SNP (Single Nucleotide Polymorphism) molecular marker related to chili fruit orientation, primer group and application of SNP molecular marker
By detecting SNP molecular markers of mutant bases A or G at specific sites in the pepper genome and combining them with KASP technology, the problem of low efficiency in improving fruit orientation traits in traditional pepper breeding has been solved, enabling rapid and accurate breeding identification and large-scale molecular marker-assisted breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HAINAN RES INST OF ZHEJIANG UNIV
- Filing Date
- 2026-04-14
- Publication Date
- 2026-05-12
AI Technical Summary
In traditional pepper breeding, the improvement of fruit orientation traits relies on phenotypic observation, which is time-consuming, inefficient, highly susceptible to environmental interference, and lacks efficient molecular marker-assisted selection technology.
We developed an SNP molecular marker located at 39,737,290th base on chromosome 12 of the chili genome (CNA0036143 version). By detecting mutated bases A or G, we used KASP molecular marker technology to genotype the orientation of chili fruits and provided specific primer sets and kits for rapid and accurate breeding identification.
It significantly shortens the breeding cycle, improves breeding efficiency, overcomes the long cycle and environmental dependence of traditional methods, and enables rapid identification at the seedling stage and large-scale molecular marker-assisted breeding.
Smart Images

Figure CN122012804A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology detection technology, and in particular relates to an SNP molecular marker, primer set and its application related to the orientation of pepper fruit. Background Technology
[0002] Chili peppers (Capsicum spp.) are an important economic crop widely cultivated and consumed globally, and the morphological characteristics of their fruits directly affect key factors such as yield, quality, and market value. Among these characteristics, the orientation of the chili pepper fruit is a crucial trait. Generally, chili pepper fruits can be categorized into several types, including upward, downward, and horizontal. Different orientations result in variations in the adaptability of chili peppers to light and ventilation conditions during growth and development, thus influencing quality indicators such as fruit growth rate, size, shape, and color. For example, chili pepper varieties with upward-growing fruits, when densely planted, receive more sunlight, which is beneficial for pigment synthesis and results in more vibrant fruit color. However, this can also increase the risk of sunburn due to excessive sun exposure. Conversely, varieties with downward-growing fruits are more advantageous in terms of shade and rain protection, helping to reduce the incidence of fruit diseases, but may to some extent affect the photosynthetic efficiency and dry matter accumulation.
[0003] In traditional chili pepper breeding practices, the improvement of fruit orientation mainly relies on phenotypic observation and artificial selection, which is time-consuming, inefficient, and highly susceptible to environmental interference. With the rapid development of molecular biology techniques, especially the application of marker-assisted selection (MAS) in crop breeding, new opportunities have emerged for the precise improvement of chili pepper fruit orientation. KASP (Kompetitive Allele Specific PCR) molecular markers, as an emerging high-throughput, low-cost, and high-precision molecular marker technology, have shown great potential in plant gene mapping, variety identification, and genetic improvement in recent years. By designing specific primers, it precisely detects target genes or DNA sequences closely linked to the target trait, enabling rapid and accurate screening of individuals with the desired fruit orientation trait at the seed or seedling stage. This significantly shortens the breeding cycle, improves breeding efficiency, and provides strong technical support for cultivating new chili pepper varieties that meet market demands. However, current research on KASP molecular markers for chili pepper fruit orientation is relatively limited. Developing efficient and stable KASP molecular markers is of significant practical importance and has broad application prospects for advancing the molecular breeding process of chili pepper fruit orientation. Summary of the Invention
[0004] In view of this, the purpose of this invention is to provide an SNP molecular marker, primer set, and its application related to the orientation of pepper fruits. By detecting the 39,737,290th base on chromosome 12 of the pepper genome version CNA0036143, and finding that the mutated base is A or G, the genotyping of pepper fruits with orientation can be achieved. Pepper plants with genotype AA have fruits facing upwards, while pepper plants with genotype AG or GG have fruits facing downwards. Through genotyping analysis, plants with specific fruit orientations can be obtained and molecular breeding can be carried out.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a SNP molecular marker related to the orientation of chili pepper fruits. The SNP molecular marker is located at the 39,737,290th base on chromosome 12 of the chili pepper genome version CNA0036143. The mutated base is A or G. When the genotype is AA, the chili pepper fruits face downward; when the genotype is GG or AG, the chili pepper fruits face upward.
[0006] The present invention provides a primer set for detecting the SNP molecular marker genotype, the sequence of which is shown in SEQ ID NO.3~5.
[0007] Preferably, the primer sequence SEQ ID NO.3 is the forward primer sequence F1 targeting the A allele, SEQ ID NO.4 is the forward primer sequence F2 targeting the G allele, and SEQ ID NO.5 is the reverse primer sequence.
[0008] Preferably, all forward primers are linked to a fluorescent label, which is either FAM or HEX.
[0009] The present invention provides a kit for identifying the orientation of chili pepper fruits, the kit comprising the aforementioned primer set.
[0010] Preferably, the kit also includes a premixed system for PCR amplification.
[0011] The present invention also provides the application of the primer set or the kit described herein in detecting the orientation of pepper fruits.
[0012] Preferably, the application includes the following steps: (1) Extracting genomic DNA from chili peppers; (2) Use the primer set or the kit to perform PCR amplification on the genomic DNA obtained in step (1) to obtain PCR amplification products; (3) Perform genotyping detection on the PCR amplification products obtained in step (2). The genotype is AA, AG or GG. For plants with genotype AA, the pepper fruit is facing down; for plants with genotype AG or GG, the pepper fruit is facing up.
[0013] Preferably, the PCR amplification system, in 10 μL, comprises the following components: 5 μL of FLU-ARMS 2×PCR Mix, 0.1 μL of 10 μM forward primer sequence F1, 0.1 μL of 10 μM forward primer sequence F2, 0.3 μL of 10 μM reverse primer sequence, 20-50 ng of genomic DNA, and ddH2O to bring the total to 10 μL. The PCR amplification program is as follows: 94℃ hot start for 15 min; 10 Touchdown cycles; 94℃ for 20 s, 57℃ for 60 s, for a total of 25 cycles; 37℃ for 60 s signal reading; wherein the Touchdown cycle is 94℃ for 20 s, 61℃~55.6℃ for 60 s, with a decrease of 0.6℃ per cycle.
[0014] The present invention also provides the application of the primer set or the kit in pepper breeding.
[0015] Compared with the prior art, the present invention has the following beneficial effects: The SNP molecular marker provided by the present invention is closely related to the orientation trait of pepper fruit. The KASP detection method based on this marker is efficient and accurate, and can realize rapid identification in the seedling stage, significantly improving the efficiency of breeding selection. The method is simple to operate, has high throughput and good stability, and effectively overcomes the defects of traditional phenotypic identification, such as long cycle and susceptibility to environmental influence. It is suitable for large-scale molecular marker-assisted breeding. Attached Figure Description
[0016] Figure 1 This is a schematic diagram of a typical phenotype of chili fruit orientation according to an embodiment of the present invention, wherein a is a schematic diagram of fruit facing downwards and b is a schematic diagram of fruit facing upwards; Figure 2 This is a QTL localization map based on BSA mixed-cell grouping analysis. Figure 3 The image shows a fluorescence scatter plot of SNP site KASP molecular marker genotyping; in the image, blue clusters represent genotype AA, corresponding to pepper fruit facing down; green clusters represent genotype GG, corresponding to pepper fruit facing up; and red clusters represent genotype AG, corresponding to pepper fruit facing up. Detailed Implementation
[0017] This invention provides a SNP molecular marker related to the orientation of chili pepper fruits. The SNP molecular marker is located at the 39,737,290th base on chromosome 12 of the chili pepper genome version CNA0036143. The mutated base is A or G. When the genotype is AA, the chili pepper fruits face downward; when the genotype is GG or AG, the chili pepper fruits face upward.
[0018] This invention provides a primer set for detecting the SNP molecular marker genotype, the sequences of which are shown in SEQ ID NO.3~5, as follows: SEQ ID NO.3: GAAGGTGACCAAGTTCATGCTATGTGCGGAAATCAGTACGA; SEQ ID NO.4: GAAGGTCGGAGTCAACGGATTATGTGCGGAAATCAGTACGG; SEQ ID NO. 5: TGACCCCATCACATAGCAAA.
[0019] In this invention, the primer sequence SEQ ID NO.3 is the forward primer sequence F1 targeting the A allele, SEQ ID NO.4 is the forward primer sequence F2 targeting the G allele, and SEQ ID NO.5 is the reverse primer sequence.
[0020] In this invention, all forward primers are linked to fluorescent labels, which are either FAM or HEX. Preferably, the fluorescent label for SEQ ID NO.3 is FAM and the fluorescent label for SEQ ID NO.4 is HEX.
[0021] The present invention provides a kit for identifying the orientation of chili pepper fruits, the kit comprising the aforementioned primer set.
[0022] In this invention, the kit further includes a premixed system for PCR amplification, wherein the premixed system for PCR amplification is preferably FLU-ARMS 2×PCR Mix.
[0023] The present invention also provides the application of the primer set or the kit described herein in detecting the orientation of pepper fruits.
[0024] In this invention, the application includes the following steps: (1) Extracting genomic DNA from chili peppers; (2) Use the primer set or the kit to perform PCR amplification on the genomic DNA obtained in step (1) to obtain PCR amplification products; (3) Perform genotyping detection on the PCR amplification products obtained in step (2). The genotype is AA, AG or GG. For plants with genotype AA, the pepper fruit is facing down; for plants with genotype AG or GG, the pepper fruit is facing up.
[0025] In this invention, the PCR amplification system, in 10 μL, comprises the following components: 5 μL of FLU-ARMS 2×PCR Mix, 0.1 μL of 10 μM forward primer sequence F1, 0.1 μL of 10 μM forward primer sequence F2, 0.3 μL of 10 μM reverse primer sequence, 20-50 ng of genomic DNA, and ddH2O to bring the total to 10 μL; The PCR amplification program is as follows: 94℃ hot start for 15 min; 10 Touchdown cycles; 94℃ for 20 s, 57℃ for 60 s, for a total of 25 cycles; 37℃ for 60 s signal reading; wherein the Touchdown cycle is 94℃ for 20 s, 61℃~55.6℃ for 60 s, with a decrease of 0.6℃ per cycle.
[0026] The present invention also provides the application of the primer set or the kit in pepper breeding.
[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0028] Example 1: Acquisition of SNPs Highly Associated with Pepper Fruit Orientation
[0029] (1) Construction of F2 segregating populations with pepper fruits facing upwards and downwards
[0030] Using C60 (fruits facing upwards) as the male parent and D41 (fruits facing downwards) as the female parent, hybridization was performed to obtain F1. The F1 generation was then further self-crossed to construct the F2 population with varying fruit orientations. The fruit orientations of the parents are as follows: Figure 1 As shown in the figure. Statistical results of the F1 and F2 phenotypes indicate that fruit facing downwards is a recessive trait.
[0031] (2) QTL (Quantitative Trait Locus) mapping and molecular marker development
[0032] The fruit branch types of the F2 population were identified, and 50 plants with fruit facing upwards and 50 plants with fruit facing downwards were selected. High-quality DNA was extracted, and two extreme pools were constructed for library preparation and sequencing. QTL mapping was performed using BSA-Seq (Bulked Segregant Analysis-Sequencing). Specifically, the delta-SNP index algorithm was used to locate QTL loci associated with the target trait. The mapping results are analyzed as follows: Figure 2 As shown, its physical location is on chromosome Ca_59Chr12 of chili pepper genome version number CNA0036143, from 31328554bp to 41951743bp. Further, linkage molecular markers associated with this QTL were developed, wherein the nucleotide at position 39737290 on chromosome Ca_59Chr12 is G when the chili pepper fruit is facing upwards, and A when the chili pepper fruit is facing downwards.
[0033] Example 2: Verification of fruit orientation phenotype using SNP genotypes in natural population materials
[0034] PCR amplification was performed on the Chr12: 39737290 site of 6 fruit-downward and 14 fruit-upward pepper inbred lines. The primer sequences used to amplify the region containing this SNP were: upstream primer sequence SEQ ID NO.1: CCGTTTCCACTGCTACTGAC, and downstream primer sequence SEQ ID NO.2: TTTCTCCTCTTGTGAACTGAATCT. The amplified fragment length was 301 bp. ApexHF DNA polymerase-CL reagent from Aikerui Biotechnology Co., Ltd. was used in a 50 μL reaction system, including 1 μL ApexHF HS DNA Polymerase CL and 25 μL 2×Apex HF CL Buffer (Mg 2+ The sample consisted of 1 μL template DNA, 1 μL each of 10 μM specific amplification primers (upstream and downstream primers), and water to a final volume of 50 μL. The amplification program was 94℃ pre-denaturation for 1 min, followed by 30 cycles: 98℃ for 10 sec; 55℃ for 15 sec; 68℃ for 15 sec. The PCR products were sent to Platinum Biotech (Hainan) Co., Ltd. for first-generation sequencing. The sequencing results are shown in Table 1.
[0035] Table 1 shows that the SNP locus was A in 6 samples with fruit facing down, and G in 14 samples with fruit facing up. This indicates that locus A is highly associated with the downward-facing phenotype, and locus G is highly associated with the upward-facing phenotype.
[0036] Table 1. Statistics on the orientation of chili pepper fruits
[0037] Example 3: Development and Validation of SNP-Based KASP Detection Primers
[0038] This refers to the specific SNP locus (A / G) at position 39737290 on chromosome 12 in version CNA0036143, and its flanking sequences (CCGTTTCCACTGCTACTGACCACTCCAAGGGAGAATGCGCAAAGGAAGGTAGATACAGGGAAGATTTGGGCAGATTTGGTGGAAGAAGAGCCAAACCCCAAACCATCGATGAGCAAATTGCAGATGTGGAGCAAAATCGTAGGGGGGATACAGGTGAAGAGGGATTCGAGCTGCAGAA). TAAATGTGCGGAAATCAGTACG[A / G]TAAAGATTACGATAGAGGATATACAAGAGGAGGTAAGTTTTTGGGAATCGGCAATATTTTGCTATGTGATGGGGTCAAATCTCTGTCAATTAGTAATGGAGGAATACTTCAATCGCATATGAAAAGGAAGGGGAATTGAAAGGGTAGCCCAAGTAAATAGAGGTGTCTTCCTTGTGAGATTCAGTTCACAAGAGGAGAAA (SEQ ID NO. 6), designed and validated KASP typing primers to achieve accurate detection. In primer design, the last base at the 3' end of the forward primer was complementary to the A and G alleles, respectively. The specific primer sequences are as follows: Primer F1 (targeting the A allele, FAM marker): 5'-GAAGGTGACCAAGTTCATGCTATGTGCGGAAATCAGTACGA-3' (SEQ ID NO.3); Primer F2 (targeting the G allele, HEX marker): 5'-GAAGGTCGGAGTCAACGGATTATGTGCGGAAATCAGTACGG-3' (SEQ ID NO.4); R (universal reverse primer): 5'-TGACCCCATCACATAGCAAA-3' (SEQ ID NO.5). All primers were purified by PAGE and synthesized by Platinum Biotech (Hainan) Co., Ltd.
[0039] Seventy-five samples with clear phenotypes and genotypes were randomly selected from the population in Example 1 (including 10 top-facing parents, 5 F1, 10 bottom-facing parents, and 50 bottom-facing F2 samples) for KASP genotyping to verify the SNP sites in Example 1. PCR reactions were performed using the KASP genotyping kit (FLU-ARMS for KASP 2× PCRMix) from Guangzhou Good Biotech Co., Ltd., according to the manufacturer's instructions. The reaction volume was 10 μL, containing 20–50 ng of genomic DNA template, 5 μL of FLU-ARMS 2×PCR Mix, 0.1 μL of 10 μM forward primer sequence F1, 0.1 μL of 10 μM forward primer sequence F2, and 0.30 μL of 10 μM reverse primer (R), brought to a final volume of 10 μL with ddH2O. The PCR program was as follows: a 94℃ hot start for 15 minutes, followed by 10 Touchdown cycles (94℃ for 20 seconds, 61℃~55.6℃ for 60 seconds, decreasing by 0.6℃ per cycle), then 25 cycles (94℃ for 20 seconds, 57℃ for 60 seconds), and finally signal reading at 37℃ for 60 seconds.
[0040] After PCR, the fluorescence endpoint signals of the FAM (485nm excitation / 520nm emission) and HEX (528nm excitation / 560nm emission) channels were read and the genotypes were determined on a Roche 480 real-time PCR instrument. The results are as follows: Figure 3 As shown.
[0041] Depend on Figure 3 It was found that the fluorescence signals of the samples were clearly divided into three clusters: AA genotype (blue cluster, 60 samples) with fruit facing down; GG genotype (green cluster, 10 samples) with fruit facing up; and AG genotype (red cluster, 5 samples) with fruit facing up. After comparison with the field phenotype, the detection method of this KASP marker showed extremely high identification accuracy and could accurately reflect the fruit orientation trait.
[0042] In summary, this invention provides an SNP variant that can distinguish the orientation of chili pepper fruits. This variant can be identified in multiple chili pepper varieties and exhibits high conservation. It can be developed into a molecular marker for rapidly, accurately, and reliably differentiating the orientation type of chili pepper fruit development. This invention also provides detection primers and a detection kit for this variant, which has a positive effect on molecular-assisted breeding of chili peppers with different fruit orientation types.
[0043] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A SNP molecular marker associated with the orientation of chili pepper fruits, characterized in that, The SNP molecular marker is located at the 39,737,290th base on chromosome 12 of the CNA0036143 version of the pepper genome. The mutated base is A or G. When the genotype is AA, the pepper fruit faces downward; when the genotype is GG or AG, the pepper fruit faces upward.
2. A primer set for detecting the SNP molecular marker genotype of claim 1, characterized in that, The sequences of the primer set are shown in SEQ ID NO.3~5.
3. The primer set according to claim 2, characterized in that, The primer sequence SEQ ID NO.3 is the forward primer sequence F1 targeting the A allele, SEQ ID NO.4 is the forward primer sequence F2 targeting the G allele, and SEQ ID NO.5 is the reverse primer sequence.
4. The primer set according to claim 3, characterized in that, All forward primers are linked to fluorescent labels, which are either FAM or HEX.
5. A kit for identifying the orientation of chili pepper fruits, characterized in that, The kit comprises the primer set as described in any one of claims 2 to 4.
6. The reagent kit according to claim 5, characterized in that, The kit also includes a premixed system for PCR amplification.
7. The application of the primer set according to any one of claims 2 to 4 or the kit according to any one of claims 5 to 6 in detecting the orientation of pepper fruits.
8. The application according to claim 7, characterized in that, The application includes the following steps: (1) Extracting genomic DNA from chili peppers; (2) Using the primer set according to any one of claims 2 to 4 or the kit according to any one of claims 5 to 6, the genomic DNA obtained in step (1) is amplified by PCR to obtain PCR amplification products; (3) Perform genotyping detection on the PCR amplification products obtained in step (2). The genotype is AA, AG or GG. For plants with genotype AA, the pepper fruit is facing down; for plants with genotype AG or GG, the pepper fruit is facing up.
9. The application according to claim 8, characterized in that, The PCR amplification system, in 10 μL, includes the following components: 5 μL of FLU-ARMS 2×PCR Mix, 0.1 μL of 10 μM forward primer sequence F1, 0.1 μL of 10 μM forward primer sequence F2, 0.3 μL of 10 μM reverse primer sequence, 20-50 ng of genomic DNA, and ddH2O to bring the total to 10 μL. The PCR amplification program is as follows: 94℃ hot start for 15 min; 10 Touchdown cycles; 94℃ for 20 s, 57℃ for 60 s, for a total of 25 cycles; 37℃ for 60 s signal reading; wherein the Touchdown cycle is 94℃ for 20 s, 61℃~55.6℃ for 60 s, with a decrease of 0.6℃ per cycle.
10. The application of the primer set according to any one of claims 2 to 4 or the kit according to any one of claims 5 to 6 in pepper breeding.