Primers and method for identifying peach kernels and mountain peach kernels and application
By designing specific PCR primers petA-F and psbJ-R and combining them with the EcoRV enzyme digestion method, the problem of distinguishing peach kernels from wild peach kernels in traditional identification methods has been solved, achieving rapid and accurate identification and quality control.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHENGDE TRADITIONAL CHINESE MEDICINE GROUP
- Filing Date
- 2026-03-13
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies make it difficult to quickly and accurately distinguish between peach kernels and wild peach kernels. Traditional identification methods are highly subjective, time-consuming, costly, and difficult to operate in mass production.
Primers petA-F and psbJ-R were designed using site-specific PCR technology and bound to the restriction endonuclease EcoRV. Peach kernels and wild peach kernels were identified by PCR amplification and enzyme digestion.
It enables rapid and accurate identification of peach kernels and wild peach kernels, establishes an efficient quality control method, and reduces human error and operation time.
Smart Images
Figure CN122012789A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of traditional Chinese medicine technology, and in particular to a primer, method and application for distinguishing peach kernel from wild peach kernel. Background Technology
[0002] Peach kernel is the kernel of the peach plant (Prunus persica), a member of the Rosaceae family. Prunus persica (L.) Batsch or mountain peach Prunus davidiana (Carr.)Franch. The dried, mature seeds of peaches have the effects of promoting blood circulation, removing blood stasis, moistening the intestines and relieving constipation, and relieving cough and asthma. Peach and wild peach seeds belong to the same family and genus, and are very similar in appearance and size, making them even more difficult to distinguish after peeling. Literature records significant differences in the chemical composition of peach kernels and wild peach kernels. Using amino acid content as an evaluation index, wild peach kernels are superior to peach kernels; using fat-soluble components as an evaluation index, there are also significant differences between the two.
[0003] Currently, quality control standards for Chinese medicinal materials are mostly limited to the identification of main components and microscopic features. They cannot accurately identify medicinal materials with similar appearances. Peach kernels, being a seed-based medicinal material, are rich in oil and prone to oil seepage and spoilage. The results are affected by sensory differences and the testing environment, making them impractical for large-scale industrial production. Traditional identification methods, such as morphological identification, microscopic identification, physicochemical identification, and chemical composition analysis, suffer from drawbacks such as high subjectivity, long processing times, complex procedures, and high costs.
[0004] Molecular biology techniques are rapid, capable of handling minute quantities, highly specific, accurate, and reliable samples, and are unaffected by factors such as the sample's growth and development stage, the tested part, environmental conditions, and storage. Therefore, they are highly suitable for the study of traditional Chinese medicinal materials. Currently, extensive research has been conducted on dozens of varieties of traditional Chinese medicinal materials using molecular biology techniques, yielding numerous successful results.
[0005] Therefore, establishing a method for identifying the original source of peach kernel is an urgent requirement to ensure the clinical safety and effective application of peach kernel medicinal materials. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a primer, method and application for distinguishing peach kernel from wild peach kernel.
[0007] The technical solution adopted by this invention to solve its technical problem is: A primer for distinguishing between peach kernel and wild peach kernel, the primer comprising primer petA-F and primer psbJ-R, wherein the gene sequence of primer petA-F is SEQ ID NO.1 and the gene sequence of primer psbJ-R is SEQ ID NO.2.
[0008] The application of the primers described above in distinguishing between peach kernels and wild peach kernels.
[0009] The method for identifying peach kernels and wild peach kernels using the primers described above involves using site-specific PCR technology to select primers, then designing restriction endonucleases based on different sites, and using enzyme digestion to identify peach kernels and wild peach kernels.
[0010] Furthermore, it includes the following steps: Genome samples were randomly taken from peach kernels, and the genome was extracted as a template. After PCR amplification and purification, the genome was ligated into the pMD20-T vector and transformed into DH5α competent cells. LB Amp + Incubate the culture medium in a plate at 37°C for 16 hours, then pick positive clones and transfer them to 400 μL of LB Amp. + The culture was carried out in liquid medium at 37°C with shaking for 2 hours. The recombinants were detected by bacterial PCR and then sequenced. The recombinants were digested with EcoRV enzyme. Each 10µL digestion system contained 2µL of PCR product, 0.3µL of EcoRV enzyme, 1µL of 10× Buffer, and 6.7µL of sterile deionized water. The mixture was incubated at 37°C for 1 hour. The digestion products were detected by 3.0% agarose gel electrophoresis. Peach kernels had no digestion sites, and the digestion products remained unchanged. Wild peach kernels were digested into two fragments by EcoRV enzyme.
[0011] Furthermore, during PCR amplification, each 10 µL amplification system contains 1 U·µL. -1 Add 5 µL of Genstar polymerase, 0.2 µL each of upstream and downstream primers (petA-F and psbJ-R), 0.3 µL of template DNA, and sterile deionized water to a total volume of 10 µL.
[0012] Furthermore, the PCR amplification conditions were as follows: pre-denaturation at 94℃ for 3 min, followed by 34 cycles of 94℃ for 30 s, 57℃ for 30 s, and 72℃ for 1 min, extension at 72℃ for 5 min, and storage at 4℃.
[0013] Furthermore, per 1L LB Amp + The formula for plate culture medium is: 10g tryptone, 5g yeast extract, 10g NaCl, 1.5g agar, and 1L of deionized water. 1L of LB Amp + The liquid culture medium formula is: 10g tryptone, 5g yeast extract, and 10g NaCl, prepared with deionized water to a volume of 1L.
[0014] The advantages and positive effects of this invention are as follows: 1. This invention establishes an intraspecific identification method for peach kernels using PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism). Primers are selected using site-specific PCR technology, and restriction endonucleases are designed based on different sites. Enzyme digestion is then used to distinguish between peach kernels and wild peach kernels. This method allows for rapid identification of peach kernels and wild peach kernels, providing a new technical means for the quality control of peach kernel-related products.
[0015] 2. This invention applies molecular biology techniques to the identification and control of peach kernel origins. For the first time, it has found the specific sequences of peach kernels and wild peach kernels using universal primers, distinguishing them from the perspective of gene sequence. Combined with existing peach kernel analysis methods, this provides a reference for the formation of a more complete peach kernel quality control system.
[0016] 3. This invention can accurately distinguish between peach kernels and wild peach kernels with only one PCR (polymerase chain reaction), one enzyme digestion reaction, and one electrophoresis, which has the advantages of high efficiency and accuracy. Attached Figure Description
[0017] Figure 1 This is a sequence result diagram from the present invention; where, note: PD represents peach ( Prunus persica ); PP represents mountain peach ( Prunus davidiana ) 。 The gray sequence (GGGTTTGCATGATATCTGATCGATAGAAA) is present only in peach kernels, while this gene sequence is lost in wild peach kernels. The EcoRI V restriction site (GATATC, darker black portion) was found within the gray sequence. Figure 2 This is a diagram showing the enzyme digestion results in this invention; Figure 3 This is a graph showing the enzyme digestion stability results in this invention. Detailed Implementation
[0018] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.
[0019] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.
[0020] A primer for distinguishing between peach kernel and wild peach kernel, the primer comprising primer petA-F and primer psbJ-R, wherein the gene sequence of primer petA-F is SEQ ID NO.1 and the gene sequence of primer psbJ-R is SEQ ID NO.2.
[0021] The application of the primers described above in distinguishing between peach kernels and wild peach kernels.
[0022] The method for identifying peach kernels and wild peach kernels using the primers described above involves using site-specific PCR technology to select primers, then designing restriction endonucleases based on different sites, and using enzyme digestion to identify peach kernels and wild peach kernels.
[0023] Furthermore, it includes the following steps: Genome samples were randomly taken from peach kernels, and the genome was extracted as a template. After PCR amplification and purification, the genome was ligated into the pMD20-T vector and transformed into DH5α competent cells. LB Amp + Incubate the culture medium in a plate at 37°C for 16 hours, then pick positive clones and transfer them to 400 μL of LB Amp. + The culture was carried out in liquid medium at 37°C with shaking for 2 hours. The recombinants were detected by bacterial PCR and then sequenced. The recombinants were digested with EcoRV enzyme. Each 10µL digestion system contained 2µL of PCR product, 0.3µL of EcoRV enzyme, 1µL of 10× Buffer, and 6.7µL of sterile deionized water. The mixture was incubated at 37°C for 1 hour. The digestion products were detected by 3.0% agarose gel electrophoresis. Peach kernels had no digestion sites, and the digestion products remained unchanged. Wild peach kernels were digested into two fragments by EcoRV enzyme.
[0024] Furthermore, during PCR amplification, each 10 µL amplification system contains 1 U·µL. -1 Add 5 µL of Genstar polymerase, 0.2 µL each of upstream and downstream primers (petA-F and psbJ-R), 0.3 µL of template DNA, and sterile deionized water to a total volume of 10 µL.
[0025] Furthermore, the PCR amplification conditions were as follows: pre-denaturation at 94℃ for 3 min, followed by 34 cycles of 94℃ for 30 s, 57℃ for 30 s, and 72℃ for 1 min, extension at 72℃ for 5 min, and storage at 4℃.
[0026] Furthermore, per 1L LB Amp + The formula for plate culture medium is: 10g tryptone, 5g yeast extract, 10g NaCl, 1.5g agar, and 1L of deionized water. 1L of LB Amp + The liquid culture medium formula is: 10g tryptone, 5g yeast extract, and 10g NaCl, prepared with deionized water to a volume of 1L.
[0027] Specifically, the relevant preparation and testing methods are as follows: This invention amplifies 16 plant-specific primers, and the resulting products are sequenced to identify specific gene sequences for peach kernel and wild peach kernel. Through comparison and screening, a unique peach kernel gene sequence (GGGTTTGCAT) was found when amplified and sequenced using primers petA-F / psbJ-R. GATATC (TGATCGATAGAAA), and a restriction endonuclease named EcoRⅤ was designed using a specific gene sequence (GATATC), and its stability was verified.
[0028] 16 plant universal primers: rps16-F / rps16-R, ycf1b-R / ycf1b-F, ycf1b-1R / ycf1b-1F, ycf1b-2R / ycf1b-2F, ycf1b-3R / ycf1b-3F, ycf1b-4R / ycf1b-4F, ycf1b-5R / ycf1b-5F, ycf1b-6R / ycf1b-6F, matk-390F / matk-1236, matk-3F-kim / matk-1R-kim, matk-XF / matk-5R, FRITLARIAE-1 / FRITLARIAE-2, petA-F / psbJ-R, rpl32-F / trnl-R, clpP-F / clpP, trnH / psbA.
[0029] Specifically as follows: 1. Extraction of genomic DNA from peach kernels Kit method (QIAGEN catalog number: 13323): The experimental procedure should be strictly followed according to the kit instructions.
[0030] 2. PCR amplification and sequencing of gene fragments using different primers Using the genomic DNA of peach kernels and wild peach kernels extracted under the conditions of step 1 as templates, rps16-F / rps16-R, ycf1b-R / ycf1b-F, ycf1b-1R / ycf1b-1F, ycf1b-2R / ycf1b-2F, ycf1b-3R / ycf1b-3F, ycf1b-4R / ycf1b-4F, ycf1b-5R / ycf1b-5F, ycf1b-6R / ycf1b-6F, matk-390F / matk-1236, matk-3F-kim / matk-1R-kim, matk-XF / matk-5R, FRITLARIAE-1 / 16 pairs of universal plant primers, FRITLARIAE-2, petA-F / psbJ-R, rpl32-F / trnl-R, clpP-F / clpP, and trnH / psbA (sequences shown in Table 1), were used for PCR amplification of the peach kernel genome. Amplification system: Genstar polymerase (1 U·µL) -1 5µL of primer, 0.2µL each of forward and reverse primers, 0.3µL of template DNA, and sterile deionized water to a total volume of 10µL. Amplification conditions: pre-denaturation at 94℃ for 3 min, followed by 34 cycles of 94℃ for 30 s, 57℃ for 30 s, and 72℃ for 1 min, extension at 72℃ for 5 min, and storage at 4℃.
[0031] The PCR products were partially detected by 1.8% agarose gel electrophoresis, and partially purified using a kit (TianGen, catalog number: 04217), ligated into the pMD20-T vector (Takara, catalog number: AK4602), and transformed into DH5α competent cells. LB Amp + Plate culture medium (LB Amp in this invention) + The plate culture medium can be any known culture medium in the prior art. Preferably, its formulation can also be: 10g tryptone, 5g yeast extract, 10g NaCl, 1.5g agar, and 1L deionized water. Incubate at 37°C for 16h, then pick positive clones and transfer them to 400μL LB Amp. + Liquid culture medium (LBAmp in this invention) + Liquid culture medium can be any known culture medium in the prior art. Preferably, the formulation can also be: 10g tryptone, 5g yeast extract, 10g NaCl, and 1L deionized water, cultured at 37°C with shaking for 2 hours. Recombinants were detected by bacterial PCR and sequenced by BGI Genomics. Sequence alignment confirmed that the PCR product of the plant universal primers petA-F / psbJ-R (primer sequences below) contained specific fragments (GGGTTTGCAT) for peach kernel and wild peach kernel. GATATC(TGATCGATAGAAA). For example Figure 1 As shown, from Figure 1 It can be seen from this that peach kernel (PP) has a specific fragment (GGGTTTGCAT). GATATC TGATCGATAGAAA); Peach kernel (PD) does not have heterologous fragments, and therefore does not have enzyme cleavage sites.
[0032] Table 1. List of 16 primer pairs
[0033] 3. Selection of restriction endonucleases Referring to sequence NC_039735.1 in the National Center for Biotechnology Information (NCBI) database, the specific sequence (GGGTTTGCAT) obtained by universal primer petA-F / psbJ-R PCR was determined by comparing it with the peach kernel gene sequence. GATATC (TGATCGATAGAAA), the unique restriction enzyme site (GATATC) for distinguishing wild peach kernels was found. EcoRV was selected as the restriction endonuclease. The digestion conditions were: 2 µL of PCR product, 0.3 µL of EcoRV enzyme, 1 µL of 10× Buffer, and 6.7 µL of sterile deionized water in a 10 µL system. The mixture was incubated at 37 °C for 1 h. The digestion product was detected by 3.0% agarose gel electrophoresis. The results are shown below. Figure 2 The electrophoresis diagram shown is as follows. A is the original PCR solution, and B is the enzyme digestion result. Peach kernels do not have enzyme digestion sites, while wild peach kernels are digested into two fragments. The enzyme digestion results show that wild peach kernels are digested into two fragments by EcoRI V.
[0034] The restriction sites of EcoRⅤ enzyme are: 4. Stability test Genome samples were randomly selected from 1-5 batches of peach kernel samples and extracted as templates. Amplification system: Genstar polymerase (1 U·µL) -1 5 µL of primer, 0.2 µL each of upstream and downstream primers (petA-F and psbJ-R), 0.3 µL of template DNA, and sterile deionized water were added to a total volume of 10 µL. Amplification conditions: 94 °C pre-denaturation for 3 min, followed by 34 cycles of 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 1 min, extension at 72 °C for 5 min, and storage at 4 °C. Part of the sample was purified using a kit (TianGen, catalog number: 04217), ligated into the pMD20-T vector (Takara, catalog number: AK4602), and transformed into DH5α competent cells. LB Amp +Plate culture medium (10g tryptone, 5g yeast extract, 10g NaCl, 1.5g agar, 1L deionized water) was used to incubate the culture medium at 37℃ for 16 hours. Positive clones were picked and transferred to 400μL LB Amp medium. + The culture was carried out in liquid medium at 37°C with shaking for 2 hours. Recombinants were detected by bacterial PCR and sequenced by BGI Genomics. Partial digestion with EcoRV enzyme was performed. A 10µL system containing 2µL PCR product, 0.3µL EcoRV enzyme, 1µL 10× Buffer, and 6.7µL sterile deionized water was mixed and incubated at 37°C for 1 hour. The digested products were detected by 3.0% agarose gel electrophoresis. The results are shown below. Figure 3 The electrophoresis diagram shown is as follows (A is the PCR stock solution, B is the enzyme digestion result). Sequencing results show that 1 and 4 are peach kernels, and 2, 3, 5, and 6 are wild peach kernels, consistent with the enzyme digestion results. Therefore, it can be seen that the primers and methods of this invention can quickly and accurately identify peach kernels and wild peach kernels.
[0035] The 2025 edition of the Chinese Pharmacopoeia defines peach kernels as flattened-oblong-ovoid, 1.2-1.8 cm long, 0.8-1.2 cm wide, and 0.2-0.4 cm thick. Wild peach kernels are oval-shaped, smaller and thicker, approximately 0.9 cm long, 0.7 cm wide, and 0.5 cm thick. Their shapes and sizes are very similar, and considering factors such as growth conditions and development, using these criteria to distinguish between peach kernels and wild peach kernels can lead to significant errors. This invention, however, distinguishes between peach kernels and wild peach kernels from a genetic perspective, offering advantages such as high accuracy and less time required.
[0036] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.
Claims
1. A primer for distinguishing between peach kernels and wild peach kernels, characterized in that: The primers include primer petA-F and primer psbJ-R, the gene sequence of primer petA-F is SEQ ID NO.1, and the gene sequence of primer psbJ-R is SEQ ID NO.
2.
2. The application of the primers as described in claim 1 in the identification of peach kernels and wild peach kernels.
3. The method for identifying peach kernels and wild peach kernels using the primers as described in claim 1, characterized in that: The method uses site-specific PCR technology to select primers, and then uses the different sites to design restriction endonucleases, and uses the enzyme digestion method to distinguish between peach kernels and wild peach kernels.
4. The method according to claim 3, characterized in that: Includes the following steps: Genome samples were randomly taken from peach kernels, and the genome was extracted as a template. After PCR amplification and purification, the genome was ligated into the pMD20-T vector and transformed into DH5α competent cells. LB Amp + Incubate the culture medium in a plate at 37°C for 16 hours, then pick positive clones and transfer them to 400 μL of LB Amp. + The culture was carried out in liquid medium at 37°C with shaking for 2 hours. The recombinants were detected by bacterial PCR and then sequenced. The recombinants were digested with EcoRV enzyme. Each 10µL digestion system contained 2µL of PCR product, 0.3µL of EcoRV enzyme, 1µL of 10× Buffer, and 6.7µL of sterile deionized water. The mixture was incubated at 37°C for 1 hour. The digestion products were detected by 3.0% agarose gel electrophoresis. Peach kernels had no digestion sites, and the digestion products remained unchanged. Wild peach kernels were digested into two fragments by EcoRV enzyme.
5. The method according to claim 4, characterized in that: For PCR amplification, each 10 µL amplification volume contains 1 U·µL. -1 Add 5 µL of Genstar polymerase, 0.2 µL each of upstream and downstream primers (petA-F and psbJ-R), 0.3 µL of template DNA, and sterile deionized water to a total volume of 10 µL.
6. The method according to claim 4, characterized in that: The PCR amplification conditions were as follows: pre-denaturation at 94℃ for 3 min, followed by 34 cycles of 94℃ for 30 s, 57℃ for 30 s, and 72℃ for 1 min, extension at 72℃ for 5 min, and storage at 4℃.
7. The method according to any one of claims 4 to 6, characterized in that: 1L of LB Amp + The formula for plate culture medium is: 10g tryptone, 5g yeast extract, 10g NaCl, 1.5g agar, and 1L of deionized water. 1L of LB Amp + The liquid culture medium formula is: 10g tryptone, 5g yeast extract, and 10g NaCl, prepared with deionized water to a volume of 1L.