InDel marker related to fat content of millet grains and application of InDel marker

Abstract

The invention discloses an InDel marker related to the fat content of millet grains and application of the InDel marker, and belongs to the technical field of genetic engineering. The InDel marker provided by the invention is a segment of 792 bp insertion variation located on a chromosome 5 of a millet genome, and the nucleotide sequence of the InDel marker is as shown in SEQ ID NO. 1. The invention develops a primer group and a detection method for detecting the InDel marker. Experimental results show that the fat content of the millet grains can be rapidly and accurately identified by utilizing the primer group and the detection method provided by the invention, and the detection method provided by the invention also has the advantages of high applicability, stable effect, simplicity and convenience in operation, low detection cost and the like. The invention provides a new molecular marker for assisted selective breeding of high-quality characters of millet grains, and provides a new technical means for cultivating or screening high / low-fat millet varieties.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the InDel marker related to the fat content of millet grains and its application. Background Technology

[0002] Millet (Setaria italica) is an important coarse grain crop, characterized by its short growing season, drought resistance, and tolerance to poor soil. Millet is rich in nutrients, containing a variety of amino acids, fatty acids, vitamins, and other nutrients. It also has important dietary therapeutic functions such as high digestibility and absorption, improving human immunity, and preventing diseases, making it highly popular among consumers.

[0003] Plant fats are mainly stored in the seeds of oilseed crops, serving as a primary energy source during germination. They also provide humans with an important source of fatty acids in their diet and are an important bioenergy source used in chemical production. Fatty acids account for over 90% of total fat content; therefore, the properties and nutritional value of fats primarily depend on their composition. Fatty acids can be divided into saturated and unsaturated fatty acids. Excessive intake of saturated fatty acids can lead to fatty liver, hyperlipidemia, and arteriosclerosis, while unsaturated fatty acids are recognized as beneficial components. Intake of polyunsaturated fatty acids plays an indispensable role in maintaining vision and regulating anti-inflammatory responses. Millet has an average fat content of 4.05%, with unsaturated fatty acids accounting for as much as 80%, including abundant linoleic acid, which is essential for the human body and has the effect of dilating blood vessels and preventing thrombosis.

[0004] The fat content and composition of millet grains not only determine their nutritional quality but also have potential links to crop agronomic traits. Studies have shown that fat metabolism may be involved in regulating yield-related traits such as grain weight and plumpness. This principle provides a theoretical reference for the synergistic improvement of millet yield and quality and highlights the importance of precisely controlling the fat content of millet grains for breeding work.

[0005] Currently, molecular breeding research on millet mainly focuses on stress resistance and leaf color, while the development of molecular markers targeting grain fat content lags behind. No InDel markers stably linked to millet grain fat content and fatty acid composition have been reported and applied in breeding practice. Therefore, identifying InDel markers closely linked to millet grain fat content and establishing rapid and accurate molecular detection methods to achieve early screening and targeted improvement of millet fat content traits, shortening the breeding cycle and improving breeding efficiency, is of significant practical importance and application value for promoting the breeding of high-quality millet varieties and fostering the high-quality development of the millet industry. Summary of the Invention

[0006] The purpose of this invention is to provide an InDel marker related to the fat content of millet grains and its application, in order to solve the problems existing in the prior art. This invention provides an InDel molecular marker for detecting the fat content of millet grains. The method for detecting the fat content of millet developed based on this molecular marker has advantages such as high detection efficiency, simple operation and low detection cost, providing a technical means for breeding or screening high / low fat millet varieties.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides an InDel marker associated with the fat content of millet grains, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0009] The present invention also provides a primer set for amplifying the above-mentioned InDel marker, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.3.

[0010] The present invention also provides an application of the above-mentioned primer set in the preparation of a product for identifying the fat content of millet grains.

[0011] Furthermore, the product is a reagent kit.

[0012] The present invention also provides a product for identifying the fat content of millet grains, comprising the primer set described above.

[0013] The present invention also provides the application of the above-mentioned primer set or the above-mentioned product in identifying the fat content of millet grains.

[0014] This invention also provides a method for identifying the fat content of millet grains, comprising the following steps:

[0015] DNA was extracted from the millet seeds to be tested, and PCR amplification was performed using the primer set or the product described above to obtain the amplification product.

[0016] The PCR amplification products were subjected to electrophoresis, staining, and development, and the bands were interpreted.

[0017] The interpretation band is:

[0018] If a single band of 1110 bp is amplified, then the millet to be tested is millet with high grain fat content;

[0019] If a single band of 318 bp is amplified, then the millet to be tested is millet with low grain fat content.

[0020] The present invention also provides an application of the above-mentioned primer set or the above-mentioned product in the breeding of millet grain fat content.

[0021] This invention also provides a method for breeding millet with high grain fat content, comprising the following steps:

[0022] DNA was extracted from the millet seeds to be tested, and PCR amplification was performed using the primer set or the product described above to obtain the amplification product.

[0023] The PCR amplification products were subjected to electrophoresis, staining, and development, and the bands were interpreted.

[0024] The interpretation band is:

[0025] If a single band of 1110 bp is amplified, the millet to be tested is retained for breeding.

[0026] This invention also provides a method for breeding millet with low grain fat content, comprising the following steps:

[0027] DNA was extracted from the millet seeds to be tested, and PCR amplification was performed using the primer set or the product described above to obtain the amplification product.

[0028] The PCR amplification products were subjected to electrophoresis, staining, and development, and the bands were interpreted.

[0029] The interpretation band is:

[0030] If a single band of 318 bp is amplified, the millet to be tested is retained for breeding.

[0031] The present invention discloses the following technical effects:

[0032] The InDel marker provided by this invention is a 792 bp insertion variant located on chromosome 5 of the millet genome, and its nucleotide sequence is shown in SEQ ID NO.1. This invention develops a primer set and detection method for detecting this InDel marker. Experimental results show that the primer set and detection method provided by this invention can rapidly and accurately identify the fat content of millet grains. The detection method provided by this invention also has advantages such as strong applicability, stable effect, simple operation, and low detection cost. This invention provides a new molecular marker for assisted selection breeding of superior traits in millet grains and provides a new technical means for breeding or screening high / low fat millet varieties. Attached Figure Description

[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0034] Figure 1 A graph showing the statistical results of fat content in millet grains;

[0035] Figure 2 Figure showing the results of genome-wide association analysis of fat content in millet grains;

[0036] Figure 3 A diagram showing the positions of bands on an agarose gel electrophoresis plate for InDel-labeled typing; where + / + indicates insertion type; - / + indicates heterozygous type; and - / - indicates non-inserted type.

[0037] Figure 4 The figure shows the statistical analysis results of fat content at InDel-labeled variant sites; where + / + indicates insertion type; - / + indicates heterozygous type; - / - indicates non-inserted type; different lowercase letters indicate statistically significant differences;

[0038] Figure 5 The figure shows the genotyping and lipid content statistics of heterozygous progeny plants at the InDel marker site; where + / + indicates inserted progeny; - / + indicates heterozygous progeny; - / - indicates non-inserted progeny; different lowercase letters indicate statistically significant differences. Detailed Implementation

[0039] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0040] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0041] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0042] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0043] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0044] This invention, through continuous analysis of the grain fat content of 315 core Chinese millet resources over three years, identified an SV locus significantly associated with millet grain fat content. Primers for the InDel molecular marker and its detection were designed. These primers can clearly distinguish between high and low fat content and can be used in both natural and hybrid populations. This allows for faster and more accurate identification or assisted identification of millet grain fat content, and can be applied to the breeding or screening of individual millet plants, lines, strains, or varieties with high or low grain fat content traits.

[0045] Example 1

[0046] 1. Detection of fat content in millet grains and discovery of linkage sites

[0047] This invention uses 315 core resources of Chinese millet as experimental materials. After harvesting, the millet was dried for 15 days, and after dehulling, millet with plump grains and uniform color was selected as the test material. The fat content of the grains was detected using a Danish NIRS™ DS2500 near-infrared spectrometer with a wavelength range of 1100 nm-2498 nm. The experiment was repeated for 3 years, from 2022 to 2024.

[0048] like Figure 1 As shown, the results indicate that the fat content of millet grains showed little variation between years, ranging from 2.17% to 5.10%, with mean fat content of 3.54%, 3.54%, and 3.63%, respectively. The coefficient of variation was also relatively stable, at 12.4%, 13.6%, and 12.1%, respectively. The skewness of fat content was 0.15, 0.99, and 0.34, respectively, and the kurtosis was 0.68, 3.19, and 0.89, respectively. The p-values ​​of the KS test results were all less than 0.05, and all conformed to a normal distribution. Therefore, it is believed that the fatty acid content of millet grains conforms to the genetic characteristics of quantitative traits and may be regulated by multiple factors.

[0049] Based on the genome resequencing results, Tassel software was used to perform genome-wide association analysis on 43,862 structural variant (SV) sites, and sites significantly associated with fat content were identified with a P-value ≤ 1E-5 threshold.

[0050] like Figure 2 As shown, the results indicate that the three-year analysis identified a variant site significantly associated with the fat content of millet grains, located at chr5: 44879261 bp.

[0051] 2. Development and application of InDel molecular markers

[0052] Upon testing, the mutation site was found to be a 792 bp fragment insertion, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0053] SEQ ID NO.1:

[0054] CGGCTGGGCTGCCCGCAGAGGCAGCGCCACCGCACACCTGTCATCACCGGGGTGCCTCGTGTCCGTCCGCGGTGGCTCGGCTCTGGCTGGCACCCGCGCCGCCGCCGATTGCCCCGCGCGTGGCATGGGGCTGCGTGCCCCGCGGCGAGACGTGACGTGACTGCGCCGCAGCCCGCAGCGAGACGACGCCCGGAGAGCCTTCAGCGTGGGGTGTTTGGGAGGAGGGGGCTTGTCATATCGAATGTTTGACACTAATTAGAAGTATTAAATCTAGACTAATTACAAAATTAATTACACAATCTCTAGGCTAAATTGCAAGATGAATCTATTAAACCTAATTAGTCCATAATTTGACAATGTGGTGCTACAGTAACCATTCGCTAATGATAAATTAATTAGGCTCAATAGATTCGTCTCGTGATTTAGCCTAGAAGTTCTGCTATTAGTTTTGTAATTAACTCATATTTAGTCCTCCTAATTAATATCCGAACATCCGATGTGATAGGGTTAAAGTCTATCTCGCAAGCACCCTCAAATCGCGCGGCGCTGCCCGCCGCCCGCCACCTACTCGTCCACTACCGCGCGCCCCGTCTCGACGACGTCCCCGTGCGTCAGCGCGAACGGACGAAACCGGGGAAGCGAGCCGTGCCCGTTCCGTGGGCCGTGGTAACGGCGGTTTCGTTCTCGCACGGTGCACGCCGGTAAAACGAAATCTTGGACGGGCCCGGCGTGTGCGACTTTCCAGTAGCAGGGGATTCTTCTCGAGCGGGGAATTCCGGTGGTGCCCTCGCG。

[0055] Based on the above mutation sites, the present invention develops into InDel markers and provides a pair of identification primers F and R, the nucleotide sequences of which are shown in SEQ ID NO.2-3 respectively.

[0056] F: 5’ -CTGGCATCTACTGCTTCTGGC- 3’, SEQ ID NO.2;

[0057] R: 5'-GTGACGAGGTGGGTGGGAT-3', SEQ ID NO. 3.

[0058] For all natural populations of millet leaves, Coolaber's 2×CTAB extraction buffer was used. 0.1 g of fresh leaves were weighed, ground into powder under liquid nitrogen freezing conditions, and the powder was transferred to a CTAB solution containing 700 μL of β-mercaptoethanol. Extraction was performed in a 65°C water bath for 30-40 min, with gentle shaking 3-4 times during extraction. After extraction, the mixture was cooled to room temperature, and 500 μL of a chloroform-isoamyl alcohol mixture (24:1) was added. After shaking, the mixture was centrifuged for 10 min (10000 g, 16°C). The solution separated into three layers. An appropriate amount of supernatant was taken and an equal volume of isopropanol solution was added. After shaking and mixing, the mixture was allowed to settle naturally at -20°C for at least 30 min, then centrifuged for 2 min (12000 g, 16°C). The supernatant was discarded and the mixture was washed with 75% ethanol. This process was repeated 2-3 times. After washing, the mixture was centrifuged for 2 min (12000 g, 16°C). The mixture was then diluted with water according to the DNA concentration.

[0059] PCR reactions were detected using Kangrun Biotechnology 2×SuperTaq PCR StarMix rapid PCR enzyme.

[0060] Reaction system: 6.5 μL of 2×SuperTaq PCR Mix, 5 μL of sterile water, 0.5 μL of primer F, 0.5 μL of primer R, and 0.5 μL of DNA template.

[0061] Reaction program: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 20 s, 34 cycles; 72℃ final extension for 5 min.

[0062] PCR amplification products were detected by 1% agarose gel electrophoresis at 110 V for 20 min.

[0063] The position of the electrophoretic bands is as follows Figure 3 As shown, the amplification product of the inserted (+ / +) millet containing the insert fragment is 1110 bp in length; the amplification product of the non-inserted (- / -) millet without the insert fragment is 318 bp in length; and the heterozygous (- / +) millet can be amplified simultaneously to obtain two electrophoretic bands with lengths of 1110 bp and 318 bp.

[0064] The nucleotide sequence of the amplification product with a length of 1110 bp is shown in SEQ ID NO.4, and the nucleotide sequence of the amplification product with a length of 318 bp is shown in SEQ ID NO.5.

[0065] SEQ ID NO.4:

[0066]

[0067] SEQ ID NO.5:

[0068] CTGGCATCTACTGCTTTCTGGCCCCGCGCCCCTTTTGGCCTCTTGCTGCTGCGGCGTCCGCGCCGAGCACCCGCGCGCTGGCAAATCCAACGCACACGCAGGATTGCCCCGCGACTTTACCCCACGAGAAGGGTCTCGTTTCAAATTATAAATTATTCC AAATTATAATTTGTACAATTTAGAACGAAAAAAAGTAGGAGTGAGCTTGTTGTTAAACTAAAGGCAGCACACTTGCTTTTCAGATATCGTCAAAGGCGATCTTATCTAGCACTCGTTGGAGTCTTGGAGATAATCCATTAATCCCACCCACCTCGTCAC.

[0069] 3. Haplotype analysis of key variant sites

[0070] like Figure 4 As shown, when the millet genotype is inserted (+ / +), it exhibits the trait of high grain fat content; when the millet genotype is non-inserted (- / -), it exhibits the trait of low grain fat content. The results of repeated experiments over three years all reached a significant level. The grain fat content of heterozygous (- / +) millet falls between that of the inserted and non-inserted genotypes.

[0071] 4. Lipid detection in heterozygous single-plant progeny

[0072] To further verify the versatility and accuracy of the InDel marker, this invention screened single plants whose marker sites were identified as heterozygous (- / +) and counted the fat content of their progeny.

[0073] The results are as follows Figure 5 As shown, genotype segregation exists in the offspring. The fat content of the inserted offspring (+ / +) is significantly higher than that of the non-inserted offspring (- / -), while the fat content of the heterozygous offspring (- / +) is similar to that of the inserted offspring.

[0074] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An InDel marker associated with the fat content of millet grains, characterized in that, The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.

1.

2. A primer set for amplifying the InDel-labeled primers of claim 1, characterized in that, This includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

3.

3. The application of the primer set according to claim 2 in the preparation of a product for identifying the fat content of millet grains.

4. The application as described in claim 3, characterized in that, The product in question is a reagent kit.

5. A product for identifying the fat content of millet grains, characterized in that, Includes the primer set as described in claim 2.

6. The application of the primer set as described in claim 2 or the product as described in claim 5 in identifying the fat content of millet grains.

7. A method for identifying the fat content of millet grains, characterized in that, Includes the following steps: DNA was extracted from the millet seed to be tested, and PCR amplification was performed using the primer set described in claim 2 or the product described in claim 5 to obtain the amplification product. The PCR amplification products were subjected to electrophoresis, staining, and development, and the bands were interpreted. The interpretation band is: If a single band of 1110 bp is amplified, then the millet to be tested is millet with high grain fat content; If a single band of 318 bp is amplified, then the millet to be tested is millet with low grain fat content.

8. The application of the primer set as described in claim 2 or the product as described in claim 5 in the breeding of millet grain fat content.

9. A method for breeding millet with high grain fat content, characterized in that, Includes the following steps: DNA was extracted from the millet seed to be tested, and PCR amplification was performed using the primer set described in claim 2 or the product described in claim 5 to obtain the amplification product. The PCR amplification products were subjected to electrophoresis, staining, and development, and the bands were interpreted. The interpretation band is: If a single band of 1110 bp is amplified, the millet to be tested is retained for breeding.

10. A method for breeding millet with low grain fat content, characterized in that, Includes the following steps: DNA was extracted from the millet seed to be tested, and PCR amplification was performed using the primer set described in claim 2 or the product described in claim 5 to obtain the amplification product. The PCR amplification products were subjected to electrophoresis, staining, and development, and the bands were interpreted. The interpretation band is: If a single band of 318 bp is amplified, the millet to be tested is retained for breeding.

Images