KASP molecular marker of bitter gourd, primer and application of KASP molecular marker
By developing KASP molecular markers and primer sets for bitter gourd, the problem of incomplete research on molecular markers for Fusarium wilt in bitter gourd was solved, enabling efficient screening of Fusarium wilt-resistant plants and simplifying the breeding process.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
- Filing Date
- 2026-03-06
- Publication Date
- 2026-05-12
AI Technical Summary
The existing molecular marker research on Fusarium wilt in bitter gourd is incomplete, which makes it difficult to breed disease-resistant varieties. Existing chemical control and grafting technologies are inefficient and costly.
KASP molecular markers for bitter gourd, including MC07-0177 and MC07-1544, were developed. Corresponding primer sets were designed, and genotypes were distinguished by PCR amplification and fluorescence signal scanning. Homozygous plants resistant to Fusarium wilt were screened out.
It has enabled efficient and convenient screening of homozygous bitter gourd plants resistant to Fusarium wilt, with the test results showing over 90% consistency with actual surveys, significantly shortening the breeding cycle of disease-resistant varieties.
Smart Images
Figure CN122012783A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and in particular to a KASP molecular marker for bitter melon, primers, and their applications. Background Technology
[0002] Bitter melon (Momordica charantia L.) is an important health-promoting vegetable belonging to the Cucurbitaceae family. Its flesh is rich in vitamin C, carotenoids, minerals, and saponins, possessing anti-cancer, blood sugar-lowering, anti-inflammatory, antibacterial, and immune-boosting effects. In recent years, due to a deeper understanding of the medicinal and health benefits of bitter melon, its consumer base has gradually expanded throughout Asia and other parts of the world, becoming a globally popular vegetable. In Guangxi, the annual bitter melon planting area reaches over 600,000 mu (approximately 40,000 hectares). The hot and humid summer weather, coupled with intensive cultivation in various regions, has led to a severe outbreak of Fusarium wilt disease, with an incidence rate reaching 85% in severely affected areas. Fusarium wilt has become one of the most devastating diseases in the main bitter melon producing areas.
[0003] Fusarium wilt is a major and devastating soil-borne disease caused by *Fusarium oxysporum* var. *bitterella*. After infection, bitter gourd leaves gradually turn yellow and wither from the bottom up due to vascular blockage and the effects of toxins, eventually leading to the death of the entire plant. Previous studies have shown that in greenhouse continuous cropping areas, the average incidence of Fusarium wilt during the peak flowering and fruiting stages reaches 13%–51% and 40%–80%, respectively, causing severe yield reduction or even crop failure, resulting in significant economic losses for bitter gourd production. The pathogen of Fusarium wilt has strong survival ability in the soil and exhibits host specificity, making control extremely difficult. Breeding disease-resistant varieties is the most effective and environmentally friendly measure.
[0004] Integrated pest management for bitter gourd wilt still faces technical bottlenecks: conventional chemical control is difficult to achieve effective control after an outbreak; grafting, while effective, is time-consuming, labor-intensive, and costly. In contrast, breeding resistant varieties remains the most economical control strategy. With the rapid development of molecular biology, molecular breeding technology has greatly accelerated the process of disease resistance breeding and significantly shortened the cycle of resistant variety selection. DNA molecular marker technology, due to its high polymorphism, convenient, rapid, and accurate detection, plays an extremely important role in the genetic breeding of crop disease resistance. Currently, research on the fine mapping of major QTLs and related molecular markers for bitter gourd wilt is still incomplete.
[0005] Based on this, the present invention is proposed. Summary of the Invention
[0006] The purpose of this invention is to provide a KASP molecular marker, primers and their applications for bitter melon, in order to solve the problem of incomplete research on molecular markers related to Fusarium wilt in bitter melon in the prior art.
[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a KASP molecular marker for bitter melon, wherein the KASP molecular marker includes one of the MC07-0177 molecular marker and the MC07-1544 molecular marker; The MC07-0177 molecular marker is located at position 13770177 on chromosome 7 of bitter melon, and the mutation type is A / G. The MC07-1544 molecular marker is located at position 14121544 on chromosome 7 of bitter melon, and the mutation type is C / T.
[0008] Preferably, when the genotype at the MC07-0177 molecular marker is AA, the bitter gourd plant is a homozygous resistant plant to Fusarium wilt; when the genotype is GG, the bitter gourd plant is a homozygous susceptible plant to Fusarium wilt; and when the genotype is GA, the bitter gourd plant is a heterozygous plant. When the genotype at the MC07-1544 molecular marker is CC, the bitter gourd plant is a homozygous resistant plant to Fusarium wilt; when the genotype is TT, the bitter gourd plant is a homozygous susceptible plant to Fusarium wilt; and when the genotype is CT, the bitter gourd plant is a heterozygous plant.
[0009] The present invention provides a primer set for detecting the KASP molecular marker, the primer set including a primer set for detecting the MC07-0177 molecular marker and a primer set for detecting the MC07-1544 molecular marker.
[0010] Preferably, the primer set for detecting the MC07-0177 molecular marker includes forward primer 1, forward primer 2, and universal reverse primer 1; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 1; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO.2; The nucleotide sequence of the universal reverse primer 1 is shown in SEQ ID NO.3.
[0011] Preferably, the 5' end of the forward primer 1 is linked to a FAM fluorescent tag sequence, the nucleotide sequence of which is shown in SEQ ID NO.7; The 5' end of the forward primer 2 is connected to a HEX fluorescent tag sequence, which is shown in SEQ ID NO. 8.
[0012] Preferably, the primer set for detecting the MC07-1544 molecular marker includes forward primer 3, forward primer 4, and universal reverse primer 2; The nucleotide sequence of the forward primer 3 is shown in SEQ ID NO. 4; The nucleotide sequence of the forward primer 4 is shown in SEQ ID NO. 5; The nucleotide sequence of the universal reverse primer 2 is shown in SEQ ID NO. 6.
[0013] Preferably, the 5' end of the forward primer 3 is linked to a FAM fluorescent tag sequence, the nucleotide sequence of which is shown in SEQ ID NO.7; The 5' end of the forward primer 4 is connected to a HEX fluorescent tag sequence, which is shown in SEQ ID NO. 8.
[0014] This invention provides the application of the KASP molecular marker or the primer set described herein in the breeding of bitter gourd varieties resistant to Fusarium wilt.
[0015] This invention provides the application of the KASP molecular marker or the primer set described herein in the preparation of products for screening homozygous bitter gourd plants resistant to Fusarium wilt.
[0016] This invention provides a method for detecting homozygous bitter gourd plants resistant to Fusarium wilt, the method comprising the following steps: DNA was extracted from the tested bitter gourd, and amplified using a primer set with the DNA as a template. The genotypes of the amplified products were distinguished, and homozygous bitter gourd plants resistant to Fusarium wilt were identified based on the genotypes. The primer set is the primer set described above.
[0017] The present invention has the following technical effects and advantages: This invention screened two KASP molecular markers closely associated with the bitter gourd wilt resistance gene. Experiments showed that the two KASP molecular markers can distinguish between wilt-resistant and wilt-susceptible bitter gourd plants. The detection results were consistent with the actual survey results by more than 90%. Furthermore, the method of screening bitter gourd wilt resistance using KASP molecular markers is simple, fast, and efficient, laying the foundation for molecular breeding of bitter gourd wilt resistance. Attached Figure Description
[0018] Figure 1 Chromosome localization results for the SNPs and Indel datasets; Figure 2 F2 population typing for the MC07-0177 molecular marker; Figure 3 F2 population typing for MC07-1544 molecular marker. Detailed Implementation
[0019] This invention provides a KASP molecular marker for bitter melon, wherein the KASP molecular marker includes one of the MC07-0177 molecular marker and the MC07-1544 molecular marker; The MC07-0177 molecular marker is located at position 13770177 on chromosome 7 of bitter melon, and the mutation type is A / G. The MC07-1544 molecular marker is located at position 14121544 on chromosome 7 of bitter melon, and the mutation type is C / T.
[0020] In this invention, when the genotype at the MC07-0177 molecular marker is AA, the bitter gourd plant is a homozygous resistant plant to Fusarium wilt; when the genotype is GG, the bitter gourd plant is a homozygous susceptible plant to Fusarium wilt; and when the genotype is GA, the bitter gourd plant is a heterozygous plant. When the genotype at the MC07-1544 molecular marker is CC, the bitter gourd plant is a homozygous resistant plant to Fusarium wilt; when the genotype is TT, the bitter gourd plant is a homozygous susceptible plant to Fusarium wilt; and when the genotype is CT, the bitter gourd plant is a heterozygous plant.
[0021] The present invention provides a primer set for detecting the KASP molecular marker, the primer set including a primer set for detecting the MC07-0177 molecular marker and a primer set for detecting the MC07-1544 molecular marker.
[0022] In this invention, the primer set for detecting the MC07-0177 molecular marker includes forward primer 1, forward primer 2, and universal reverse primer 1; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 1; The nucleotide sequence of SEQ ID NO.1 is: GCCAACATAAAAATAGTCTATTGGGATAT; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO.2; The nucleotide sequence of SEQ ID NO.2 is: CCAACATAAAAATAGTCTATTGGGATAC; The nucleotide sequence of the universal reverse primer 1 is shown in SEQ ID NO.3; The nucleotide sequence of SEQ ID NO.3 is: GAGAGTGGGGATTCAAATTCATAATCTTTTAATC.
[0023] In this invention, the 5' end of the forward primer 1 is connected to a FAM fluorescent tag sequence, the nucleotide sequence of which is shown in SEQ ID NO.7; The nucleotide sequence of SEQ ID NO.7 is: GAAGGTGACCAAGTTCATGCT; The 5' end of the forward primer 2 is connected to a HEX fluorescent tag sequence, which is shown in SEQ ID NO. 8; The nucleotide sequence of SEQ ID NO.8 is: GAAGGTCGGAGTCAACGGATT.
[0024] In this invention, the primer set for detecting the MC07-1544 molecular marker includes forward primer 3, forward primer 4, and universal reverse primer 2; The nucleotide sequence of the forward primer 3 is shown in SEQ ID NO. 4; The nucleotide sequence of SEQ ID NO.4 is: TTGTTCACTAGTGGACAATGTGTTTG; The nucleotide sequence of the forward primer 4 is shown in SEQ ID NO. 5; The nucleotide sequence of SEQ ID NO.5 is: TTTGTTCACTAGTGGACAATGTGTTTA; The nucleotide sequence of the universal reverse primer 2 is shown in SEQ ID NO. 6; The nucleotide sequence of SEQ ID NO.6 is: GCATTCTAACCAATGTTACCATTTTAGGTTTAAA.
[0025] In this invention, the 5' end of the forward primer 3 is connected to a FAM fluorescent tag sequence, the nucleotide sequence of which is shown in SEQ ID NO.7; The 5' end of the forward primer 4 is connected to a HEX fluorescent tag sequence, which is shown in SEQ ID NO. 8.
[0026] This invention provides the application of the KASP molecular marker or the primer set described herein in the breeding of bitter gourd varieties resistant to Fusarium wilt.
[0027] This invention provides the application of the KASP molecular marker or the primer set described herein in the preparation of products for screening homozygous bitter gourd plants resistant to Fusarium wilt.
[0028] This invention provides a method for detecting homozygous bitter gourd plants resistant to Fusarium wilt, the method comprising the following steps: DNA was extracted from the tested bitter gourd, and amplified using a primer set with the DNA as a template. The genotypes of the amplified products were distinguished, and homozygous bitter gourd plants resistant to Fusarium wilt were identified based on the genotypes. The preferred method for distinguishing the genotypes of amplification products is to scan the fluorescence signals of the amplification products and distinguish different genotypes based on the fluorescence signals. The PCR reaction system was 5 μL: 2 KASP master mix 2.5 μL, upstream primer 0.625 μL, downstream primer 0.625 μL; DNA template 1.25 μL; The PCR reaction program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 61~55℃ annealing / extension for 60 s, 10 cycles; 95℃ denaturation for 20 s, 61~55℃ annealing / extension for 60 s, 27 cycles; 25℃ reading for 30 s. The primer set is the primer set described above.
[0029] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0030] Example 1
[0031] 1. Experimental Materials
[0032] The bitter gourd resistant to Fusarium wilt material 5-278 is a high-generation inbred line obtained by radiation mutagenesis and multi-generation segregation and directional selection provided by the Vegetable Research Institute of Guangxi Academy of Agricultural Sciences. The bitter gourd susceptible to Fusarium wilt material MC10-1 is a high-generation inbred line provided by the Vegetable Research Institute of Guangxi Academy of Agricultural Sciences.
[0033] 2. Constructing a genetically segregating F2 population of bitter gourd.
[0034] The F1 generation was obtained by crossing the resistant parent 5-278 and the susceptible parent MC10-1 of bitter gourd wilt. The F1 generation was then self-pollinated to obtain the F2 generation plants. After seedling inoculation and identification, highly resistant and highly susceptible individual plants were screened based on their plant phenotypes, and resistant and susceptible mixed ponds were constructed.
[0035] 3. Whole genome resequencing of bitter melon
[0036] High-throughput sequencing was performed on the resistant parent 5-278, the susceptible parent MC10-1, and the resistant and susceptible mixed pools, with a sequencing depth of 30X.
[0037] The results showed that the four sequencing samples generated 61,364,674, 61,657,850, 62,675,546, and 62,016,462 clean reads, respectively, with high-quality clean reads accounting for over 99.5% of the total. These clean reads were compared with the reference genome (Dali-11) (CNSA database, accession number: CNP0000016) to detect SNPs and indels. The results showed that 98% of the clean reads were aligned to the reference genome (Dali-11), resulting in a dataset of 180,052 SNPs and 52,192 highly reliable indels.
[0038] 4. Preliminary localization of Fusarium wilt resistance genes
[0039] Chromosome localization was performed on the obtained SNPs and Indel datasets using four analysis methods: SNP-index, G-value, ED, and Fisher. The results are as follows: Figure 1 As shown.
[0040] according to Figure 1 It was found that the obtained SNPs and Indel datasets contained localization intervals on multiple chromosomes. Intervals located simultaneously by four analysis methods were selected as candidate intervals, resulting in two candidate intervals associated with Fusarium wilt resistance: chr6:28380001-31248787 and chr7:13201560-14802903. The chr7:13201560-14802903 interval contained 87 genes. GO enrichment analysis and KEGG pathway analysis of these 87 genes revealed that the genes within the interval mainly function in metabolic processes, cellular biosynthesis, and mitogen-activated protein kinase (MAPK). Therefore, the chr7:13201560-14802903 interval was selected for further research.
[0041] 5. Development of SNP molecular markers for resistance to Fusarium wilt in bitter gourd
[0042] We searched for homozygous and differentially expressed loci between parents within the range of chr7:13201560-14802903. Then, we selected SNP variants located in gene regions (upstream, intronic, exonic, and UTR regions) from these homozygous and differentially expressed loci, identifying a total of 56 loci. Preliminary analysis of these 56 loci revealed that they were primarily distributed across 12 genes: MC07g0576, MC07g0600, MC07g0602, MC07g0612, MC07g0613, MC07g0614, MC07g0615, MC07g0616, MC07g0617, MC07g0618, MC07g0654, and MC07g0656. Functional annotations were performed on these 12 genes, and the results are shown in Table 1.
[0043] Table 1. Functional annotation results of 12 genes
[0044] Based on the functional information of the 12 genes in Table 1, five SNP sites closely associated with resistance to Fusarium wilt in bitter gourd were screened, as shown in Table 2.
[0045] Table 2. Five SNP loci closely associated with resistance to Fusarium wilt in bitter gourd.
[0046] 6. Development of KASP molecular markers
[0047] Based on the information of five SNP sites closely associated with resistance to Fusarium wilt in bitter gourd, a KASP primer set was designed to develop KASP molecular markers. DNA was then extracted from the F2 population of bitter gourd. Using the DNA as a template, the designed KASP primer set was used for amplification, and the amplified products were scanned for fluorescence signals to distinguish different genotypes. KASP primers with clear genotyping and few mismatch reactions were selected as validation primers, and the allele frequency of each marker was calculated. The polymorphism information content of each marker was calculated using the formula PIC = 1 - fi². KASP primers with good specificity, high sensitivity, and good reproducibility showing polymorphism among parents were selected for genotyping of the F2 population, and the fluorescence genotyping results of the primers in the population were statistically analyzed. The association between genotypes and phenotypes of markers within candidate intervals was analyzed by combining inter- and inter-genetic phenotypic data and marker genotyping data.
[0048] The results showed that the two KASP markers designed at positions MC07-0177 and MC07-1544 could classify the F2 population into three categories: homozygous resistant, homozygous susceptible, and heterozygous. The genotyping effect was good, and the marker development was successful. Genotypes AA and TT at the MC07-0177 and MC07-1544 KASP molecular markers corresponded to homozygous resistant plants, GG and CC to homozygous susceptible plants, and GA and TC to heterozygous plants. The primer sequences for the MC07-0177 and MC07-1544 molecular markers are shown in Table 3.
[0049] Table 3 Primer sequences for MC07-0177 and MC07-1544 molecular markers
[0050] In summary, the two KASP molecular markers closely associated with resistance to Fusarium wilt in bitter gourd identified in this application are MC07-0177 and MC07-1544. MC07-0177 is located at base 13770177 on chromosome 7 of bitter gourd, with an A / G variant; MC07-1544 is located at base 14121544 on chromosome 7 of bitter gourd, with a C / T variant. Primer sets for detecting MC07-0177 and MC07-1544 were also designed. Specifically, the primer set for detecting MC07-0177 includes forward primer 1 (SEQ ID NO. 1), forward primer 2 (SEQ ID NO. 2), and universal reverse primer 1 (SEQ ID NO. 3). Forward primer 1 has a FAM fluorescent tag sequence (SEQ ID NO. 3) attached to its 5' end. The primer set for detecting the MC07-1544 molecular marker includes forward primer 3 (SEQ ID NO. 7), forward primer 4 (SEQ ID NO. 5), and universal reverse primer 2 (SEQ ID NO. 6), wherein the 5' end of forward primer 3 is connected to the FAM fluorescent tag sequence (SEQ ID NO. 7), and the 5' end of forward primer 4 is connected to the HEX fluorescent tag sequence (SEQ ID NO. 8).
[0051] Example 2
[0052] A method for detecting homozygous bitter gourd plants resistant to Fusarium wilt, the method comprising the following steps: DNA was extracted from the tested bitter gourd and amplified using a primer set with KASP molecular markers as a template. The amplification products were obtained, and the fluorescence data of the amplification products were read using a high-throughput SNP genotype analyzer. Different genotypes were distinguished based on the fluorescence signals, and homozygous plants resistant to Fusarium wilt were detected based on the genotypes. When the genotype at the molecular marker MC07-0177 is AA, the bitter gourd plant is a homozygous resistant plant to Fusarium wilt; when the genotype is GG, the bitter gourd plant is a homozygous susceptible plant to Fusarium wilt; and when the genotype is GA, the bitter gourd plant is a heterozygous plant. When the genotype at the MC07-1544 molecular marker is CC, the bitter gourd plant is a homozygous resistant plant to Fusarium wilt; when the genotype is TT, the bitter gourd plant is a homozygous susceptible plant to Fusarium wilt; and when the genotype is CT, the bitter gourd plant is a heterozygous plant.
[0053] Example 3
[0054] Using the method described in Example 2, primer sets with MC07-0177 molecular markers and primer sets with MC07-1544 molecular markers were used to perform plant typing on 177 bitter gourd individual plants in the F2 population. The results are as follows: Figure 2 and Figure 3 As shown, Figure 2 The F2 population genotyping map for the MC07-0177 molecular marker. Figure 3 This is the F2 population genotyping diagram for the MC07-1544 molecular marker. In the diagram, blue squares represent homozygous resistance, which is the same as the parental 5-278 genotype; orange dots represent homozygous susceptibility, which is the same as the parental MC10-1 genotype; green triangles represent heterozygous genotypes; black represents negative controls; and x represents undetected.
[0055] according to Figure 2 and Figure 3 It can be seen that the MC07-0177 and MC07-1544 molecular markers can be used to genotype plants in the F2 population, distinguishing between disease-resistant and disease-susceptible individual plants. At the same time, the field phenotypic identification of 177 bitter gourd individual plants was carried out using the seedling inoculation identification method to verify the genotyping results of the two KASP markers. It was found that the genotyping results of the two KASP markers were consistent with the phenotypes of 165 and 163 individual plants, respectively, with a consistency of more than 90% with the actual phenotype of the individual plants.
[0056] As shown in the above embodiments, this invention provides a KASP molecular marker, primers, and their applications for bitter gourd. This invention screened two KASP molecular markers closely related to the bitter gourd wilt resistance gene. Experiments showed that the two KASP molecular markers can distinguish between wilt-resistant and wilt-susceptible bitter gourd plants, with the detection results showing over 90% consistency with actual survey results. Furthermore, the method of using KASP molecular markers to screen for wilt resistance in bitter gourd is simple, rapid, and efficient, laying the foundation for molecular breeding of wilt-resistant bitter gourd.
[0057] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A KASP molecular marker for bitter melon, characterized in that, The KASP molecular marker includes one of the MC07-0177 molecular marker and the MC07-1544 molecular marker; The MC07-0177 molecular marker is located at position 13770177 on chromosome 7 of bitter melon, and the mutation type is A / G. The MC07-1544 molecular marker is located at position 14121544 on chromosome 7 of bitter melon, and the mutation type is C / T.
2. The KASP molecular marker according to claim 1, characterized in that, When the genotype at the MC07-0177 molecular marker is AA, the bitter gourd plant is a homozygous resistant plant to Fusarium wilt; when the genotype is GG, the bitter gourd plant is a homozygous susceptible plant to Fusarium wilt; and when the genotype is GA, the bitter gourd plant is a heterozygous plant. When the genotype at the MC07-1544 molecular marker is CC, the bitter gourd plant is a homozygous resistant plant to Fusarium wilt; when the genotype is TT, the bitter gourd plant is a homozygous susceptible plant to Fusarium wilt; and when the genotype is CT, the bitter gourd plant is a heterozygous plant.
3. A primer set for detecting the KASP molecular marker of claim 1, characterized in that, The primer set includes a primer set for detecting the MC07-0177 molecular marker and a primer set for detecting the MC07-1544 molecular marker.
4. The primer set according to claim 3, characterized in that, The primer set for detecting the MC07-0177 molecular marker includes forward primer 1, forward primer 2, and universal reverse primer 1; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 1; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO.2; The nucleotide sequence of the universal reverse primer 1 is shown in SEQ ID NO.
3.
5. The primer set according to claim 4, characterized in that, The 5' end of the forward primer 1 is linked to a FAM fluorescent tag sequence, the nucleotide sequence of which is shown in SEQ ID NO.7; The 5' end of the forward primer 2 is connected to a HEX fluorescent tag sequence, which is shown in SEQ ID NO.
8.
6. The primer set according to claim 3, characterized in that, The primer set for detecting the MC07-1544 molecular marker includes forward primer 3, forward primer 4, and universal reverse primer 2; The nucleotide sequence of the forward primer 3 is shown in SEQ ID NO. 4; The nucleotide sequence of the forward primer 4 is shown in SEQ ID NO. 5; The nucleotide sequence of the universal reverse primer 2 is shown in SEQ ID NO.
6.
7. The primer set according to claim 6, characterized in that, The 5' end of the forward primer 3 is linked to a FAM fluorescent tag sequence, the nucleotide sequence of which is shown in SEQ ID NO.7; The 5' end of the forward primer 4 is connected to a HEX fluorescent tag sequence, which is shown in SEQ ID NO.
8.
8. The application of the KASP molecular marker as described in claim 1 or 2 or the primer set as described in any one of claims 3 to 7 in the breeding of bitter gourd varieties resistant to Fusarium wilt.
9. The application of the KASP molecular marker as described in claim 1 or 2, or the primer set as described in any one of claims 3 to 7, in the preparation of products for screening homozygous bitter gourd plants resistant to Fusarium wilt.
10. A method for detecting homozygous bitter gourd plants resistant to Fusarium wilt, characterized in that, The method includes the following steps: DNA was extracted from the tested bitter gourd, and amplified using a primer set with the DNA as a template. The genotypes of the amplified products were distinguished, and homozygous bitter gourd plants resistant to Fusarium wilt were identified based on the genotypes. The primer set is the primer set according to any one of claims 3 to 7.