invention discloses a promoter region SNP marker combination, detection reagent, and its application related to chicken egg production performance, belonging to the field of molecular genetics technology. This invention is the first of its kind in... CHST8 Three SNP sites significantly associated with egg production performance were identified in the promoter screening of the gene. All three are located within key regulatory regions of the promoter and possess the potential to influence transcription factor binding and gene transcription activity. Furthermore, these three SNP sites exhibit a consistent effect trend across different genotypes, meaning that superior genotypes show better performance in key traits such as egg production. In marker-assisted breeding, consistency and stability of effect direction are often more practically significant. Therefore, the promoter region SNP marker combinations of this invention are of great importance for breeding high-producing laying hens.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, specifically to a combination of promoter region SNP markers related to chicken egg production performance, detection reagents, and their applications. Background Technology

[0002] Egg production performance is a core economic trait in chicken breeding, mainly including indicators such as age at first laying, number of eggs laid, and longest consecutive laying days. Its heritability is moderate to low, and it is regulated by multiple genes and the environment. Traditional phenotypic selection has limitations such as long cycle, low efficiency, and susceptibility to environmental interference. Single nucleotide polymorphisms (SNPs), as a form of variation of a single base in the genome, have advantages such as high distribution density, strong genetic stability, and automated typing. They have become the core molecular markers for poultry molecular breeding, providing key technical support for the precise genetic improvement of egg production performance.

[0003] In recent years, through genome-wide association studies and candidate gene methods, a large number of SNP markers significantly associated with egg production performance in chickens have been identified, involving genes in key pathways such as endocrine regulation and follicle development. These SNP markers participate in the genetic regulation of egg production traits by regulating gene expression levels and altering protein structure, and are gradually being applied to marker-assisted selection in laying hens. However, current research still faces challenges such as a low proportion of functional SNPs, unclear mechanisms of action of non-coding region SNPs, and significant differences in the breeding value of SNPs from different regions, which hinder the precision development of molecular breeding.

[0004] The gene promoter region is a core regulatory region located upstream of the transcription start site, directly controlling the efficiency of gene transcription initiation and expression levels. Compared to molecular markers in gene exons, introns, and 3'UTR / 5'UTR regions, promoter region SNPs have clear functional effects, can directly alter transcription factor binding affinity, regulate gene expression from the source, and avoid functional ambiguity issues caused by synonymous mutations and neutral variations. Furthermore, their markers exhibit high specificity and genetic stability, enabling synergistic regulation of multiple egg production traits, and possess significant advantages in molecular breeding for egg production performance.

[0005] Current research on promoter region SNPs for egg production performance in chickens is still in its early stages, and the number of high-quality functional markers is limited. In-depth exploration of promoter region SNPs of key egg production genes, analysis of their regulatory mechanisms, and development of efficient breeding applications are of great theoretical and practical significance for improving the efficiency of genetic improvement of laying hens and breeding new breeds of high-yield and high-quality laying hens.

[0006] CHST8 (Carbohydrate sulfotransferase 8) belongs to the carbohydrate sulfotransferase family and is mainly involved in the sulfation modification of glycoproteins and glycolipids. This process plays an important role in maintaining extracellular matrix structure, intercellular signal transduction, and regulating cellular function. Currently, regarding...CHST8 Research on genes in birds is still relatively limited, and no data on... CHST8 A report on the correlation between SNP markers in gene promoter regions and egg production performance in chickens. Summary of the Invention

[0007] In view of the above-mentioned prior art, the purpose of this invention is to provide a promoter region SNP marker combination, detection reagent and its application related to chicken egg production performance.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides a combination of SNP markers for promoter regions related to egg production performance in chickens, comprising: a first SNP marker and a second SNP marker;

[0010] The nucleotide sequence of the first SNP marker is shown in SEQ ID NO.1; the 128th base from the 5' end of the sequence is the SNP1 site, and its base polymorphism is C or T;

[0011] The nucleotide sequence of the second SNP marker is shown in SEQ ID NO.2; the 214th base from the 5' end of the sequence is the SNP2 site, and its base polymorphism is T or C; the 276th base from the 5' end of the sequence is the SNP3 site, and its base polymorphism is G or A.

[0012] The specific nucleotides marked by the first SNP are as follows:

[0013] ACAGTTCTTATCTGAGCACTGTATATTTGAGCACCTCAAATAGCACAGAACCATTCATAAAAAATGGGCAAGAGAGACTGTGTCCCATCAATATTTCAAGCTTGGTTATCAAATCAAGAGAAAGCCA C / T(SNP1)GAGTCCTGCTCCAGATCAACATTTGCAGGTTTGATACGATTGTTTGGCAGTTTAGTTTCTTTTTTCCCCTCTGCATTCTCATTGTCTTTAATATTTTATATAACCTTCCAGTTGATGGTTATTGTAATATTTATTAATTTTTCTTTACTTGGCTGCACTAACCAGTTTGCTCCTTTCTCTTTCAGCAGGGAGAAATTCACACTCATTTGCTATTTGCGGGGTGATGACACAGTGTGAAGAAGCAGTAATGATGACTGACTGATAGAAGACACCATATGTTCTCTTCATTTTTCTCTGTGCTATTTTATGAGAGAGGAATAAAGACTCAAT。

[0014] The nucleotides of the second SNP marker are as follows:

[0015] ACTCCCTTCCTAATGCCTTTCAGTCTTTCACAGTAAAAACTCCAAAACCAGACATTGTTTGTGACTAAACAAAGGTTAGAAATTCCTCCCAATTTTAAAGAACGCTGCATATAATCCCATTAATTACGTGCCAATCTGTACTACAAGACAGCCAACAACCCCGACCACAAGCAGCTGCCAGTACCGCCAGAGCCAGCGCTGTGCGTCGGGATG T / C(SNP2)TTCCTTACACACCCAGAGCACGAGTCAGCACAGCTACGCGACCAATGGCATCAGCTTTAAC G / A(SNP3)TGTTTTAGTCTTAAGAAAGAAGAAATGTCATTTTCGATCAAATATGTGAAAAGCTTTCACTGTTGTAACTCATGCACCTAAGTATGCTCTTTTCTTACAAACTCCTGAATATTTTTGTTTTCCCCCACTTCCTTAATCTACCCTCCCAAACCAAAGCTGTCTGATTTTTGCTCTTCCTCCTAACTTCACAACAGCCACTAACT。

[0016] Note: The nucleotides in bold italics in the sequence are SNP sites, which are represented in the sequence listing as the corresponding degenerate bases. For example: the degenerate base of C / T is Y; the degenerate base of G / A is R.

[0017] This invention is in chicken CHST8 Three SNP sites that are significantly associated with egg production performance in hens were found in the promoter region of the gene (Gene ID: 769263).

[0018] The physical locations corresponding to the above three SNP sites are as follows:

[0019] The physical location of SNP1 is 11_10488156; its base polymorphism is C or T, and the dominant allele associated with the number of eggs laid at peak laying period (EN2) and the total number of eggs laid at 43 weeks of age (E43) is T. The TT genotype corresponds to a higher number of eggs laid.

[0020] The physical location of SNP2 is 11_10488907; its base polymorphism is T or C, and the dominant allele associated with the number of eggs produced during the rising egg production period (EN1) and the total number of eggs produced at 43 weeks of age (E43) is C. The CC genotype corresponds to a higher number of eggs produced.

[0021] The physical location of SNP3 is 11_10488969; its base polymorphism is G or A. The dominant allele associated with the number of eggs produced during the rising egg production period (EN1) and the total number of eggs produced at 43 weeks of age (E43) is A. The AA genotype corresponds to a higher number of eggs produced.

[0022] The reference genome for the above physical location is Gallus gallus 6.0.

[0023] Based on these three SNP sites, this invention developed molecular markers related to hen egg production performance for the breeding of hens with high egg production.

[0024] A second aspect of the present invention provides a detection reagent comprising: primer pair A for detecting a first SNP marker and primer pair B for detecting a second SNP marker;

[0025] Primer pair A consists of the upstream primer shown in SEQ ID NO.3 and the downstream primer shown in SEQ ID NO.4; primer pair B consists of the upstream primer shown in SEQ ID NO.5 and the downstream primer shown in SEQ ID NO.6. Specifically:

[0026] Primer pair A:

[0027] CHST8- 1-F:ACAGTTCTTATCTGAGCACTG; (SEQ ID NO.3)

[0028] CHST8- 1-R:ATTGAGTCTTTATTCCTCTCTC. (SEQ ID NO.4)

[0029] Primer pair B:

[0030] CHST8- 2-F:ACTCCCTTCCTAATGCCTTTC; (SEQ ID NO.5)

[0031] CHST8- 2-R: AGTTAGTGGCTGTTGTGAAG. (SEQ ID NO.6)

[0032] Preferably, the detection reagent is a PCR sequencing kit or a KASP typing kit.

[0033] A third aspect of the present invention provides the application of the above-mentioned promoter region SNP marker combination in the selection of hens with high egg production trait.

[0034] A fourth aspect of the present invention provides the use of the above-described detection reagent in the following (1) or (2):

[0035] (1) Identify the egg-laying traits of hens;

[0036] (2) Select and breed hens with a high egg production rate.

[0037] In the above applications, the egg production traits include: the number of eggs produced during the rising egg production period, the number of eggs produced during the peak egg production period, or the total number of eggs produced at 43 weeks of age.

[0038] In the above applications, the method for selecting hens with a high egg production trait is as follows:

[0039] Using the genomic DNA of the hen to be tested as a template, primer A was amplified by PCR using primers shown in SEQ ID NO.3 and SEQ ID NO.4 to obtain amplification product A; primer B was amplified by PCR using primers shown in SEQ ID NO.5 and SEQ ID NO.6 to obtain amplification product B; amplification products A and B were sequenced, and the egg production trait of the hen was identified based on the sequencing results, and hens with high egg production were selected.

[0040] Specifically, if the sequencing result of amplification product A corresponds to the TT genotype at position 128 of the sequence shown in SEQ ID NO.1; and the sequencing result of amplification product B corresponds to the CC genotype at position 214 and the AA genotype at position 276 of the sequence shown in SEQ ID NO.2, then it is identified as having the trait of high egg production.

[0041] Preferably, the PCR amplification system is as follows: 2 μL genomic DNA, 25 μL 2×Phanta UniFi Master Mix, 2 μL each of upstream and downstream primers (10 μM), and ddH2O to a final volume of 50 μL.

[0042] The PCR amplification program was as follows: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds; 50℃-53℃ annealing for 10 seconds; 72℃ extension for 30 seconds, for 35 cycles; after the cycles, complete extension was performed and incubated at 72℃ for 5 minutes.

[0043] The beneficial effects of this invention are:

[0044] This invention is the first of its kind in CHST8 Three SNP sites significantly associated with egg production performance were identified in the promoter screening of the gene. All three are located within key regulatory regions of the promoter and possess the potential to influence transcription factor binding and gene transcription activity. Furthermore, these three SNP sites exhibit a consistent effect trend across different genotypes, meaning that superior genotypes show better performance in key traits such as egg production. In marker-assisted breeding, consistency and stability of effect direction are often more practically significant. Therefore, the promoter region SNP marker combinations of this invention are of great importance for breeding high-producing laying hens. Attached Figure Description

[0045] Figure 1 Among different chicken breeds CHST8 Polymorphism in key promoter regions of genes.

[0046] Figure 2 : CHST8 Linkage disequilibrium analysis of SNPs in key promoter regions of genes; in the figure, 3 represents SNP1 with physical location 11_10488156; 4 represents SNP2 with physical location 11_10488907; and 5 represents SNP3 with physical location 11_10488969.

[0047] Figure 3 : CHST8 The effect of SNP mutations in key promoter regions of genes on promoter activity.

[0048] Figure 4 : Gel electrophoresis results of amplification products; In the figure, A is the gel electrophoresis result of amplification product A; B is the gel electrophoresis result of amplification product B; M: Marker, lanes 1-5 are the amplification products of the Langya chicken hen to be tested in Example 3. Detailed Implementation

[0049] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0050] Terminology Explanation:

[0051] AFE: Age at first egg; the age at which a hen lays its first egg.

[0052] EN1: Number of eggs produced during the rising egg production period; the rising egg production period refers to the period from AFE to 26 weeks of age.

[0053] EN2: Number of eggs laid during peak laying period; peak laying period refers to 27-36 weeks of age.

[0054] EN3: Number of eggs produced during the laying period; the laying period refers to 37-43 weeks of age.

[0055] E43: Total number of eggs laid at 43 weeks of age; refers to the total number of eggs laid by individuals from AFE to 43 weeks of age.

[0056] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0057] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions. Wherein:

[0058] Zaozhuang Sunzhi Chicken comes from Shandong Sunzhi Chicken Breeding Technology Co., Ltd.; Hy-Line Brown commercial laying chicken comes from Linxi Village, Daiyue District, Tai'an City, Shandong Province; Rizhao Langya Chicken comes from Shandong Jihua Poultry Breeding Co., Ltd.; Jinghong laying chicken comes from Li Shijun's research group at Huazhong Agricultural University; and Jining 100-day chicken comes from Jining Datang 100-day chicken conservation farm.

[0059] Example 1: Screening, identification, and association analysis of SNP molecular markers associated with egg production traits in hens.

[0060] 1. Screening and identification of SNP molecular markers related to egg production traits in hens:

[0061] Twenty blood genomic DNA samples were randomly selected from each of the following chicken breeds: Zaozhuang Sunzhi Chicken, Hy-Line Brown Commercial Layer Chicken, Rizhao Langya Chicken, Jinghong Layer Chicken, and Jining Hundred-Day Chicken. Using these samples as templates, promoter regions containing SNP sites were amplified by PCR. The regions were then detected by 1% agarose gel electrophoresis. The gel samples were excised, recovered, and sent to the company for sequencing. The sequencing sequences were then compared with those on the NCBI website. CHST8 The gene promoter region was compared to screen for SNP sites.

[0062] According to the NCBI database, chicken CHST8 The genome annotation information of the gene (Gene ID: 769263) was analyzed, with the sequence upstream of its transcription start site as a potential promoter region. Typically, the core regulatory region of a gene promoter is located approximately 1 kb upstream of the TSS; therefore, this region was selected as a candidate promoter region for amplification and analysis in this embodiment. Ultimately, three SNP sites located within the key regulatory region of the promoter and present in all five egg-laying hen breeds were identified. Figure 1 ), respectively:

[0063] The physical location of SNP1 is 11_10488156; its base polymorphism is C or T;

[0064] The physical location of SNP2 is 11_10488907; its base polymorphism is T or C;

[0065] The physical location of SNP3 is 11_10488969; its base polymorphism is G or A.

[0066] 2. Association analysis of three SNPs with egg production traits of Langya hens:

[0067] Using the Langya chicken breeding population from Shandong Jihua Poultry Breeding Co., Ltd. as experimental animals, 1129 hens were randomly selected from the same batch and housed individually under the same environmental and feeding conditions. The age at first egg (AFE) of each hen was recorded, and individual egg production was recorded daily thereafter. An egg production curve was plotted based on the daily egg production of each hen from the date of first egg to 43 weeks of age. The number of eggs produced during the rising egg production period (EN1), the peak egg production period (EN2), the sustained egg production period (EN3), and the total number of eggs produced at 43 weeks of age (E43) were recorded. The longest continuous egg production period (MCL) for each hen was calculated based on the daily egg production records.

[0068] Blood was collected from the wing veins of 1129 hens after the egg production record was completed, and heparin sodium was used for anticoagulation. Genomic DNA was extracted from the chicken blood using the Tiangen DNA kit. The concentration and purity of the extracted DNA samples were determined by a Nano-500 micro spectrophotometer and verified by 1% agarose gel electrophoresis.

[0069] Genome sequencing was used to determine the genotypes of Langya chickens at three loci: 11_10488156, 11_10488907, and 11_10488969. Association analysis was performed with these genotypes and laying traits, including: age at first laying (AFE), number of eggs laid during the rising laying period (EN1), number of eggs laid during peak laying (EN2), number of eggs laid during the duration of laying (EN3), total number of eggs laid at 43 weeks of age (E43), and longest continuous laying period (MCL). The results are shown in Table 1.

[0070] Table 1: CHST8 Association analysis of key promoter region SNP sites in genes with egg production traits in Langya chickens

[0071]

[0072] Note: When P < 0.05, the association between each genotype and the egg production trait is significantly different; otherwise, it is not significant. The unit for AFE and MCL is "days," and the unit for EN1, EN2, EN3, and EN43 is "units."

[0073] The results showed that the 11_10488156 locus was significantly associated with the number of eggs laid during the peak laying period (EN2) and the number of eggs laid at 43 weeks of age (E43), with the TT genotype corresponding to a higher number of eggs laid; the 11_10488907 locus was significantly associated with the number of eggs laid during the rising laying period (EN1) and the number of eggs laid at 43 weeks of age (E43), with the CC genotype corresponding to a higher number of eggs laid; and the 11_10488969 locus was significantly associated with the number of eggs laid during the rising laying period (EN1) and the number of eggs laid at 43 weeks of age (E43), with the AA genotype corresponding to a higher number of eggs laid.

[0074] Moreover, the three SNP loci mentioned above all showed a consistent effect trend across different genotypes, meaning that superior genotypes performed better in key traits such as egg production. In marker-assisted breeding, the consistency of the effect direction has greater practical application value.

[0075] 3. Linkage disequilibrium analysis of three SNP loci in the Langya chicken population:

[0076] The linkage disequilibrium (LD) of three SNP sites (11_10488156, 11_10488907, and 11_10488969) in the key promoter region of the CHST8 gene in the Langya chicken population was analyzed using Haploview software.

[0077] The results are as follows Figure 2As shown, loci 11_10488907 and 11_10488969 are closely linked, forming a haplotype block. This indicates that these loci can be used as combined molecular markers for selection-aided selection. In practical breeding, multi-locus combined selection (haplotype or combined genotype) is usually significantly superior to single-locus selection. Therefore, even if the effect of a single locus is limited, its combined application still has clear breeding value.

[0078] Example 2: CHST8 The effect of key promoter region SNP sites on promoter region transcriptional activity

[0079] 1. Test method:

[0080] 1.1 Chicken CHST8 Construction of expression vectors for mutant luciferase at polymorphic sites in gene promoter regions:

[0081] by CHST8 Using the gene promoter region as a template, design CHST8 The full-length primers for amplifying the gene promoter region, as well as the mutant primers for the three sites 11_10488156 (g.-2857C>T), 11_10488907 (g.-2106T>C), and 11_10488969 (g.-2044 G>A), are shown in Table 2.

[0082] Table 2: Full-length amplification primers and point mutation primers

[0083]

[0084] Amplification was performed using a high-fidelity enzyme. The reaction system (50 μL) included: 2 μL genomic DNA (50-100 ng), 25 μL 2×Phanta UniFi Master Mix, 2 μL each of forward and reverse primers, and ddH2O to a final volume of 50 μL. The amplification program was as follows: 98℃ pre-denaturation for 30 sec; 98℃ denaturation for 10 sec, annealing for 10 sec (annealing temperatures as shown in Table 2), 72℃ extension for 1 min 45 sec, for 35 cycles; after the cycles, a final extension was performed at 72℃ for 5 min. PCR products were detected by 1% agarose gel electrophoresis at 220V for 15 min. The products were then recovered using an agarose gel extraction kit. The target fragment was ligated into the pGL3-Basic vector, transformed, and single-clone cultured overnight before being sent to the company for sequencing. The sequencing results were compared with the CHST8 gene promoter region sequence in the NCBI database, confirming the successful construction of the mutant plasmid.

[0085] Using the endotoxin-free high-purity plasmid miniprep kit from Adley Biotech, plasmids pGL3-CHST8, pGL3-8156(T), pGL3-8907(C), and pGL3-8969(A) were extracted according to the instructions and used for transfection of primary cells.

[0086] 1.2 Isolation and culture of chicken follicle granulosa cells:

[0087] Hy-Line Brown commercial laying hens at peak egg production were selected and euthanized by exsanguination via the jugular vein. The abdomen was opened with sterile scissors, and the entire ovary was removed and placed in a beaker containing 5% penicillin-streptomycin phosphate buffer. The outer membrane of the follicle was peeled off, and the yolk was released completely by puncturing the follicle with scissors. The granulosa layer was carefully separated with forceps and washed 2-3 times in PBS. The processed graded granulosa cells were aspirated using a disposable sterile syringe and placed in a 15mL centrifuge tube. The tube was centrifuged at 2000 rpm for 5 minutes. The PBS buffer was discarded, and an appropriate amount of trypsin was added to the centrifuge tube. After mixing thoroughly, the tube was incubated in a 37°C water bath for 8-10 minutes. An appropriate amount of M199 medium was added to terminate the digestion. After digestion, the cells were filtered through a 200-mesh filter into a sterile beaker in a laminar flow hood. Immediately transfer the filtrate to a new 15 mL centrifuge tube, centrifuge at 2,000 rpm for 5 min, discard the supernatant, then wash with PBS buffer, centrifuge at 2,000 rpm for 5 min, discard the supernatant, add M199 culture medium containing 1% penicillin-dextrose antibody and 5% FBS, and mix thoroughly by pipetting to suspend the cells. Seed the cells in 24-well culture plates and incubate statically at 39°C with a CO2 concentration of 5%. Change the medium after 24 h.

[0088] 1.3 Plasmid transfection experiment:

[0089] (1) When the cells have adhered and grown to 80-90% confluency, transfect them. Prepare the mixture for each well according to the following steps:

[0090] a. Take a 1.5 mL centrifuge tube, add 25 μL of Opti medium and 1.25 μL of LTX transfection reagent;

[0091] b. Take a 1.5 mL centrifuge tube, add 25 μL of Opti medium, 800 ng of target plasmid, 100 ng of Renaissance fluorescent plasmid and 0.9 μL of Plus;

[0092] (2) After incubating at room temperature for 5 min, combine solutions a and b, mix by blowing and stirring, and let stand for 20 min.

[0093] (3) Take out the cells to be transfected, discard the culture medium, wash twice with PBS, add 450 μL of serum-free and antibiotic-free M199 culture medium to each well; after the transfection mixture has been incubated, slowly add the cells, gently shake the cell plate to mix them, and put it into a cell culture incubator.

[0094] (4) After 6 hours, change the medium and discard the medium. Add 500 μL of pure M199 medium containing 5% serum but without antibiotics to each well. Continue culturing for 24-48 hours and then harvest the cells for dual-luciferase activity detection.

[0095] 1.4 Dual-luciferase activity assay:

[0096] (1) Preparation of dual-luciferase activity assay reagent

[0097] a. 1×PLB lysis buffer: The amount of this lysis buffer used per well is 100μL. The preparation ratio is: 20μL 5×PLB lysis buffer + 80μL ddH2O. Mix well by blowing and set aside.

[0098] b. 1×Stop stop solution: The amount of stop solution used per well is 100μL. The preparation ratio is: 2μL 50×Stop stop solution + 98μL Stop buffer. Mix well by blowing and set aside.

[0099] c. LARII reagent: Use a pipette to add 10 mL of LA Buffer to LARII powder, mix well by inverting the pipette, and set aside.

[0100] (2) Detection of dual-luciferase activity:

[0101] a. Remove the cells, discard the culture medium, and wash the cells with 300 μL of PBS buffer per well, repeating twice.

[0102] b. Add 100 μL of 1×PLB cell lysis buffer to each well and place in a shaker and shake for 10 min.

[0103] c. Repeatedly pipette the mixture until the cells are completely lysed, then transfer the lysate to a new 1.5 mL centrifuge tube and centrifuge at 13000 rpm for 2 min. Use a pipette to transfer 20 μL of the supernatant into the new centrifuge tube.

[0104] d. First, calibrate twice with an empty tube. Then, add 100 μL of LARII reagent to the supernatant, mix well by pipetting, and then test. The measured value is the firefly activity value A. Record the data.

[0105] e. Add 100 μL of 1×Stop solution, mix thoroughly by pipetting, and measure the value again. This value is the activity value B of the sea ginseng. Record the data.

[0106] f. The value of A / B is the measured value. CHST8 The activation efficiency of the target gene fragment is determined by different SNP sites. CHST8 Quantification results of the relative transcriptional activity of the promoter.

[0107] 1.5 Statistical Analysis

[0108] Data were analyzed using t-tests for pairwise comparisons. Data were expressed as mean ± standard error. P < 0.05 was considered statistically significant, and P < 0.01 was considered highly statistically significant.

[0109] 2. Test Results:

[0110] The results are as follows Figure 3 As shown, the transcriptional activity was significantly reduced when G was mutated to A at position 11_10488969 (P<0.001); the transcriptional activity was significantly reduced when T was mutated to C at position 11_10488907 (P<0.001); and the transcriptional activity was significantly reduced when C was mutated to T at position 11_10488156 (P<0.001).

[0111] Example 3: Design and application verification of SNP marker combinations in promoter regions associated with egg production traits in hens.

[0112] 1. Design of SNP marker combinations and detection primers for promoter regions related to egg production traits in hens:

[0113] Based on the three SNP loci that were significantly associated with the egg production trait of hens screened in Example 1, this example designed a combination of promoter region SNP markers associated with the egg production trait of hens; including: a first SNP marker and a second SNP marker;

[0114] The nucleotide sequence of the first SNP marker is shown in SEQ ID NO.1; the 128th base from the 5' end of the sequence is the SNP1 site, and its base polymorphism is C or T;

[0115] The nucleotide sequence of the second SNP marker is shown in SEQ ID NO.2; the 214th base from the 5' end of the sequence is the SNP2 site, and its base polymorphism is T or C; the 276th base from the 5' end of the sequence is the SNP3 site, and its base polymorphism is G or A.

[0116] Based on the above-mentioned promoter region SNP marker combinations, detection primer pairs were designed, including: primer pair A for detecting the first SNP marker and primer pair B for detecting the second SNP marker; as detailed below:

[0117] Primer pair A:

[0118] CHST8-1-F:ACAGTTCTTATCTGAGCACTG; (SEQ ID NO.3)

[0119] CHST8- 1-R:ATTGAGTCTTTATTCCTCTCTC. (SEQ ID NO.4)

[0120] Primer pair B:

[0121] CHST8- 2-F:ACTCCCTTCCTAATGCCTTTC; (SEQ ID NO.5)

[0122] CHST8- 2-R: AGTTAGTGGCTGTTGTGAAG. (SEQ ID NO.6)

[0123] 2. Application Validation:

[0124] Another 300 Langya hens with egg production records were selected as test subjects. Genomic DNA was extracted from the test subjects and PCR amplification was performed using the above-mentioned detection primer pairs. The PCR reaction system was 50 μL: 2 μL genomic DNA, 25 μL 2×PhantaUniFi Master Mix, 2 μL each of upstream and downstream primers (10 μM), and ddH2O was added to make up to 50 μL.

[0125] The amplification program for primer pair A was as follows: pre-denaturation at 98℃ for 30 seconds; denaturation at 98℃ for 10 seconds, annealing at 50℃ for 10 seconds, extension at 72℃ for 30 seconds, for 35 cycles; after the cycles, complete extension was performed and incubated at 72℃ for 5 minutes; thus, amplification product A was obtained.

[0126] The amplification program for primer pair B was as follows: pre-denaturation at 98℃ for 30 seconds; denaturation at 98℃ for 10 seconds, annealing at 53℃ for 10 seconds, extension at 72℃ for 30 seconds, for 35 cycles; after the cycles, complete extension was performed and incubated at 72℃ for 5 minutes to obtain amplified product B.

[0127] The gel electrophoresis results of amplification product A and amplification product B are as follows: Figure 4 As shown; sequencing analysis of the amplified products was performed, and the egg production traits of hens were predicted based on the base detection results at three SNP sites in the promoter region SNP marker combination. Specifically:

[0128] Hens with genotypes TT, CC, and AA at SNP1, SNP2, and SNP3 loci, respectively, have higher egg production during the rising egg production period (EN1), peak egg production period (EN2), and 43-week-old egg production (E43) than hens with genotypes CC or CT, TC or TT, GA or GG at the corresponding loci.

[0129] Comparing the marker-based predictions with the actual egg production records of the corresponding hens revealed consistency. This demonstrates that the marker combination of the present invention can be used to predict egg production traits in hens with accurate and reliable results, possessing practical application value.

[0130] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. The application of promoter region SNP markers related to egg production performance in the selection of hens with high egg production count, characterized in that, The promoter region SNP markers related to chicken egg production performance include: a first SNP marker or a second SNP marker; The nucleotide sequence of the first SNP marker is shown in SEQ ID NO.1; the 128th base from the 5' end of the sequence is the SNP1 site, and its base polymorphism is C or T; The nucleotide sequence of the second SNP marker is shown in SEQ ID NO.2; the 214th base from the 5' end of the sequence is the SNP2 site, and its base polymorphism is T or C; the 276th base from the 5' end of the sequence is the SNP3 site, and its base polymorphism is G or A. Hens with the TT genotype at the SNP1 locus have higher peak egg production and higher total egg production at 43 weeks of age than hens with the CC or CT genotype at the corresponding locus; or, Hens with the CC genotype at the SNP2 locus have higher egg production during the rising egg production period and higher total egg production at 43 weeks of age than hens with the TC or TT genotype at the corresponding locus; or, Hens with the AA genotype at the SNP3 locus have a higher egg production during the rising egg production period and a higher total egg production at 43 weeks of age than hens with the GA or GG genotype at the corresponding locus.

2. Application of the test reagent in the following (1) or (2): (1) Identify the egg-laying traits of hens; (2) Select and breed hens with a high egg production rate; The detection reagent comprises: primer pair A for detecting the first SNP marker or primer pair B for detecting the second SNP marker; Primer pair A consists of the upstream primer shown in SEQ ID NO.3 and the downstream primer shown in SEQ ID NO.4; primer pair B consists of the upstream primer shown in SEQ ID NO.5 and the downstream primer shown in SEQ ID NO.

6. The egg-laying traits include: Egg production during the rising egg production period, egg production during the peak egg production period, or total egg production at 43 weeks of age; The method for selecting hens with a high egg production trait is as follows: Using the genomic DNA of the hen to be tested as a template, primer A was amplified by PCR using primers shown in SEQ ID NO.3 and SEQ ID NO.4 to obtain amplification product A; primer B was amplified by PCR using primers shown in SEQ ID NO.5 and SEQ ID NO.6 to obtain amplification product B; amplification products A and B were sequenced, and the egg production trait of the hen was identified based on the sequencing results, and hens with high egg production were selected; The sequencing result of amplification product A corresponds to the TT genotype at position 128 of the sequence shown in SEQ ID NO.

1. Its peak egg production and total egg production at 43 weeks of age are higher than those of the CC or CT genotypes corresponding to position 128 of the sequence shown in SEQ ID NO.1; or... The sequencing result of amplification product B corresponds to the CC genotype at position 214 of the sequence shown in SEQ ID NO.

2. Its egg production during the rising egg-laying period and total egg production at 43 weeks of age are higher than those of the TC or TT genotypes corresponding to position 214 of the sequence shown in SEQ ID NO.2; or... The sequencing results of amplified product B correspond to the AA genotype at position 276 of the sequence shown in SEQ ID NO.

2. The number of eggs produced during the rising egg production period and the total number of eggs produced at 43 weeks of age are greater than the GA or GG genotypes corresponding to the GA or GG genotypes in the sequence shown in SEQ ID NO.

2.

3. The application according to claim 2, characterized in that, The PCR amplification system consisted of: 2 μL genomic DNA, 25 μL 2×Phanta UniFi Master Mix, 2 μL each of upstream and downstream primers, and ddH2O to a final volume of 50 μL. The PCR amplification program was as follows: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds; 50℃-53℃ annealing for 10 seconds; 72℃ extension for 30 seconds, for 35 cycles; after the cycles, complete extension was performed and incubated at 72℃ for 5 minutes.

4. The application according to claim 2, characterized in that, The detection reagent is a PCR sequencing kit.