Primer pair, kit and method for specifically detecting mannheimia haemolytica
By designing specific primer pairs and a simplified RAA system, the problems of complexity and low sensitivity in the detection of hemolytic Mansonia in existing technologies have been solved, achieving rapid, simple, and sensitive detection that is suitable for grassroots laboratories and field use, reducing reliance on specialized equipment.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHIHEZI UNIVERSITY
- Filing Date
- 2026-03-06
- Publication Date
- 2026-05-12
AI Technical Summary
Existing hemolytic Mansonia solani detection products are complex to operate or have low sensitivity, making them unsuitable for rapid on-site testing in laboratories with limited resources, and thus difficult to effectively control the spread and infection of Mh.
Highly specific primer pairs are designed for recombinase-mediated isothermal nucleic acid amplification (RAA) systems. Combined with simple kits and methods, detection can be completed within 10 to 30 minutes under isothermal conditions of 25℃ to 41℃, making it suitable for primary laboratories and on-site testing.
It enables rapid, simple, and sensitive detection of hemolytic Mansonia solani, with a detection sensitivity of 2.87 × 10¹ copies/μL. The results show a concordance rate of up to 98% with qPCR, making it suitable for field and grassroots laboratories and reducing reliance on specialized laboratories and equipment.
Smart Images

Figure CN122012762A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a primer pair, kit, and method for the specific detection of hemolytic Mansonia. Background Technology
[0002] hemolytic Mansorbacterium ( Mannheimia haemolytica Mansica hystericus (Mh) is a Gram-negative cocci widely found in the respiratory tracts of ruminants such as cattle and sheep, and is an opportunistic pathogen. When animals experience weakened immune function due to long-distance transportation, changes in feeding conditions, environmental stress, or viral infection, Mh can rapidly proliferate and descend to the lungs, causing severe pneumonia and resulting in significant economic losses to the livestock industry. Simultaneously, as a potential zoonotic pathogen, hemolytic Mansica hystericus poses a potential occupational exposure risk to immunocompromised individuals or those with occupational exposure, and it easily contaminates meat products during slaughter and processing, causing public health and animal-derived food safety issues. Therefore, effective measures are needed to control the spread of Mh, and rapid and accurate detection is crucial for its prevention and control.
[0003] Currently, commonly used Mh detection products include ELISA kits, PCR kits, and real-time quantitative PCR (qPCR) kits. However, these products suffer from complex operation or low sensitivity, making them unsuitable for resource-constrained laboratories or field testing. Therefore, developing a rapid, simple, and highly sensitive Mh detection product is of great significance for effectively controlling Mh infection and reducing economic losses in the aquaculture industry. Summary of the Invention
[0004] This invention provides a primer pair, kit, and method for the specific detection of hemolytic Mansonia. The primer pair provided by this invention has high specificity and sensitivity, amplifying specific bands only for hemolytic Mansonia and showing no cross-reactivity with non-target pathogens. The kit provided by this invention has the advantages of being rapid and easy to operate. Detection can be completed in 10 to 30 minutes under constant temperature conditions of 25℃ to 41℃, with a detection sensitivity of 2.87 × 10¹ copies / μL. The clinical sample detection results show a concordance rate of 98% with qPCR, making it suitable for rapid and accurate detection of hemolytic Mansonia in primary laboratories and on-site.
[0005] This invention provides a method for the specific detection of hemolytic Mansonia ( ). Mannheimia haemolytica The primer pair includes the upstream primer shown in SEQ ID NO:3 and the downstream primer shown in SEQ ID NO:4.
[0006] The primer pairs provided by this invention have high specificity and sensitivity, amplifying specific bands only against hemolytic Mansonia and showing no cross-reaction with non-target pathogens.
[0007] The present invention also provides a kit for the specific detection of hemolytic Mansonia, comprising the primer pair described above.
[0008] Furthermore, the kit also contains one or more of a buffer solution and a reactive dry powder.
[0009] The present invention also provides a method for specifically detecting hemolytic Mansonia, comprising the following steps: Using the DNA of the sample to be tested as a template, the primer pair described above is used to carry out the amplification reaction in a recombinase-mediated isothermal nucleic acid amplification reaction system; if a specific amplification band of 206 bp is generated, the sample to be tested contains hemolytic Mansonia.
[0010] Furthermore, the recombinase-mediated isothermal nucleic acid amplification reaction system comprises: 24 μL~26 μL A Buffer, 12.5 μL~14.5 μL ddH2O, 1.5 μL~2.5 μL upstream primer, 1.5 μL~2.5 μL downstream primer, and reaction powder; 4 μL~6 μL of the DNA sample to be tested and 2 μL~3 μL B Buffer are added at the start of the reaction.
[0011] Furthermore, the concentrations of both the upstream and downstream primers are 1 μmol / L to 10 μmol / L.
[0012] Furthermore, the detection of the amplification product is performed by detecting the presence of a specific 206 bp band using agarose gel electrophoresis.
[0013] Furthermore, the amplification reaction was carried out at a constant temperature of 25℃ to 41℃ for 10 min to 30 min.
[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: The primer pair provided by this invention, in a recombinase-mediated isothermal nucleic acid amplification (RAA) system, achieves nucleic acid amplification at an optimal temperature of 37°C for 20 minutes. Compared to traditional PCR methods requiring several hours of thermal cycling and qPCR methods relying on sophisticated instruments, this significantly shortens the detection time and is more suitable for rapid detection. The RAA reaction is performed in a constant-temperature water bath, eliminating the need for complex PCR instruments or quantitative PCR instruments. The operation steps are simple, including sample loading, constant-temperature incubation, and electrophoresis detection, reducing dependence on professional laboratory environments and operators, and facilitating detection in grassroots laboratories.
[0015] This invention designs primers based on the specific gene sequence of hemolytic Mansonia (Mh), and screened multiple primer pairs to determine the optimal primer pair (MH-F2 / MH-R2). Specificity tests show that this method produces specific amplification bands only for the DNA template of Mh, while no amplification signals are found for the DNA of other common animal pathogens such as Mycoplasma synoviae, Mycoplasma bovis, Pasteurella multocida, Mycoplasma gallisepticum, Staphylococcus aureus, Salmonella, and Escherichia coli. This demonstrates that the primers have excellent target pathogen identification ability and effectively avoid false positive results.
[0016] The kit provided by this invention has a limit of detection of 2.87 × 10¹ copies / μL, which is approximately 100 times higher than that of traditional PCR methods (2.87 × 10³ copies / μL). This allows for earlier detection of low-level pathogen infections in the environment, facilitating early warning and intervention for hemolytic Mansicae. It is suitable for rapid on-site detection (such as airborne microbial monitoring in livestock farms, aerosol bacterial load detection during slaughtering and processing, and monitoring of hygiene indicator bacteria on the surface of beef and mutton and the environment during slaughtering), identifying potential public health and animal-derived food safety hazards. Repeatability tests demonstrate that the detection process of this invention is highly stable and reproducible, and the detection results are highly reliable. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 The results show the primer screening for RAA detection. In the figure, A is a grayscale electrophoresis image; B is a UV electrophoresis image; 1 represents the MH-F1 and MH-R1 primer pair, 2 represents the MH-F2 and MH-R2 primer pair, 3 represents the MH-F3 and MH-R3 primer pair, 4 represents the MH-F4 and MH-R4 primer pair, M represents the relative molecular mass standard of DNA, and N represents the blank control.
[0019] Figure 2 The results show the optimized primer concentrations for RAA detection. In the figure, A is the grayscale electrophoresis image with optimized primer concentration, and B is the ultraviolet electrophoresis image with optimized primer concentration. In the figure, 1 indicates a final primer concentration of 1 μmol / L, 2 indicates a final primer concentration of 2.5 μmol / L, 3 indicates a final primer concentration of 5 μmol / L, 4 indicates a final primer concentration of 7.5 μmol / L, and 5 indicates a final primer concentration of 10 μmol / L.
[0020] Figure 3 The results show the temperature optimization of RAA detection. In the figure, A is the temperature-optimized grayscale electrophoresis image and B is the temperature-optimized ultraviolet electrophoresis image. In the figure, 1 represents 25℃, 2 represents 30℃, 3 represents 35℃, 4 represents 37℃, 5 represents 39℃, and 6 represents 41℃.
[0021] Figure 4 The results show the time optimization for RAA detection. In the figure, A is the time-optimized grayscale electrophoresis image, and B is the time-optimized ultraviolet electrophoresis image. In the figure, 1 represents 10 min, 2 represents 15 min, 3 represents 20 min, 4 represents 25 min, and 5 represents 30 min. M represents the relative molecular mass standard of DNA, and N represents the blank control.
[0022] Figure 5 The results show the specificity of the RAA detection method. In the figure, A is a grayscale electrophoresis image; B is a UV electrophoresis image; 1-4 represent the RAA detection results of Mh, 5 represent the RAA detection results of MG, 6 represent the RAA detection results of MS, 7 represent the RAA detection results of Mb, 8 represent the RAA detection results of Pm, 9 represent the RAA detection results of Sa, 10 represent the RAA detection results of Salmonella, 11 represent the RAA detection results of Escherichia coli, 12 represents the negative control, M represents the relative molecular mass standard of DNA, and N represents the blank control.
[0023] Figure 6 The figure shows the sensitivity comparison results of RAA, PCR, and qPCR. In the figure, A is the grayscale electrophoresis image of the sensitivity test results of the RAA detection method; B is the ultraviolet electrophoresis image of the sensitivity test results of the RAA detection method; C is the sensitivity test result of the PCR method; D is the sensitivity test result of the qPCR method; 1 represents 2.87 × 10⁻⁶. 7 copies / μL, 2 indicates 2.87 × 10 6 copies / μL, 3 indicates 2.87 × 10 5 copies / μL, 4 indicates 2.87 × 10 4 copies / μL, 5 indicates 2.87 × 10 3 copies / μL, 6 indicates 2.87 × 10 2 copies / μL, 7 indicates 2.87 × 10 1 copies / μL, 8 indicates 2.87 × 10 0 copies / μL, 9 indicates negative control, M indicates relative molecular mass standard of DNA, and N indicates blank control.
[0024] Figure 7This shows the results of the reproducibility test within the RAA group; in the figure, A is a grayscale electrophoresis image; B is a UV electrophoresis image; 1-3 indicate a template concentration of 2.87 × 10⁻³. 4 copies / μL; 4-6 indicates a template concentration of 2.87 × 10⁻⁶. 3 copies / μL; 7-9 indicates a template concentration of 2.87 × 10⁻⁹. 2 copies / μL; M represents the relative molecular mass standard of DNA; N represents the blank control; from left to right in the figure are 3 replicates within the group.
[0025] Figure 8 This shows the results of the intergroup repeatability test of RAA; in the figure, A is a grayscale electrophoresis image; B is a UV electrophoresis image; 1 indicates a template concentration of 2.87 × 10⁻⁶. 4 copies / μL, where 2 indicates a template concentration of 2.87 × 10⁻⁶. 3 copies / μL, 3 indicates a template concentration of 2.87 × 10⁻⁶. 2 copies / μL, M represents the relative molecular mass standard of DNA, and N represents the blank control; from left to right in the figure, there are 3 replicates between groups. Detailed Implementation
[0026] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.
[0027] Example 1: A primer pair, kit, and method for the specific detection of hemolytic Mansonia.
[0028] I. Experimental Materials 1. Test reagents Recombinase-mediated isothermal nucleic acid amplification (RAA) reagent (basic type) was purchased from Hangzhou Zhongce Biotechnology Co., Ltd.; gel extraction kit, DNA purification kit, plasmid miniprep kit, and pMD19-T vector were all purchased from Vazyme Biotechnology Co., Ltd.; V (phenol):V (chloroform):V (isoamyl alcohol) = 25:24:1 mixture and Biowest agarose were purchased from Xinjiang Hengchao Biotechnology Co., Ltd.; Escherichia coli DH5α competent cells were purchased from Weidi Biotechnology Co., Ltd.; ampicillin was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; 2× Universal Blue SYBR Green qPCR MasterMix and DNA molecular weight standard markers were purchased from Wuhan Sewell Biotechnology Co., Ltd.; Gold View nucleic acid dye was purchased from Beijing Bio-Top Technology Co., Ltd.; 2× Es Taq PCR Master Mix (Dye) and ddH2O were purchased from Beijing Kangwei Century Biotechnology Co., Ltd.
[0029] 2. Test equipment The water bath was purchased from Zhejiang Qun'an Scientific Instruments Co., Ltd.; the high-speed benchtop centrifuge was purchased from Nanjing Haidixi Equipment Co., Ltd.; the PCR instrument was purchased from Thermo Fisher Scientific Co., Ltd.; the real-time PCR instrument was purchased from Tianlong Technology Co., Ltd.; and the electrophoresis gel imaging system was purchased from Bio-Rad, USA.
[0030] 3. Strains and clinical samples Mh (product number BNCC376043), Mycoplasma synovitis ( Mycoplasma synoviae MS, catalog number BNCC393281), bovine mycoplasma ( Mycoplasma bovis Mb, catalog number ATCC25523), Pasteurella multocida ( Pasteurella multocida PM, Product No. BNCC270568), Mycoplasma chickenis ( Mycoplasma gallisepticum MG, product number BNCC382031), Staphylococcus aureus ( Staphylococcus aureus Salmonella pullorum (Sa, product number BNCC391765) Salmonella pullorum Sp, catalog number ATCC9120), Escherichia coli ( Escherichia coli The samples (item number BNCC336902) were all purchased from Beina Chuanglian Biotechnology Co., Ltd. A total of 100 nasopharyngeal swab samples with respiratory infection symptoms were collected from cattle farms around Shihezi City, Xinjiang, and stored at -80℃.
[0031] II. Test Methods 1. Nucleic acid extraction DNA templates for Mh, MS, Mb, Pm, MG, Sa, Salmonella pullorum, and Escherichia coli were extracted according to the instructions of the DNA extraction kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.). All DNA templates were stored at -20℃.
[0032] 2. RAA primer design According to Mh published in GenBank lktD Gene (accession number: AF414141.1), lktC Gene (accession number: AF414141.1) and gcp Based on the conserved region of the gene (accession number: AY839677.1) and the RAA reaction principle, four pairs of specific primers were designed using Oligo 7.0 software. The primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd., and their sequences are shown in Table 1. Among them, MH-F1, MH-R1, MH-F2, and MH-R2 target specific regions of the gene. lktD Genetic design, MH-F3 and MH-R3 targeting lktC Genetic design, MH-F4 and MH-R4 targeting gcp Gene design.
[0033] Table 1 RAA primer sequences 3. Establishment of RAA reaction system and primer screening Following the instructions of the RAA basic nucleic acid amplification kit, a 50 μL RAA reaction system was established. The premix consisted of 25 μL A Buffer, 13.5 μL ddH2O, 2 μL upstream primer (10 μmol / L), and 2 μL downstream primer (10 μmol / L). The premix was thoroughly mixed in a clean PCR reaction tube and then added to a detection unit tube containing the reaction powder. Next, 5 μL of Mh DNA template was added to the detection unit tube, and 2.5 μL of B Buffer was added to the inside of the cap. The cap was tightened, the tube was gently inverted, and the tube was tapped to mix thoroughly. The tube was centrifuged rapidly for 10 s and incubated in a 39°C water bath for 30 min. After incubation, 50 μL of a mixture of phenol, chloroform, and isoamyl alcohol (V:V:25:24:1) was added to the detection unit tube. The mixture was thoroughly mixed and centrifuged at 12000 rpm for 5 min. The supernatant was subjected to agarose gel electrophoresis (20 g / L). The electrophoresis results were presented as grayscale images using a gel imaging system and as ultraviolet electrophoresis images under ultraviolet light, which were then used for primer screening.
[0034] 4. Optimization of RAA reaction conditions The selected optimal primer pairs were diluted, and with other components and amounts remaining constant, upstream and downstream primers were added to the reaction system at final concentrations of 1 μmol / L, 2.5 μmol / L, 5 μmol / L, 7.5 μmol / L, and 10 μmol / L, respectively, to screen for the optimal primer concentrations. Based on the optimal primer concentrations, the reaction was carried out at 25℃, 30℃, 35℃, 37℃, 39℃, and 41℃ for 30 min, respectively, to screen for the optimal reaction temperature. Finally, the reaction time was set to 10 min, 15 min, 20 min, 25 min, and 30 min to optimize the optimal reaction time. All RAA amplification products were detected by agarose gel electrophoresis using the above method.
[0035] 5. Specificity test Using DNA from Mh, MS, Mb, Pm, MG, Sa, Salmonella, and Escherichia coli as templates, and ddH2O as a negative control, RAA amplification was performed under optimized reaction conditions to determine the specificity of the method.
[0036] 6. Preparation of standard plasmids Using the upstream primer CCACAAAGAATGGAGCTGTGAA (SEQ ID NO: 9) and the downstream primer TCATTTTTAAGTGCTGTTGCCA (SEQ ID NO: 10), Mh was amplified by PCR. lktD The gene PCR amplification reaction system was as follows: 10 μL PCR Mix, 6 μL ddH2O, 1 μL each of forward and reverse primers (10 μmol / L), and 2 μL Mh DNA template. The reaction program was: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58.5℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 32 cycles; and a final extension at 72℃ for 7 min. After the reaction, the amplified fragment was ligated into the pMD19-T vector. The ligation system (10 μL) was: [the mixture of the gel-recovered DNA and the ligation solution]. lktD4 μL of gene, 1 μL of pMD19-T vector, and 5 μL of Solution I ligase were added. The ligation system was incubated at 4°C for 12 h. E. coli DH5α competent cells stored at -80℃ were thawed on ice. In a clean bench, 10 μL of the ligation product was transferred into the competent cells, gently shaken, and incubated on ice for 30 min. A heat shock at 42℃ for 90 s was then performed, followed by an immediate ice incubation for 3 min. 1 mL of LB liquid medium without Amp resistance was added, and the cells were incubated at 37℃ and 200 rpm for 1 h. The culture was then centrifuged at low speed for 1 min, and the supernatant was removed to obtain the bacterial suspension. 200 μL of the bacterial suspension was evenly spread on LB solid medium (Amp resistant), and after complete absorption, the cells were incubated upside down for 12-16 h. A single colony was picked from the medium and transferred to 5 mL of LB liquid medium containing Amp resistance. The cells were incubated at 37℃ and 220 rpm for 12 h to obtain 5 mL of positive bacterial suspension for PCR verification.
[0037] Positive strains were screened by bacterial culture PCR using universal primers M13F and M13R for pMD19-T. The reaction conditions were: 95℃ for 5 min; 30 cycles (95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min); extension at 72℃ for 7 min. The samples were sent to Youkang Biotechnology Co., Ltd. for sequencing, and the sequencing results were compared with those in NCBI. Plasmid DNA was extracted using a plasmid miniprep kit (to obtain the pMD19-lktD plasmid) and stored at -20℃. After verifying the correctness of the recombinant plasmid by PCR and sequencing, its concentration was determined using a micro spectrophotometer, and the copy number was calculated.
[0038] 7. Sensitivity tests for RAA, PCR, and qPCR The pMD19-lktD plasmid was serially diluted 10-fold, with a concentration gradient of 2.87 × 10⁻⁶. 7 copies / μL, 2.87×10 6 copies / μL, 2.87×10 5 copies / μL, 2.87×10 4 copies / μL, 2.87×10 3 copies / μL, 2.87×10 2 copies / μL, 2.87×10 1 copies / μL and 2.87×10 0The template was obtained by measuring copies / μL of the sample and determining the sensitivity of RAA, PCR, and qPCR. RAA detection was performed under the optimized conditions described above. The primers, reaction system, and procedure used for PCR were consistent with those used in preparing the standard plasmid. qPCR detection used SYBR Green qPCR Mix, and the primers were the same as those used in PCR (SEQ ID NO: 9 and SEQ ID NO: 10). The qPCR reaction system (25 μL) consisted of: 12.5 μL qPCR Mix, 1 μL each of forward and reverse primers (10 μM), 1 μL template, and 9.5 μL sterile water. The reaction program was as follows: pre-denaturation at 95℃ for 30 s; denaturation at 95℃ for 15 s, annealing at 60℃ for 10 s, and extension at 72℃ for 30 s, for 40 cycles.
[0039] 8. Repeatability test The RAA detection method (optimized RAA reaction system) was used to detect 2.87 × 10⁻⁶ ppm. 4 copies / μL, 2.87×10 3 copies / μL, 2.87×10 2 The pMD19-lktD plasmid template (copies / μL) was subjected to three intra- and inter-group repeatability tests to analyze the amplification results.
[0040] 9. Clinical sample testing One hundred nasopharyngeal swab samples were collected from 2-month-old calves exhibiting respiratory infection symptoms at three dairy farms in Shihezi City, Xinjiang Uygur Autonomous Region. All samples were tested using the RAA (Respiratory Acute Acid) assay, PCR, and qPCR methods, and the concordance rates among the three methods were compared.
[0041] III. Test Results 1. Primer screening Four pairs of Mh primers were amplified using the RAA reaction system, and detected by 20 g / L agarose gel electrophoresis. Primer pairs were then screened based on the detection results. Results ( Figure 1 As shown in Figures A and B, all four designed Mh primer pairs amplified specific bands of the expected size; among them, the Mh-F2 and Mh-R2 primer pairs produced bands with high brightness, good clarity, and the fewest non-specific bands. Therefore, Mh-F2 and Mh-R2 were selected as the optimal primer pairs for subsequent experiments.
[0042] 2. Optimization results of RAA reaction primer concentration, temperature, and time The primer concentration was optimized, and the results are as follows: Figure 2As shown in Figures A and B, the target band brightness increases with increasing primer concentration, indicating enhanced RAA amplification ability. Above 7.5 μmol / L, the difference in brightness between amplified bands is not significant. Considering all factors, 7.5 μmol / L was selected as the optimal primer concentration (higher primer concentrations increase non-specific amplification; therefore, when the brightness difference is not significant, a relatively low concentration is chosen as the optimal primer concentration).
[0043] Based on the optimal primer concentrations described above, the reaction temperature was optimized, and the results are as follows: Figure 3 As shown in Figures A and B, bands can be amplified in the temperature range of 25℃ to 41℃, and the bands are brighter in the range of 37℃ to 39℃; therefore, the lower temperature in this range, 37℃, is selected as the optimal reaction temperature.
[0044] Based on the above optimal primer concentration and optimal reaction temperature, the reaction time was optimized, and the results are as follows: Figure 4 As shown in A and B, clear target bands can be observed in reaction times ranging from 10 min to 30 min, with the bands exhibiting better brightness in the 20 min to 30 min range. Therefore, the shorter time of 20 min within this range was selected for subsequent experiments.
[0045] 3. Specificity test results RAA amplification of Mh, MG, MS, Mb, Pm, Sa, Salmonella, and Escherichia coli was performed under optimized reaction conditions. The results showed that the DNA of all Mh strains could amplify the target band, while the DNA of other pathogens did not amplify the band. Figure 5 (A and B). This indicates that the RAA detection method of the present invention has good specificity and no cross-reaction with other common pathogens.
[0046] 4. Comparison of sensitivity results of RAA, PCR and qPCR A concentration gradient of 2.87 × 10⁻⁶ was selected. 7 copies / μL, 2.87×10 6 copies / μL, 2.87×10 5 copies / μL, 2.87×10 4 copies / μL, 2.87×10 3 copies / μL, 2.87×10 2 copies / μL, 2.87×10 1 copies / μL and 2.87×10 0Using pMD19-lktD plasmid (copies / μL) as a template, the sensitivity of three detection methods—RAA, PCR, and qPCR—was tested and compared, with ddH2O as a negative control template. The results showed that the limits of detection for the three methods were 2.87 × 10¹ copies / μL (copies / μL, ...). Figure 6 (A, B), 2.87 × 10³ copies / μL ( Figure 6 (C) and 2.87 copies / μL ( Figure 6 (D).
[0047] 5. Repeatability test results Results of intragroup repeatability tests are as follows Figure 7 As shown in Figures A and B, the target band was successfully amplified at all concentrations, and the brightness of the amplified bands in each repeated detection at the same concentration was basically the same; the results of the inter-group repeatability test are as follows. Figure 8 As shown in Figures A and B, the target band was successfully amplified in all three replicate experiments at all concentrations, and the brightness of the amplified bands was basically the same across different replicate groups, indicating that the RAA detection method of the present invention has good stability.
[0048] 6. Clinical sample test results Clinical sample testing results showed that the positive rate of RAA detection was 50% (50 / 100); the positive rate of PCR detection was 45% (45 / 100); and the positive rate of qPCR detection was 52% (52 / 100). The concordance rate between RAA and PCR was 95%, and the concordance rate between RAA and qPCR was 98% (Table 2). Furthermore, all 45 samples that were positive by PCR were also positive by RAA, meaning the sensitivity of RAA relative to PCR was 100%; of the 55 samples that were negative by PCR, 50 were also negative by RAA, meaning the specificity of RAA relative to PCR was 90.9%. Compared with the PCR method, the kappa value of the RAA detection method of this invention was 0.9 (K>0.75) (Table 3). These results indicate that the RAA detection method of this invention can be used for the detection of Mh in clinical samples.
[0049] Table 2. Detection results of clinical samples using different methods (n=100) Table 3. Performance comparison of RAA and PCR methods in detecting Mh in clinical samples (n=100) Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments.
[0050] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. A method for the specific detection of hemolytic Mansonia ( ) Mannheimia haemolytica The primer pair of ) is characterized in that, The primer pair includes the upstream primer shown in SEQ ID NO: 3 and the downstream primer shown in SEQ ID NO:
4.
2. A kit for the specific detection of hemolytic Mansonia, characterized in that, It includes the primer pair as described in claim 1.
3. The reagent kit according to claim 2, characterized in that, The kit also contains one or more of a buffer solution and a reactive dry powder.
4. A method for specifically detecting hemolytic Mansonia solani, characterized in that, Includes the following steps: Using the DNA of the sample to be tested as a template, the primer pair described in claim 1 is used to carry out the amplification reaction in a recombinase-mediated isothermal nucleic acid amplification reaction system; if a specific amplification band of 206 bp is generated, the sample to be tested contains hemolytic Mansonia.
5. The method for specifically detecting hemolytic Mansonia solani according to claim 4, characterized in that, The recombinase-mediated isothermal nucleic acid amplification reaction system comprises: 24 μL~26 μL A Buffer, 12.5 μL~14.5 μL ddH2O, 1.5 μL~2.5 μL upstream primer, 1.5 μL~2.5 μL downstream primer, and reaction powder; 4 μL~6 μL of the DNA sample to be tested and 2 μL~3 μL B Buffer are added at the start of the reaction.
6. The method for specifically detecting hemolytic Mansonia as described in claim 5, characterized in that, The concentrations of the upstream and downstream primers are both 1 μmol / L to 10 μmol / L.
7. The method for specifically detecting hemolytic Mansonia solani according to claim 4, characterized in that, The detection amplification product is determined by agarose gel electrophoresis to detect the presence of a specific 206 bp band.
8. The method for specifically detecting hemolytic Mansonia as described in claim 4, characterized in that, The amplification reaction was carried out at a constant temperature of 25℃ to 41℃ for 10 min to 30 min.