Method for screening waxy wheat gene Wx-B1b by using powdery mildew resistant gene MlIW30
By detecting the Wx-B1b site for wheat powdery mildew resistance screening, combined with PCR amplification and multiplex PCR technology, the problems of long screening cycles and low efficiency in traditional breeding have been solved. This has enabled rapid and efficient screening and accurate identification of Wx-B1b and MlIW30 sites, thus improving breeding efficiency and accuracy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHINA AGRI UNIV
- Filing Date
- 2026-02-11
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies are insufficient for efficiently screening wheat Wx-B1b loci, resulting in long selection cycles and low efficiency in traditional breeding methods, making it difficult to quickly and accurately aggregate powdery mildew resistance and waxy genes in wheat.
By detecting wheat powdery mildew resistance, the Wx-B1 locus was screened using the powdery mildew resistance phenotype. PCR amplification was performed using the IW30InDel-F/IW30InDel-R primer pair to detect the presence of Wx-B1b. Multiplex PCR was then performed using the BFC/BRC2/BDFL/BRC1 primer pair to rapidly identify the genetic distance between the Wx-B1b and MlIW30 loci, thereby improving breeding efficiency.
This technology enables rapid and efficient screening of intermediate breeding materials containing Wx-B1b and MlIW30 in the early stages of traditional breeding processes, improving breeding efficiency and clearly identifying the genotypes of offspring, thus enhancing detection efficiency and breeding accuracy.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a method utilizing a powdery mildew resistance gene. MlIW30 Screening for glutinous wheat genes Wx-B1b The method. Background Technology
[0002] Wheat, as an important food crop, is not only constrained by climate change but also threatened by pathogen renewal and increased virulence. Wheat powdery mildew, an airborne fungal disease caused by *Erysiphe brucellae*, is widespread and mutates rapidly, threatening sustainable production in the world's major wheat-producing areas. [1] Wheat resistance to powdery mildew is determined by resistance genes. The specific resistance gene carried is crucial in determining wheat's resistance. Breeding resistant varieties using these genes is the most economical and effective measure for controlling wheat powdery mildew. Traditional breeding methods are time-consuming and inefficient. Using molecular marker-assisted selection to breed new wheat germplasm that integrates resistance genes and other high-quality genes can shorten the breeding cycle and improve the accuracy of gene selection. (From wild emmer wheat...) Triticum dicoccoides Powdery mildew resistance gene (2n=4x=28, AABB) MlIW30 It exhibits resistance throughout the entire reproductive period to the prevalent physiological race E09 in the Beijing area and is located on chromosome 4AL. [2] Molecular markers closely linked to it IW30InDel It can be accurately identified as (CN120591444A). Wild emmer wheat, as an ancestor of common wheat, can fully recombine into the genome of common wheat, enriching the genetic background of wheat and possessing great breeding value.
[0003] Starch is an important component of wheat grains, including amylopectin and amylose, which account for 20%-30% and 70%-80% of the total starch content, respectively. Wheat grains with less than 1% amylose are called whole glutinous wheat. In 1993, Japanese researchers discovered that the synthesis of wheat amylose is mainly controlled by granule-bound starch synthase I (GBSSI), also known as Waxy protein. [3] Waxy protein content is positively correlated with the waxy and non-waxy properties of wheat. The gene encoding the Waxy protein is named... Wx Genes. Common hexaploid wheat contains three Waxy protein subunits, and the glutinous texture of wheat is determined by the subunits located on 7AS, 4AL, and 7DS. Wx-A1 , Wx-B1 and Wx-D1 Genes control synthesis; the deletion of the corresponding allele is called gene synthesis. Wx-A1b , Wx-B1b and Wx-D1b [4]Studies by Chen Dongsheng et al. have shown that ordinary wheat endosperm contains... Wx Genes exhibit a dose-response effect on amylose content: the absence of the Wx-B1 subunit results in the greatest decrease in wheat amylose content; when both Wx protein subunits are absent, the simultaneous absence of Wx-A1 and Wx-D1 has the least impact on amylose content; when all three Wx protein subunits are absent, the wheat endosperm contains almost no amylose, and this is also known as whole glutinous wheat. [5] .
[0004] In 1999, J. Murai published three [unclear - possibly related to wheat]. Wx The DNA sequence of a gene Wx-A1 It is 2781 bp. Wx-B1 It is 2794 bp. Wx-D1 It is 2862 bp in length, and the encoded protein has a similarity of 96.5%-97.4%. [6] Research has consistently found that... Wx Genetic Wx-A1 and Wx-D1 Site variations are not static; they encompass a variety of base insertions and deletions. Wx-B1 All sites are missing parts of the complete coding sequence.
[0005] The ratio of amylose to amylopectin in wheat affects the viscosity, gelatinization properties, and malleability of starch. Glutinous wheat, a specialty wheat variety, has a high amylopectin content, resulting in high starch viscosity and good extensibility. This gives it significant advantages in making noodles and specialty pastries. Bread made from glutinous wheat exhibits good delayed staling properties, and the dough viscosity increases rapidly above 60°C, making it suitable for use in cooked foods. [7] Studies by Liang Rongqi et al. have shown that low amylose varieties are less prone to sprouting in the panicle, reducing yield loss before harvest and avoiding flour quality degradation caused by increased amylase activity during processing. [8] In addition, it has important value in the paper and textile industries, and can also be made into biodegradable agricultural films, reducing white pollution in agriculture in recent years.
[0006] The detection of glutinous wheat mainly involves methods such as iodine staining, SDS-PAGE, far-infrared spectroscopy, antibodies, 2D-PAGE, and molecular markers. Iodine staining can only identify whole glutinous wheat; whole glutinous wheat will be stained reddish-brown, while glutinous wheat will be stained purplish-black. SDS-PAGE is cumbersome, time-consuming, and labor-intensive, and it is difficult to distinguish between the Wx-B1 and Wx-D1 subunits. Far-infrared spectroscopy and antibodies are difficult to differentiate between mutants and wild types. 2D-PAGE can only detect variations. [9] However, while this method can identify the type of variation, it cannot determine the specific variation. Molecular markers, on the other hand, offer high accuracy and are simple to use, leading to their increasingly widespread application in breeding research. In recent years, research on identifying wheat... Wx The number of molecular markers for genes is increasing. Liu Yingchun et al. reported...Wx-A1 and Wx-D1 STS codominant molecular markers MAG264 and MAG269 Specialized testing Wx-A1 and Wx-D1 site
[10] Saito and Rasheed, among others, reported on this. Wx-B1 dominant STS molecular markers
[11] However, it is difficult to distinguish between heterozygous and homozygous types. In 2010, Saito et al. continued to develop co-dominant markers. BFC / BRC2 / BDFL / BRC1 Can be used as Wx-B1 Codominant markers at loci can be detected quickly and accurately. Wx-B1b
[12] . Summary of the Invention
[0007] The technical problem to be solved by this invention is how to screen Wx-B1b Site.
[0008] To solve the above-mentioned technical problems, the present invention first provides a method for detecting wheat Wx-B1 The method of site, the Wx-B1 The site is the DNA fragment in the wheat genome corresponding to SEQ ID No. 7 or SEQ ID No. 8, which is... Wx-B1b or Wx-B1a The method includes: detecting the powdery mildew resistance of the wheat to be tested, and using the powdery mildew resistance phenotype to detect... Wx-B1 Does the site carry Wx-B1b : Test wheat species resistant to powdery mildew Wx-B1 Site carrying Wx-B1b ;
[0009] The Wx-B1b The DNA fragment shown in SEQ ID No. 7; The Wx-B1a The DNA fragment is shown in SEQ ID No. 8.
[0010] Specifically, the detection of powdery mildew resistance in the wheat to be tested is accomplished by inoculating the wheat to be tested with powdery mildew fungus to determine its resistance to powdery mildew fungus.
[0011] In one embodiment of the present invention, the powdery mildew pathogen is physiological race E09 of powdery mildew.
[0012] Furthermore, the method for detecting powdery mildew in the wheat to be tested is as follows: IW30InDel-F and IW30InDel-R The primer pairs were used to amplify the genomic DNA of the wheat to be tested by PCR. IW30InDel-F With the IW30InDel-RThe single-stranded DNAs are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively. Wheat samples whose PCR products contain a 1431 bp DNA fragment are considered or candidate wheat resistant to powdery mildew, while wheat samples whose PCR products do not contain a 1431 bp DNA fragment are considered or candidate non-powdery mildew resistant wheat.
[0013] The detection of wheat Wx-B1 The application of the site method in the breeding of glutinous wheat, or in the breeding of powdery mildew resistant glutinous wheat, is also within the scope of protection of this invention.
[0014] This invention also provides a method for detecting wheat MlIW30 The substance at the site in the detection of wheat Wx-B1 Application in the site, the Wx-B1 The site is the DNA fragment in the wheat genome corresponding to SEQ ID No. 7 or SEQ ID No. 8, which is... Wx-B1b or Wx-B1a ; The Wx-Bl b The DNA fragment shown in SEQ ID No. 7; The Wx-B1a The DNA fragment is shown in SEQ ID No. 8.
[0015] Furthermore, the detection MlIW30 The substance at the site is a primer pair consisting of single-stranded DNA as shown in SEQ ID No. 1 and SEQ ID No. 2.
[0016] wheat testing MlIW30 The application of the substance at the site in the cultivation of glutinous wheat, or in the cultivation of powdery mildew resistant glutinous wheat, is also within the scope of protection of this invention.
[0017] Furthermore, the detection of wheat MlIW30 The substance at the site is a primer pair consisting of single-stranded DNA as shown in SEQ ID No. 1 and SEQ ID No. 2.
[0018] This invention also provides a method for detecting wheat MlIW30 Sites and detection of wheat Wx-B1 Application of the substance at the site in the breeding of glutinous wheat, or in the breeding of powdery mildew resistant glutinous wheat.
[0019] Furthermore, the detection of wheat MlIW30 The substance at the site is a primer pair consisting of single-stranded DNA as shown in SEQ ID No. 1 and SEQ ID No. 2.
[0020] The detection of wheat Wx-B1The substances at the sites are the primers shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6.
[0021] Detection MlIW30 PCR reaction system for the site: 1.5 μl template DNA, 12.5 μl 2 × Magic PCR Mix (Tolo Harbour), 0.4 μM single-stranded DNA as shown in SEQ ID No.1 and SEQ ID No.2, and sterile distilled water to a final volume of 25 μl.
[0022] Detection Wx-B1 PCR reaction system for the site: 1.5 μl template DNA, 12.5 μl 2 × Magic PCR Mix (Tolo Harbour), 0.4 μM primers shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6, and sterile distilled water to a final volume of 25 μl.
[0023] This invention calculates Wx-B1b and MlIW30 The genetic distance between them proves that powdery mildew resistance phenotype can be used as a morphological marker in traditional breeding processes to identify powdery mildew resistance in early generations, and to quickly and efficiently screen for more than 85% of those phenotyped simultaneously. Wx-B1b and MlIW30 This invention provides intermediate breeding materials, improving breeding efficiency. Furthermore, by combining two loci using multiplex PCR, the genotypes of the two genes in offspring can be clearly identified, increasing detection efficiency. The method of this invention can be used for the selection of high-efficiency polymeric materials with disease-resistant glutinous loci in traditional breeding processes. Attached Figure Description
[0024] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0025] Figure 1 . BFC / BRC2 / BDFL / BRC1 and IW30InDel-F / IW30InDel-R Specific detection. M: DNA molecular weight standard; 1: Wx-2L6; 2: Agricultural University 210; 3: Shi Luan 02-1; The figure shows... Indicator Marker IW30InDel The target band, with anti- and susceptible bands of 1431 bp and 955 bp respectively, is indicated by ◆. BFC / BRC2 / BDFL / BRC1 Target band,Wx-B1a (Non-glutinous) / Wx-B1b (Glutinousness) 778 bp / 668 bp.
[0026] Figure 2 Parental powdery mildew resistance identification and seed iodine staining phenotype.
[0027] Figure 3 . BFC / BRC2 / BDFL / BRC1 and IW30InDel-F / IW30InDel-R Multiplex PCR detection. DNA molecular weight standard; 1: Wx-2L6; 2: Shilu 02-1; 3-11: Representative genotypes were selected from the offspring derived from Wx-2L6 and Shilu 02-1 (one genotype from each). instruct MlIW30 The target band at the site, indicated by ◆ Wx-B1 The target band at the site.
[0028] Figure 4 Collinearity of two-gene genetic linkage maps and their corresponding physical locations in Fielder RefSeq v1.0.
[0029] Figure 5 BC2F2 powdery mildew resistant single plants of .Wx-2L6 and Shilu 02-1 Wx-B1 Site detection. All samples were renumbered from 1 to 96, with Wx-2L6 as a positive control. Twelve single-strain amplification bands (4, 20, 28, 45, 50, 52, 68, 75, 82, 84, 89, and 96) were 778 bp in length. Wx-B1a ), 45 single-plant amplification bands (1, 2, 5, 6, 9-11, 13, 15-17, 19, 22, 24, 25, 33, 36, 37, 40, 42, 43, 46, 53-62, 64, 67, 70, 71, 76, 78-80, 90-92) were heterozygous (containing 778 bp and 668 bp), and 39 single-plant amplification bands (3, 7, 8, 12, 14, 18, 21, 23, 26, 27, 29-32, 34, 35, 38, 39, 41, 44, 47, 49, 51, 63, 65, 66, 69, 72-74, 77, 81, 85-88, 93, 94, 95) were 668 bp. Wx-B1b ). Detailed Implementation
[0030] In this document, unless otherwise defined herein, terms should be understood according to their common usage by those skilled in the art. Examples of resources describing many of the molecular biology-related terms used herein can be found in the following references: Alberts et al., Molecular Biology of The Cell, 5th ed., Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed., Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th ed., Oxford University Press: New York, 2002; and Lewin, GenesIX, Oxford University Press: New York, 2007.
[0031] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0032] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available.
[0033] The powdery mildew-resistant glutinous wheat material Wx-2L6 (genotype: ) in the following examples MlIW30 / Wx-B1b , for 2L6(IW30 / Zheng98 / / 87-1 3) The hybrid material derived from Zhongmai 816wx is MLIW30, as described in the literature “Geng M, Zhang J, Peng F, et al. Identification and mapping of MLIW30, a novel powdery mildewresistance gene derived from wild emmer wheat[J]. Molecular Breeding, 2016,36(9): 130.” The public can obtain this biological material from the applicant. This biological material is only used for repeating the relevant experiments of this invention and cannot be used for other purposes.
[0034] The following examples use Shilu 02-1 (genotype: Wx-B1a The biological material is recorded in Chinese patent application 202510811112.3 and in the document "Huang Zhanjing, Breeding of a new high-quality special wheat variety Shilu 02-1. Hebei Province, Luancheng County Seed Farm, 2006-06-06." The public can obtain this biological material from the applicant. This biological material is only used to repeat the relevant experiments of this invention and cannot be used for other purposes.
[0035] The powdery mildew physiological race E09 in the following examples was provided by Researcher Duan Xiayu of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences, and is described in Chinese Patent Application 202510811112.3 and the literature "Qiu L, Liu N, Wang H, et al. Fine mapping of a powdery mildew resistance gene". MlIW39 derived fromwild emmer wheat ( Triticum turgidum ssp. dicoccoides In the article "[J]. Theoretical and Applied Genetics, 2021, 134(8): 2469-2479," with the consent of researcher Duan Xiayu, the public may obtain the biological material from the applicant. The biological material is only for repeating the relevant experiments of this invention and may not be used for other purposes.
[0036] Example 1 1. Material to be tested The powdery mildew-resistant glutinous wheat material Wx-2L6 was crossed with powdery mildew-susceptible non-glutinous wheat varieties Shilu 02-1 and Nongda 210, respectively. BC1F1 was obtained by backcrossing with Shilu 02-1 and Nongda 210, respectively. BC1F1 was then self-crossed to obtain BC1F2. BC1F1 was then backcrossed with Shilu 02-1 and Nongda 210, respectively, to obtain BC2F1.
[0037] 2. Phenotypic detection 2.1 Detection of powdery mildew resistance The disease resistance of the test materials at the one-leaf-one-heart stage was tested by inoculating them with the physiological race E09 of powdery mildew. The specific steps are as follows: Using physiological races of powdery mildew Bgt E09 was used for powdery mildew resistance identification of all materials. First, a large amount of powdery mildew fungus was propagated using susceptible materials. Once the materials to be identified reached the appropriate inoculation period, inoculation was performed using the sweeping method. Powdery mildew resistance identification was conducted in the greenhouse of China Agricultural University. The materials to be identified were sown in 8 × 16 cm seedling trays, one seed per cell. A resistant parent, a susceptible parent, and a susceptible control were planted on one side of the tray. When the materials reached the three-leaf stage, inoculation was performed. Phenotypic records were made 10-15 days after inoculation based on the disease incidence of the susceptible control. Phenotypic identification was based on a 0-4 grade grading standard (Table 1).
[0038] Table 1 Grading Standards for Wheat Powdery Mildew Resistance
[0039] 2.2 Glutinousness Test The waxiness of the test material seeds was identified by staining with a 0.1% iodine-potassium iodide (KI) solution. The detection steps are as follows: Make a transverse cut with a knife at two-thirds of the distance from the embryo end of the seed to be identified. Stain the cross-section with iodine reagent. Glutinous wheat will be stained reddish-brown, while regular glutinous wheat will be stained purplish-black. 3. Utilizing molecular markers to detect disease resistance and grain glutinousness First, the powdery mildew-resistant glutinous wheat material Wx-2L6 and the powdery mildew-susceptible non-glutinous wheat varieties Shilu 02-1 and Nongda 210 were tested. MlIW30 site 、Wx-B1 Sites were selected, genomic DNA was extracted from each material, and utilized... IW30InDel-F and IW30InDel-R Detection MlIW30 site, using BFC、BRC2、BDFL、BRC1 Detection Wx-B1 The site and primer information are shown in Table 2.
[0040] Table 2. Primer sequence information
[0041] in, BFC and BRC2 The 668 bp PCR product (denoted as Wx-B1b The sequence is: CGTAGTAAGGTGCAAAAAAGTGCCACGTTTTAGAAACCCAAAAATTGTGCAATTGCCATGAGATATATGAAAACACTATTAAAAATTTACAATTTCCATACAACCAAAAAGATATAATTAAAAAATTGAAGTAATTTGATCCGAATATTTTATATACCCATGGTTGTTTTCCCATGGCATTTTGTGTTAAGAAAAGTACTCCCTTCGTTCCTAAATATAAGTATTTTTAGAGATTCCAATAGGAACTACATATGGAGCAAAATGAGTGAATCTACACTCTAAATAGATCTATATACATCCGTATGTAGTCCCAATTGAAATATCTAAAAAGACATATATAGTCTAAAATTATAAGTTTGAACTAAGGTACAATACTAGGGTTGCAGAAAAATGAAGACTGATAATTCTCTCTGCATTTTGCTACGAAGTGAACTAGTAGCATCTGAATACTGTGCAACTCTGATAACCACACTGATCAAAGTTCAATTGCCATTACTACACAACCTTCTTAAATGATCAGATGTGATGGAAGATCAAGAAATGCAAGATCTCAAAATAAATGAGCTACTACTATGAACTATGAAGTCCTCAAAATATCTTATCTTCACGGAGCCGCTGGCATTGGCACTCAAATGGTTCACACATGGGTCTTGGTACAATAAGGCTGT (SEQ ID No. 7); BFC The 778 bp PCR product (designated as BRC2 ), which is related to ), has the following sequence: GTTGCGGTTGGGGTCGATGACGTACCAGGAGAACGATCTGGACGTCCTCCTCCTTCAAGATCTCCGGGATGGCGGCGATCATCACGTCGGGGCCCTTCTGCTCCTCCAGCCTGCCGATGAAGGCCACCAGGGGCACCTTCCGGTCCACCGGCAGCCCCACCTCGGCCTGCAGCGCCTCCTTGTTCAGCGCCTTCCCCTCCAACGCCTGTCACTTTGCCTCGTCCGTCAGAACCCACCCAGAACCAGCAATCACCGGAAGAAATCTTTGTGTGGGTGTGTGGGTGGGCGGGTGCTCACGGTGGTGACGTCGTAGTTGGCGGCGAGGAACTTGTCCTTGGCGGGGTCCCACTCGCTGACGTCCATGCCGTTGACGATGCCGGTGATGCCCGTGAGGCGCATGATGTTGTCGAGCTCGCAGCCCCTGGCTTCGCCGGAGATGAGCTCCTCCGCGTAGTAGGGGCTCACCGTGAGCACCTTGTCGGCCTGCAGGATCCCGGCCTTCATCCAGTTGATCTTGCGCCCCTCCACCGGCTTGTCGTAGCCGTCGATGAAGTCGAAGGACGACTTGAACCTGTCGGGCAGGTTGAGCTGCGCGAAGTCGTCGAAGGAGAAGCGGCCCTGATACGAGATGTTGTGGATGCAGAACGCTACCTGGACATGAAATGAAGTTGCAATGTAAAATTCTGCAGAGAGAATATAAAGTTTGAGAAGATGCAAAACCTTGGCCGTCCTATAGATGCCACTGGACTGGTAGTTGCTCTTGAGGTAGCAGGCCAGA (SEQ ID No.8).
[0042] Detection Wx-B1a PCR reaction system for the site: 1.5 μl of template DNA, 12.5 μl of 2 × Magic PCR Mix (Tolo Harbour), and MlIW30 1 μl each, made up to 25 μl with sterile distilled water. 、 IW30InDel-F Their concentrations in the system are both 0.4 μM.
[0043] Detection PCR reaction system for the site: 1.5 μl template DNA, 12.5 μl 2 × Magic PCR Mix (Tolo Harbour). [[ID=!08]]IW30InDel-R Add 1 μl of each, and bring the total volume to 25 μl with sterile distilled water. The concentration in the system was 0.4 μM.
[0044] The PCR reaction procedure was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 s, 62℃ annealing for 15 s, 72℃ extension for 40 s, 35 cycles; 72℃ extension for 5 min; storage at 4℃.
[0045] The obtained PCR products were subjected to electrophoresis, and the electrophoresis results of each material are as follows: IW30InDel-F As shown, the test results for disease resistance and glutinous texture of each material are as follows: As shown, the powdery mildew resistant glutinous wheat material Wx-2L6... IW30InDel-R The site can be amplified to produce a 1431 bp band. The site could be amplified to obtain a 668 bp band, which was observed in non-glutinous wheat varieties susceptible to powdery mildew, such as Shi Luan 02-1 and Agricultural University 210. Wx-B1 All sites could be amplified to obtain a 955 bp band. All sites amplified to obtain 778 bp bands, conforming to the following correlation between banding and phenotype: BFC、BRC2、BDFL、BRC1 Homozygous wheat whose PCR product contains a 1431 bp band but not a 955 bp band is disease-resistant wheat; heterozygous wheat whose PCR product contains both 1431 bp and 955 bp bands is disease-resistant wheat; and homozygous wheat whose PCR product does not contain a 1431 bp band but contains a 955 bp band is disease-susceptible wheat. The PCR product containing a 668 bp band but not a 778 bp band is a homozygous deletion. BFC、BRC2、BDFL、BRC1 The PCR product containing bands of 668 bp and 778 bp indicates a heterozygous type. PCR products containing no 668 bp band or containing a 778 bp band are homozygous wild-type. Figure 1 .
[0046] Secondly, the offspring of Wx-2L6 and Shi Luan 02-1 and Nongda 210 were tested. site Figure 2 Loci, and using the parents as controls.
[0047] Genomic DNA was extracted from each material and utilized. , MlIW30 , Multiplex PCR was performed, and the multiplex PCR system is as follows: 1.5 μl template DNA, 12.5 μl 2 × Magic PCR Mix (Tolo Harbour). Wx-B1 , , MlIW30 Add 1 μl of each, and bring the total volume to 25 μl with sterile distilled water. , Wx-B1 , MlIW30 Wx-B1 Wx-B1b Wx-B1a / Wx-B1b Wx-B1a MlIW30 、Wx-B1 IW30InDel-F IW30InDel-R BFC、BRC2、BDFL、BRC1 IW30InDel-F IW30InDel-R BFC、BRC2、BDFL、BRC1 IW30InDel-F IW30InDel-R BFC、BRC2、BDFL、BRC1 The concentration in the system was 0.4 μM.
[0048] PCR amplification reaction program: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 s, 62℃ annealing for 15 s, 72℃ extension for 40 s, 35 cycles; 72℃ extension for 5 min; store at 4℃.
[0049] The PCR products of each obtained material were subjected to electrophoresis. The electrophoresis results of some materials are shown below. Figure 4 As shown, MlIW30 Homozygous wheat whose PCR product contains a 1431 bp band but not a 955 bp band is denoted as RR genotype wheat; heterozygous wheat whose PCR product contains both 1431 bp and 955 bp bands is denoted as Rr genotype wheat; and homozygous wheat whose PCR product does not contain a 1431 bp band but contains a 955 bp band is denoted as rr genotype wheat. Will Wx-B1 Homozygous wheat whose PCR products contain a 668 bp band but not a 778 bp band is denoted as bb genotype wheat; heterozygous wheat whose PCR products contain both 668 bp and 778 bp bands is denoted as ab genotype wheat; and homozygous wheat whose PCR products do not contain a 668 bp band but contain a 778 bp band is denoted as aa genotype wheat.
[0050] 4. Genes MlIW30 and Wx-B1b Calculation of genetic distance Powdery mildew-resistant glutinous wheat material Wx-2L6 was crossed with powdery mildew-susceptible non-glutinous wheat varieties Shilu 02-1 and Nongda 210, respectively. The resulting BC1F1 single plants, exhibiting resistance to the physiological race E09 of powdery mildew, were obtained through backcrossing with Shilu 02-1 and Nongda 210, respectively. These plants were then tested according to step 3. Wx-B1 PCR reaction system and conditions for the site, using primers BFC / BRC2 / BDFL / BRC1 Detection of BC1F1 individual plants Wx-B1 Site.
[0051] The results showed that all disease-resistant plants of Wx-2L6 and BC1F1 from Nongda 210 could amplify the target band of 1431 bp, of which 14 plants could amplify the target band of 668 bp, indicating that the 14 plants in the backcross progeny contained the target band of 1431 bp. Wx-B1b, the genotypes of these 14 individual plants are Rrab; the target band of 1431 bp can be amplified from all the BC1F1 individual plants of Wx-2L6 and Shiluan 02-1, and the target band of 668 bp can be amplified from 12 of these individual plants, indicating that 12 individual plants in the backcross progeny contain Wx- B1b , and the genotypes of these 12 individual plants are Rrab.
[0052] Using the 26 individual plants (with Rrab genotype) that were identified to contain both Wx-B1b and MlIW30 in the BC1F1 of Wx-2L6 / Nongda 210 and Wx-2L6 / Shiluan 02-1 to self-cross or backcross to obtain 567 BC1F2 and BC2F1 individual plants, and using the multiplex PCR in step 3 for genotyping to calculate the genetic distance between the two genes. A total of 171 exchange individual plants were identified, among which 11 individual plants had both recombinant gametes in the target segment, and 160 individual plants had only one recombinant gamete in the target segment. That is, the recombination value between the two loci ( MlIW30 locus and Wx-B1 locus) = (160 + 11×2) / (567×2) × 100% ≈ 16.05%, as shown in Figure 5 . The genetic distance between the MlIW30 locus and Wx-B1 locus is 16.05 cM (Fielder contains Wx-B1b ). Among the powdery mildew-resistant individual plants, about 88% of the individual plants contain Wx-B1b . Among them, exchange refers to the exchange of corresponding segments between non-sister chromatids of homologous chromosomes, which causes the exchange and recombination of corresponding genes. Here, the exchange individual plants refer to the individual plants that are different from the two parents at the W1-B1 and MlIW30 loci due to exchange. Recombinant gametes are the result of exchange within the corresponding segment of linked genes. Here, the recombinant gametes refer to the gametes that are different from the parents due to the exchange between W1-B1 and MlIW30.
[0053] Backcross the 12 individual plants with the genotype of Rrab in the BC1F1 of Wx-2L6 and Shiluan 02-1 with Shiluan 02-1 to obtain BC2F1, and self-cross BC2F1 to obtain BC2F2. Randomly select 96 disease-resistant individual plants from BC2F2, and according to the PCR reaction system and reaction conditions for detecting the Wx- B1 locus in step 3, separately detect the Wx-B1 locus.
[0054] The results are as shown in Figure 6 . Among the 96 disease-resistant individual plants, 84 individual plants were detected with the Wx-B1b band pattern (ab genotype or bb genotype), and separately detect the Wx-B1The banding patterns of the loci were consistent with those of multiplex PCR, proving the accuracy of the above methods and results; that is, 87.5% of the resistant plants contained [the desired banding pattern]. Wx-B1b The band pattern indicates that 87.5% of the disease-resistant individual plants carried the virus. Wx-B1b Site.
[0055] Therefore, in the traditional breeding process, it is possible to... Wx-B1b and MlIW30 During the aggregation and utilization process, the powdery mildew resistance phenotype was used to screen for products containing [specific substances]. Wx-B1b The material showed that 87.5% of powdery mildew-resistant plants contained [the relevant ingredient]. Wx-B1b It should be noted that in the original text, there seems to be an error where "图3" is translated as "Figure 4" in the translation. It should be "Figure 3". And "图4" should be "Figure 4", "图5" should be "Figure 5". The above translation has been corrected according to the correct understanding. Furthermore, it can be used to select high-efficiency polymeric materials with disease-resistant glutinous sites in traditional breeding processes.
[0056] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
[0057] References: [1] Duan Xiayu, Sheng Baoqin, Zhou Yilin, et al. Identification of physiological races of wheat powdery mildew and monitoring of pathogen virulence [J]. Journal of Plant Protection, 1998, 25(1): 31-36. [2] Geng M, Zhang J, Peng F, et al. Identification and mapping ofMLIW30, a novel powdery mildew resistance gene derived from wild emmer wheat[J]. Molecular Breeding, 2016, 36: 1-11. [3] Nakamura T, Yamamori M, Hirano H, et al. Decrease of waxy (Wx)protein in two common wheat cultivars with low amylose content[J]. PlantBreeding, 1993, 111(2): 99-105. [4] Yamamori M, Endo T R. Variation of starch granule proteins andchromosome map of their coding genes in common wheat[J]. Theoretical andApplied Genetics, 1996, 93: 275-281. [5] Chen Dongsheng, C. Kiribuchi-Otobe, Xu Zhaohua, et al. Effects of Waxy protein deficiency on wheat starch properties and the quality of fresh noodles in China [J]. Chinese Agricultural Science, 2005(5):865-873.DOI:10.3321 / j.issn:0578-1752.2005.05.002. [6] Murai J, Taira T, Ohta D. Isolation and characterization of the three Waxy genes encoding the granule-bound starch synthase in hexaploidwheat[J]. Gene, 1999, 234(1): 71-79. [7] Zhang Fengqin, Wang Xiangdong, Lu Lahu. Analysis of quality characteristics and development and utilization of glutinous wheat [J]. Shanxi Agricultural Sciences, 2019, 47(12): 2210. [8] Liang Rongqi, Zhang Yirong, Tang Zhaohui, et al. Study on grain composition and starch quality of glutinous common wheat [J]. Journal of Chinese Cereals and Oils, 2002, 17(4): 12-16. [9] Li Chun, Song Guangzhi, Tian Jichun. Research progress on glutinous wheat and its Waxy gene [J]. Bulletin of Agricultural Science, 2007, 23(7): 257-262.
[10] Liu Yingchun, Zhu Huilan, Cheng Shunhe, et al. PCR molecular markers of Wx-A1 and Wx-D1 sites in wheat [J]. Journal of Triticeae Crops, 2005, 25(1): 1-5.
[11] Saito M, Vrinten P, Ishikawa G, et al. A novel codominant marker for selection of the null Wx-B1 allele in wheat breeding programs[J]. Molecular Breeding, 2009, 23: 209-217.
[12] Saito M, Vrinten P, Nakamura T. DNA markers for identifying waxymutations and improving noodle quality in wheat[J]. Japan AgriculturalResearch Quarterly: JARQ, 2010, 44(2): 109-115.
[0058]
[13] Huang Zhanjing, Breeding of a new high-quality special-purpose wheat variety, Shilu 02-1. Luancheng County Seed Farm, Hebei Province, 2006-06-06.
Claims
1. A method for detecting wheat Wx-B1 The method of site, the Wx-B1 The site is the DNA fragment in the wheat genome corresponding to SEQ ID No. 7 or SEQ ID No. 8, which is... Wx-B1b or Wx-B1a The method includes: To detect the powdery mildew resistance of wheat samples, the powdery mildew resistance phenotype was used for detection. Wx-B1 Does the site carry Wx-B1b : Test wheat species resistant to powdery mildew Wx- B1 Site carrying Wx-B1b ; The Wx-B1b The DNA fragment shown in SEQ ID No. 7; The Wx-B1a The DNA fragment is shown in SEQ ID No.
8.
2. The method according to claim 1, characterized in that: The detection of powdery mildew resistance in the wheat to be tested is accomplished by inoculating the wheat to be tested with powdery mildew fungus and determining its resistance to powdery mildew fungus.
3. The method according to claim 1, characterized in that: The method used to detect powdery mildew in the wheat under test is as follows: IW30InDel-F and IW30InDel-R The primer pairs were used to amplify the genomic DNA of the wheat to be tested by PCR. IW30InDel-F With the IW30InDel-R The single-stranded DNAs are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively. Wheat samples whose PCR products contain a 1431 bp DNA fragment are considered or candidate wheat resistant to powdery mildew, while wheat samples whose PCR products do not contain a 1431 bp DNA fragment are considered or candidate non-powdery mildew resistant wheat.
4. The application of the method described in any one of claims 1-3 in the cultivation of glutinous wheat, or in the cultivation of powdery mildew resistant glutinous wheat.
5. Testing wheat MlIW30 The substance at the site in the detection of wheat Wx-B1 Application in the site, the Wx-B1 The site is the DNA fragment in the wheat genome corresponding to SEQ ID No. 7 or SEQ ID No. 8, which is... Wx-B1b or Wx-B1a ; The Wx-B1b The DNA fragment shown in SEQ ID No. 7; The Wx-B1a The DNA fragment is shown in SEQ ID No.
8.
6. The application according to claim 5, characterized in that: The detection MlIW30 The substance at the site is a primer pair consisting of single-stranded DNA as shown in SEQ ID No. 1 and SEQ ID No.
2.
7. Testing wheat MlIW30 Application of the substance at the site in the breeding of glutinous wheat, or in the breeding of powdery mildew resistant glutinous wheat.
8. The application according to claim 7, characterized in that: The detection of wheat MlIW30 The substance at the site is a primer pair consisting of single-stranded DNA as shown in SEQ ID No. 1 and SEQ ID No.
2.
9. Testing wheat MlIW30 Sites and detection of wheat Wx-B1 Application of the substance at the site in the breeding of glutinous wheat, or in the breeding of powdery mildew resistant glutinous wheat.
10. The application according to claim 9, characterized in that: The detection of wheat MlIW30 The substance at the site is a primer pair consisting of single-stranded DNA as shown in SEQ ID No. 1 and SEQ ID No. 2; The detection of wheat Wx-B1 The substances at the sites are the primers shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6.