Escherichia coli with high RNA content as well as construction method and application thereof
By introducing recombinant plasmids containing expression elements consisting of strong promoters and rDNA into E. coli, the RNA yield of E. coli was increased, solving the problem of insufficient RNA production and achieving efficient RNA production capacity.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- OCEAN UNIV OF CHINA
- Filing Date
- 2026-03-03
- Publication Date
- 2026-05-15
AI Technical Summary
The low RNA content in existing technologies of microorganisms or biological tissues limits RNA production capacity, resulting in insufficient RNA yield and a narrow range of applications.
To construct a high RNA-content Escherichia coli strain, recombinant plasmids containing expression elements consisting of a strong promoter, rDNA, and terminator were introduced into the E. coli strains. The rRNA coding sequence in the rrnB operon was preferred, and the strains were overexpressed using a multi-copy plasmid. Combined with optimized fermentation medium and RNA extraction conditions, RNA yield was increased.
It significantly increased the RNA yield of Escherichia coli, with the RNA content of many strains increasing by more than 50%, solving the problem of insufficient RNA production and laying the foundation for large-scale industrial production.
Smart Images
Figure CN122038255A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically relating to a high RNA content Escherichia coli, its construction method, and its application. Background Technology
[0002] Nucleic acids are one of the most important components of cells. Based on their structure, they can be divided into macromolecular nucleic acids, oligonucleotides, mononucleotides, and nucleotide derivatives, and are widely used in scientific research, medicine, health products, and feed (Ying Guoqing, Guangzhou Food Industry Technology, 2004, (02):126-128+125). One of the main uses of RNA is the production of mononucleotides, which can then be used to synthesize oligonucleotides and nucleoside derivatives. Therefore, RNA is of great significance as a raw material for the production of various nucleic acid substances, and its low-cost, large-scale production is of great importance.
[0003] RNA-rich microorganisms or biological tissues are commonly used raw materials for RNA production. For example, Chinese patent CN1389568A discloses a method for producing ribonucleic acid using microorganisms from monosodium glutamate (MSG) fermentation waste liquid. The RNA content of the microorganisms is about 7.5%, the extraction rate is about 50%, and the yield is 2.7%~3.3%. Patents CN101759739A and CN1302613A extract RNA from animal liver and pancreas, respectively, with yields of 0.8 g / kg liver and 3.0~4.8 g / kg pancreas. The most common method is to extract RNA from yeast. The RNA content of yeast is about 3%~15%. Patent CN108220280A extracts RNA from yeast with an extraction rate of about 70%, equivalent to a yield of 2.1~10.5 g / kg dry yeast. In addition, patents CN1169434A and CN1117972A also studied the extraction of RNA from natural foods or natural plants, such as legumes, sorghum, wheat, and corn, but the yield was relatively low.
[0004] In the aforementioned existing technologies, the RNA content of monosodium glutamate (MSG) cells is typically around 7.5%, and the RNA content of yeast cells is only 3% to 15%. Therefore, it can be seen that the RNA content of microorganisms or biological tissues has become a key factor limiting RNA production capacity. Some researchers have used methods such as traditional mutagenesis (China Brewing, 2016, 35(12): 66–71), atmospheric and room temperature plasma mutagenesis (ARTP) (Food, 2022, 11(18): 2742), and genetic engineering (Applied Microbiology and Biotechnology, 2020, 104(18): 1–13) to increase the RNA content in yeast. Chinese patent CN113881581A discloses a high-RNA yeast strain of Saccharomyces cerevisiae, which was obtained through ARTP mutagenesis, but its RNA content was only 15.8% at its highest. Furthermore, in actual production, high-density, long-term fermentation is used to ensure yield, but the final yeast RNA content can only be maintained at 6%~10%, resulting in insufficient RNA production and thus narrowing the application range of RNA products (Journal of Ocean University of China (Natural Science Edition), 2019, 49(10): 64–78). Therefore, increasing the RNA content of microorganisms and developing high-RNA-producing microbial strains are urgent problems to be solved. Summary of the Invention
[0005] To address the problems of slow growth of production strains, low nucleic acid content, and limited nucleic acid production capacity in existing nucleic acid production methods, this invention proposes a high RNA content Escherichia coli, its construction method, and its application. This construction method can simply and efficiently increase the nucleic acid content of Escherichia coli, is low in cost, highly operable, and suitable for large-scale industrial production.
[0006] The technical solution of this invention is:
[0007] This invention provides a high RNA content *E. coli* strain, which is an *E. coli* strain with introduced recombinant plasmid. The recombinant plasmid contains an expression element consisting of a strong promoter, rDNA, and a terminator. The rDNA is an rRNA coding sequence derived from an *E. coli* rDNA operon. The rDNA operon is selected from one or more of rrnA, rrnB, rrnC, rrnD, rrnE, rrnG, and rrnH, and the rRNA coding sequence includes 16S rDNA, 23S rDNA, and 5S rDNA corresponding to the operon.
[0008] Preferably, the rDNA is derived from the rrnB operon, which includes E. coli 16S rDNA rrsB (Gene ID: 948466), 23S rDNA rrlB (Gene ID: 948473), and 5S rDNA rrfB (Gene ID: 948471).
[0009] Furthermore, the strong promoter includes the T7 promoter, lac promoter, trc promoter, tac promoter, trp promoter, PlacUV5 promoter, PBAD promoter, recA promoter, groESL promoter, pL / pR promoter, and J23119 promoter. Preferably, the strong promoter is the T7 promoter or the trc promoter.
[0010] In this invention, a constitutive promoter can be used to overexpress rDNA, and if a constitutive promoter is used, IPTG induction is not required during culture.
[0011] Furthermore, the terminator includes the rrnB T1 terminator, rrnB T2 terminator, T7 terminator, Hisoperon terminator, trpA terminator, E. coli thr operator T1 terminator, and TrrnC terminator. Preferably, the terminator is the rrnB T1 / T2 terminator or the T7 terminator.
[0012] In this invention, transcription can be terminated using one or more terminators.
[0013] Furthermore, the plasmid is a multi-copy plasmid, that is, the plasmid is an expression plasmid having at least 10 copies in Escherichia coli.
[0014] Furthermore, the plasmid is selected from one or more of pTrc99a, pET28a, pET28b, and pCDFDuet.
[0015] In this invention, one or more plasmids can be transformed into E. coli, and transforming multiple plasmids can achieve a better effect in increasing RNA content.
[0016] Furthermore, the *Escherichia coli* strain is selected from one or more of NCM3722, MG1655, DH5α, Nissle 1917, BL21(DE3), W3110, or their derivative strains.
[0017] The present invention also provides a method for constructing the high RNA content Escherichia coli, the method comprising: replacing the promoter of the Escherichia coli rDNA itself with a strong promoter to construct an expression element of "strong promoter + rDNA + terminator", and transferring the expression element into Escherichia coli using a plasmid as a vector to obtain an engineered Escherichia coli strain containing a recombinant plasmid.
[0018] The present invention further provides the application of the high RNA content Escherichia coli described in any of the above-mentioned claims, or the high RNA content Escherichia coli obtained by the above-described construction method, in RNA production.
[0019] Furthermore, the application includes the following steps:
[0020] (1) The engineered Escherichia coli containing the expression elements of “strong promoter + rDNA + terminator” was cultured to obtain seed culture, and then inoculated into fermentation medium to obtain fermentation culture. IPTG was added to a final concentration of 0.2~2 mmol / L to induce fermentation, and the culture was continued for a period of time. The cells were collected by centrifugation to obtain Escherichia coli cells with high RNA production.
[0021] (2) Prepare a bacterial suspension with a bacterial dry weight of 5% to 10%, then add sodium hydroxide for treatment, then add hydrochloric acid to neutralize to pH 6 to 8, centrifuge and take the supernatant; add 0.1% to 1% of bacterial dry weight of protease to the supernatant for treatment to inactivate the enzyme, centrifuge and take the supernatant; adjust the pH of the supernatant to 2 to 2.5, then add ethanol to fully precipitate the RNA, centrifuge, dry and pulverize to obtain RNA powder.
[0022] Furthermore, the amount of cell accumulation can be increased by optimizing the composition of the fermentation medium and the fermentation conditions, thereby further increasing RNA production. Optimizing the composition of the fermentation medium can be achieved by increasing the nutrient content and supplementing the feed.
[0023] Furthermore, optimizing fermentation conditions can be achieved by using fermentation tanks, extending fermentation time, increasing stirring speed, and increasing dissolved oxygen levels.
[0024] Furthermore, RNA yield can be further increased by optimizing RNA extraction conditions; among which, conventional concentrated salt extraction or dilute alkali extraction methods can be selected.
[0025] Furthermore, the protease can be an alkaline protease, a neutral protease, papain, bromelain, etc., and can be used alone or in combination.
[0026] The beneficial effects of this invention are:
[0027] (1) The method for constructing high-RNA-producing Escherichia coli proposed in this invention can significantly increase the RNA yield of multiple strains of Escherichia coli during the rapid growth phase and the plateau phase. After verification by shake-flask fermentation, the RNA content of strains overexpressing rrnB, NCM3722, MG1655, DH5α, Nissle 1917 and BL21(DE3), all increased by more than 50%.
[0028] Overexpression of the operon rrnB of Escherichia coli ribosomal RNA in the above five commonly used Escherichia coli strains showed that the growth rate of the constructed Escherichia coli strain was not affected compared with the parent strain. After shake-flask fermentation, the nucleic acid content of the selected strain reached up to 30.27%, while the nucleic acid content of the parent strain was 16.29%, which was 85.80% higher than that of the parent strain.
[0029] (2) The method for constructing high-RNA-producing Escherichia coli proposed in this invention can keep the nucleic acid content of multiple strains of Escherichia coli stable at more than 25% during the plateau phase, and has no significant impact on bacterial growth and bacterial accumulation, thereby greatly increasing the total nucleic acid yield that can be obtained per unit of culture medium, which is beneficial to the industrial production of RNA.
[0030] (3) The method of the present invention can significantly increase the RNA content of Escherichia coli. When the high-RNA-producing Escherichia coli constructed and selected is used to produce RNA, its RNA yield is significantly higher than that of the initial Escherichia coli strain and the yeast strain commonly used in RNA production. It can greatly improve RNA production capacity, which is of great significance for solving the current problem of insufficient nucleic acid production. It lays the foundation for achieving lower cost and larger scale production of nucleic acid, and thus expanding the application of nucleic acid. Attached Figure Description
[0031] Figure 1 This is a schematic diagram illustrating the mechanism by which the present invention increases the RNA content of Escherichia coli.
[0032] Figure 2 This is a diagram of the rrnB operon of Escherichia coli (including the P1 / P2 promoter); where P1 / P2 is the rDNA promoter of E. coli, and rrnB T1 / T2 terminator is the rDNA terminator of E. coli.
[0033] Figure 3 This is a map of the pTrc99a-rrnB plasmid; in it, the trc promoter is responsible for transcribing rRNA, the lac operator is the lactose operon, the lacI and lacIq promoters are the lactose gene and its promoter, respectively, ori is the origin of plasmid replication, and AmpR and AmpR promoters are the ampicillin resistance gene and its promoter, respectively.
[0034] Figure 4 (a) Growth curve and RNA content of pTrc99a-rrnB overexpression in NCM3722; (b) RNA content.
[0035] Figure 5(a) Growth curve and RNA content of pTrc99a-rrnB overexpression in MG1655; (b) RNA content.
[0036] Figure 6 Growth curve and RNA content of pTrc99a-rrnB overexpression in DH5α; (a) Growth curve; (b) RNA content.
[0037] Figure 7 Growth curves and RNA content of pTrc99a-rrnB overexpression in Nissle 1917; (a) growth curve; (b) RNA content.
[0038] Figure 8 This is a map of the pET28b-rrnB plasmid; in this model, the T7 promoter is responsible for transcribing rRNA, and the T7 terminator is responsible for terminating transcription.
[0039] Figure 9 (a) Growth curve and RNA content of pET28b-rrnB overexpression in BL21(DE3); (b) RNA content.
[0040] Figure 10 This is the pTrc99a-rrlB plasmid map.
[0041] Figure 11 Growth curve and RNA content of pTrc99a-rrlB overexpression in NCM3722; (a) growth curve; (b) RNA content.
[0042] Figure 12 The image shows the pTrc99a-rrsB plasmid.
[0043] Figure 13 Growth curve and RNA content of pTrc99a-rrsB overexpression in NCM3722; (a) growth curve; (b) RNA content. Detailed Implementation
[0044] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0045] Unless otherwise specified, the experimental methods in the following embodiments of the present invention are conventional methods, performed in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions; unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.
[0046] The primers used in this invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd., the genome extraction and plasmid extraction kits were purchased from Tiangen Biotech (Beijing) Co., Ltd., 2× Phanta Flash Master Mix was purchased from Novizan Biotechnology Co., Ltd., restriction endonucleases were purchased from Takara, 2× Enzymax UniversalCloneMix was purchased from Tolobio, competent cells were purchased from Qingke Biotechnology, 2× Taq PCR StarMix (Dye) was purchased from Kangrun Biotechnology, ampicillin, kanamycin and protease were purchased from Solarbio, yeast extract and peptone were purchased from Oxoid, and the remaining reagents were purchased from Sinopharm Chemical Reagent Co., Ltd.
[0047] like Figure 1 As shown, this invention provides a method for constructing an expression element that increases the RNA content of Escherichia coli. A strong promoter is used to replace the P1 / P2 promoter of the E. coli rDNA itself, constructing a "promoter + rDNA + terminator" expression element. This expression element is then transferred into E. coli using a plasmid as a vector, and the rRNA is overexpressed in E. coli to construct a high-RNA-producing E. coli engineered strain, thereby increasing the RNA content of E. coli.
[0048] The rrnB operon used in this invention refers to the region 4166491-4171756 in the Escherichia coli K12 MG1655 reference genome (NC_000913.3), the sequence of which is shown in SEQ ID NO.1. (See illustration below.) Figure 2 .
[0049] Example 1
[0050] Overexpression of rrnB with the trc promoter in E. coli NCM3722 to increase RNA yield
[0051] 1. Construct the recombinant plasmid pTrc99A-rrnB (pTrc99A itself contains the trc promoter)
[0052] Using the genome of Escherichia coli MG1655 as a template, primer WXW1-F ( :TTCGAGCTCGGTACCCGGGGATCCCGCTGAGAAAAAAGCGAAGCG) (SEQ ID NO:2) and WXW2-R ( The rrnB fragment, 5314 bp in length, was obtained by PCR amplification using the formula :TCATCCGCCAAAACAGCCAAGCTTATGCCTGGCAGTTCCCTACT (SEQ ID NO:3). Primers WXW1-F and WXW2-R were bound upstream and downstream of the rrnB operon, respectively, and contained homologous arms required for homologous recombination with plasmid pTrc99A.
[0053] The PCR amplification system consisted of: a total volume of 50 μL, 25 μL of 2× Phanta Flash Master Mix, 2 μL each of primers (2 μmol / L), 100 ng of template (MG1655 genome), and the remaining volume was made up with ddH2O. The amplification conditions were: 95℃ for 3 min; 95℃ for 15 sec; 56℃ for 15 sec; 72℃ for 2 min; 72℃ for 5 min; and 35 cycles.
[0054] The vector pTrc99A was digested with restriction endonucleases BamHI and HindIII to obtain a linear fragment. The digestion system consisted of: 10 μL total volume, 0.5 μL each of BamHI and HindIII, 1 μL of 10× Quickcut Buffer, 500 ng of plasmid, and the remaining volume was made up with ddH2O. The digestion conditions were 37℃ for 1 h.
[0055] The vector and target gene were ligated via homologous recombination to obtain the recombinant plasmid pTrc99A-rrnB. The homologous recombination ligation system consisted of: a total volume of 10 μL, 2 μL of 2× Enzymax Universal CloneMix, 100 ng of the amplified rrnB fragment, 50 ng of the pTrc99A fragment, and the remaining volume was made up with ddH2O. The incubation conditions were 55℃ for 2 h.
[0056] The heat shock transformation was performed as follows: 10 μL of ligation solution was added to 100 μL of competent *E. coli* DH5α cells, gently mixed, and incubated on ice for 30 min. The cells were then heat-shocked at 42°C for 1 min, immediately placed on ice for 3 min, and then 1 mL of SOB medium (20 g / L peptone, 5 g / L yeast extract, 0.5 g / L sodium chloride, 0.19 g / L potassium chloride, 2.03 g / L magnesium chloride, 2.45 g / L magnesium sulfate) was added. The cells were then recovered at 37°C and 220 rpm for 1 h, centrifuged at 8000 rpm for 1 min, and the bacterial culture was plated on LB agar plates containing 100 mg / L ampicillin (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 20 g / L agar) and incubated at 37°C for 12 h.
[0057] Transformants were picked and cultured in 5 mL of LB medium containing ampicillin (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride) at 37°C and 220 rpm for 8 h. The cells were collected by centrifugation, and the plasmid pTrc99A-rrnB was extracted using a plasmid extraction kit. The constructed pTrc99A-rrnB plasmid map is shown below. Figure 3 .
[0058] 2. The recombinant plasmid pTrc99A-rrnB was transformed into Escherichia coli NCM3722.
[0059] 100 ng of plasmid pTrc99A-rrnB was added to 100 μL of competent Escherichia coli NCM3722 and transformed using the heat shock method. The transformed bacterial culture was plated on LB agar plates containing ampicillin and incubated at 37°C for 12 h. After single colonies grew, single clones were picked to obtain the Escherichia coli strain NCM3722 pTrc99A-rrnB that overexpresses rrnB using the trc promoter.
[0060] 3. Cultivate
[0061] Wild-type NCM3722, NCM3722 pTrc99A (NCM3722 containing the empty plasmid pTrc99A), and NCM3722pTrc99A-rrnB were inoculated into 5 mL of TB medium (12 g / L peptone, 24 g / L yeast extract, 9.4 g / L dipotassium hydrogen phosphate, 2.2 g / L potassium dihydrogen phosphate, 8 mL / L glycerol, pH 6.8), respectively. The medium for NCM3722 pTrc99A and NCM3722pTrc99A-rrnB was further supplemented with ampicillin to a final concentration of 100 mg / L. After overnight incubation at 37°C and 220 rpm, the cultures were inoculated into 100 mL of TB medium containing ampicillin for fermentation. The initial OD was... 600 The concentration was 0.04, and the culture was carried out at 37°C and 220 rpm until the OD reached 0.04. 600 IPTG (final concentration 1 mM) was added when the concentration was 0.6 to induce expression, and the culture conditions were changed to 25℃ and 180 rpm.
[0062] 4. Growth curve determination
[0063] Samples were taken at 3 h, 6 h, 9 h, and 24 h after induction culture, and their OD values were measured. 600 To plot the growth curve, the results are as follows: Figure 4 As shown in (a). It can be seen from 4(a) that the growth rates of the three are basically the same, with no obvious difference.
[0064] 4. RNA content determination
[0065] Take 10 mL of fermentation broth at 3 h, 6 h, 9 h, and 24 h of induction culture (three parallel samples for each sample), centrifuge to collect bacterial cells, transfer the cells to a pre-weighed 1.5 mL centrifuge tube (empty tube mass m1), freeze-dry, and measure the total mass m2 of the centrifuge tube and bacterial cells. Then add 1 mL of perchloric acid (0.5 mol / L), resuspend thoroughly, and incubate in a 72℃ water bath for 15 min, shaking to mix every 2-3 min. After the water bath, centrifuge at 12000 rpm for 10 min, take 0.5 mL of the supernatant, and dilute to 50 mL with ddH2O. After mixing, measure the absorbance A at 260 nm using a UV / Vis spectrophotometer. 260 Use ddH2O as a blank. Record the absorbance, repeat the measurement three times, and take the average of the three measurements. Calculate the RNA content using the following formula:
[0066]
[0067] In the formula:
[0068] A 260 —Absorbance of the sample solution;
[0069] Dilution ratio—When operating according to this method, the dilution ratio is 100;
[0070] m2 — Total mass of tubes and freeze-dried bacterial cells, mg;
[0071] m1—mass of empty tube, mg;
[0072] 0.032 — The amount of RNA in the test solution, in mg / mL, corresponding to an absorbance of 1 at 260 nm.
[0073] 1—Volume of solution after adding 0.5 mol / L perchloric acid, in mL;
[0074] The measurement results are as follows Figure 4(b) shows that the RNA content of NCM3722 pTrc99A-rrnB was significantly higher than that of the wild type at 3 h, 6 h, 9 h, and 24 h. In particular, at 24 h of culture, the RNA content of NCM3722 pTrc99A-rrnB reached 28.13%, which was 85.83% higher than that of wild-type NCM3722 (RNA content 15.14%). In addition, the RNA content of NCM3722 and NCM3722 pTrc99A decreased significantly with increasing culture time. In contrast, the RNA content of NCM3722 pTrc99A-rrnB remained stable at a high level, between 26% and 30% from 3 h to 24 h. Even when the growth plateau was reached, the RNA content could still be maintained above 28%. Therefore, overexpression of rrnB using the trc promoter in Escherichia coli NCM3722 can increase RNA content by 85.83% without affecting bacterial growth.
[0075] 5. RNA extraction
[0076] (1) Cell disruption: Take 10 g (equivalent to 2.5 g dry weight) of wet Escherichia coli NCM3722 or NCM3722 pTrc99A-rrnB cultured for 24 h, add 20 mL of water to completely resuspend, then add 1.25 mL of sodium hydroxide (6 mol / L) and mix thoroughly. React at room temperature (22℃) for 30 min, shaking continuously during the reaction. After the reaction, add 6 mol / L HCl to adjust the pH to 7.0, centrifuge and collect the supernatant, resuspend the precipitate in water, centrifuge again and collect the supernatant, combine the supernatants to obtain supernatant 1.
[0077] (2) Protease treatment: Add 0.05 g of alkaline protease to supernatant 1, treat at 50℃ for 1 h, then treat at 90℃ for 10 min to inactivate the enzyme, centrifuge and take the supernatant to obtain supernatant 2;
[0078] (3) RNA precipitation: Adjust the pH of supernatant 2 to 2~2.5 with phosphate, then add ethanol (final concentration 50%), and let stand at 4℃ or -20℃ for 0.5~2 h to allow RNA to precipitate fully. Centrifuge to obtain RNA precipitate, dry the precipitate, and pulverize to obtain RNA powder.
[0079] The RNA content was weighed and determined. The RNA powder extracted from the engineered E. coli strain NCM3722 pTrc99A-rrnB weighed 0.688 g and contained 80.2% RNA, resulting in a net RNA weight of 0.552 g and an RNA yield of 0.221 g / g dry cells, significantly higher than that of yeast. In contrast, the RNA powder extracted from wild-type NCM3722 weighed 0.361 g and contained 79.1% RNA, resulting in a net RNA weight of 0.286 g and an RNA yield of 0.114 g / g dry cells. The RNA yield of NCM3722pTrc99A-rrnB was 93.9% higher.
[0080] Example 2
[0081] Overexpression of rrnB with the trc promoter in E. coli MG1655 to increase RNA yield
[0082] Following the method described in Example 1, plasmid pTrc99A-rrnB was constructed. Plasmids pTrc99A and pTrc99A-rrnB were transformed into Escherichia coli MG1655, respectively, to obtain MG1655 containing the empty plasmid pTrc99A (MG1655 pTrc99A) and MG1655 containing the plasmid pTrc99A-rrnB (MG1655 pTrc99A-rrnB), and then induced to grow.
[0083] The growth curves of MG1655, MG1655 pTrc99A, and MG1655 pTrc99A-rrnB were determined, and the results are as follows: Figure 5 As shown in (a), the growth rates of the three are basically the same, with no significant difference.
[0084] The RNA content of the three bacteria was measured, such as... Figure 5 As shown in (b), the RNA content of MG1655 pTrc99A-rrnB was significantly higher than that of the wild type at both 6 h and 24 h of culture. In particular, at 24 h of culture, the RNA content of MG1655 pTrc99A-rrnB reached 26.12%, which was 58.11% higher than that of wild-type MG1655 (RNA content 16.52%). Therefore, overexpression of rrnB in Escherichia coli NCM3722 can increase the RNA content by 58.11% without affecting cell growth.
[0085] RNA was extracted from *E. coli* MG1655 and MG1655 pTrc99A-rrnB cultured for 24 h according to the method in Example 1. The RNA content of the obtained RNA powder was weighed and determined. The RNA powder extracted from the engineered *E. coli* MG1655 pTrc99A-rrnB weighed 0.649 g, with an RNA content of 82.2%, resulting in a net RNA weight of 0.533 g and an RNA yield of 0.213 g / g dry bacterial cells. The RNA powder extracted from wild-type MG1655 weighed 0.384 g, with an RNA content of 79.6%, resulting in a net RNA weight of 0.306 g and an RNA yield of 0.122 g / g dry bacterial cells. In comparison, the RNA yield of MG1655 pTrc99A-rrnB was increased by 74.6%.
[0086] Example 3
[0087] Overexpression of rrnB with the trc promoter in E. coli DH5α to increase its RNA content
[0088] Following the method described in Example 1, plasmid pTrc99A-rrnB was constructed. Plasmids pTrc99A and pTrc99A-rrnB were transformed into Escherichia coli DH5α, respectively, to obtain DH5α containing the empty plasmid pTrc99A (DH5α pTrc99A) and DH5α containing the plasmid pTrc99A-rrnB (DH5α pTrc99A-rrnB), which were then induced and cultured.
[0089] The growth curves of DH5α, DH5α pTrc99A, and DH5α pTrc99A-rrnB were determined, and the results are as follows: Figure 6 As shown in (a), it can be seen that the growth rates of the three are basically the same and there is no obvious difference.
[0090] The RNA content of the three strains was measured, and the results are as follows: Figure 6 (b) shows that the RNA content of DH5α pTrc99A-rrnB was significantly higher than that of the wild type at 3 h, 6 h, 9 h, and 24 h. After 24 h of culture, the RNA content of DH5α pTrc99A-rrnB was 30.27%, which was 85.80% higher than that of wild-type DH5α (RNA content 16.29%). Therefore, overexpression of rrnB in E. coli DH5α can increase the RNA content by 85.8% without affecting the growth of the strain.
[0091] RNA was extracted from *E. coli* DH5α and DH5α pTrc99A-rrnB cultured for 24 h according to the method in Example 1. The RNA content of the obtained RNA powder was weighed and determined. The RNA powder extracted from the engineered *E. coli* strain DH5α pTrc99A-rrnB weighed 0.702 g, with an RNA content of 80.3%, resulting in a net RNA weight of 0.564 g and an RNA yield of 0.226 g / g dry bacterial cells. The RNA powder extracted from wild-type DH5α weighed 0.372 g, with an RNA content of 80.2%, resulting in a net RNA weight of 0.298 g and an RNA yield of 0.119 g / g dry bacterial cells. In comparison, the RNA yield of DH5α pTrc99A-rrnB was increased by 89.9%.
[0092] Example 4
[0093] In E. coli Nissle 1917, rrnB was overexpressed using the trc promoter to increase its RNA content.
[0094] Following the method described in Example 1, plasmid pTrc99A-rrnB was constructed. Plasmids pTrc99A and pTrc99A-rrnB were transformed into Escherichia coli Nissle 1917 (EcN) to obtain EcN containing the empty plasmid pTrc99A (EcNpTrc99A) and EcN containing the plasmid pTrc99A-rrnB (EcN pTrc99A-rrnB), and then induced to grow.
[0095] The growth curves of EcN, EcN pTrc99A, and EcN pTrc99A-rrnB were determined, and the results are as follows: Figure 7 As shown in (a), it can be seen that the growth rates of the three are basically the same and there is no obvious difference.
[0096] The RNA content of the three strains was measured, and the results are as follows: Figure 7 (b) shows that the RNA content of EcN pTrc99A-rrnB was significantly higher than that of the wild type at both 6 h and 24 h. At 24 h of culture, the RNA content of EcN pTrc99A-rrnB was 21.03%, which was 31.38% higher than that of wild-type EcN (RNA content 16.01%). Therefore, overexpression of rrnB in E. coli EcN can increase the RNA content by 31.38% without affecting the growth of the strain.
[0097] RNA was extracted from *E. coli* EcN and EcN pTrc99A-rrnB cultured for 24 h according to the method in Example 1. The RNA content of the obtained RNA powder was weighed and determined. The RNA powder extracted from the engineered *E. coli* EcN pTrc99A-rrnB weighed 0.482 g, with an RNA content of 80.5%, resulting in a net RNA weight of 0.388 g and an RNA yield of 0.155 g / g dry bacterial cells. The RNA powder extracted from wild-type EcN weighed 0.366 g, with an RNA content of 75.6%, resulting in a net RNA weight of 0.277 g and an RNA yield of 0.111 g / g dry bacterial cells. In comparison, the RNA yield of EcN pTrc99A-rrnB was increased by 39.6%.
[0098] Example 5
[0099] Overexpression of rrnB using the T7 promoter in E. coli BL21(DE3) to increase its RNA content
[0100] 1. Construct the recombinant plasmid pET28b-rrnB (pET28b itself contains the T7 promoter)
[0101] Using the genome of Escherichia coli MG1655 as a template, primer WXW3-F ( :CAGCAAATGGGTCGGGATCCCGCTGAGAAAAAAGCGAAGCG) (SEQ ID NO:4) and WXW4-R ( The rrnB fragment, 5306 bp in length, was obtained by PCR amplification using the formula TCGAGTGCGGCCGCAAGCTTATGCCTGGCAGTTCCCTACT (SEQ ID NO:5). Primers WXW3-F and WXW4-R were attached upstream and downstream of the rrnB operon, respectively, and contained homologous arms required for homologous recombination with plasmid pET28b. The vector pET28b was digested with restriction endonucleases BamHI and HindIII to obtain a linear fragment. The vector and the target gene were then ligated via homologous recombination to obtain the recombinant plasmid pET28b-rrnB. Detailed procedures are described in Example 1. The constructed pET28b-rrnB plasmid map is shown below. Figure 8 .
[0102] 2. The recombinant plasmid pET28b-rrnB was transformed into Escherichia coli BL21(DE3).
[0103] 100 ng of plasmid pET28b-rrnB was added to 100 μL of competent cells BL21(DE3) and transformed using the heat shock method. The bacterial culture was spread on LB agar plates containing 50 mg / L kanamycin and incubated at 37°C for 12 h. After single colonies grew, single clones were picked to obtain the Escherichia coli strain BL21(DE3) pET28b-rrnB that overexpresses rrnB using the T7 promoter.
[0104] 3. Cultivate
[0105] Wild-type BL21(DE3), BL21(DE3) pET28b (BL21(DE3) containing empty plasmid pET28b), and BL21(DE3)pET28b-rrnB were inoculated into 5 mL TB medium, respectively. The BL21(DE3) pET28b and BL21(DE3)pET28b-rrnB media were supplemented with kanamycin to a final concentration of 50 mg / L. After overnight incubation at 37°C and 220 rpm, the cultures were inoculated into 100 mL TB medium containing kanamycin for fermentation. The initial OD was... 600 The concentration was 0.04, and the culture was carried out at 37°C and 220 rpm until the OD value was reached. 600 IPTG (final concentration 0.5 mM) was added at a concentration of 0.6 to induce expression, and the culture conditions were changed to 25℃ and 180 rpm.
[0106] 4. Growth curve and RNA content determination
[0107] The growth curves of BL21(DE3), BL21(DE3)pET28b, and BL21(DE3)pET28b-rrnB were determined, and the results are as follows: Figure 9 As shown in (a), it can be seen that the growth rates of the three are basically the same and there is no obvious difference.
[0108] The RNA content of the three strains was measured, and the results are as follows: Figure 9 (b) shows that after 24 h of culture, the RNA content of BL21(DE3)pET28b-rrnB was 26.08%, which is 82.36% higher than that of wild-type BL21(DE3) (RNA content 14.30%). Therefore, overexpression of rrnB in E. coli BL21(DE3) can increase the RNA content by 82.36% without affecting the growth of the strain.
[0109] 5. RNA extraction
[0110] RNA was extracted from *E. coli* BL21(DE3) and BL21(DE3) pET28b-rrnB cultured for 24 h according to the method in Example 1. The RNA content of the obtained RNA powder was weighed and determined. The RNA powder extracted from the engineered *E. coli* BL21(DE3) pET28b-rrnB weighed 0.643 g, with an RNA content of 81.1%, resulting in a net RNA weight of 0.521 g and an RNA yield of 0.208 g / g dry bacterial cells. The RNA powder extracted from wild-type BL21(DE3) weighed 0.376 g, with an RNA content of 79.8%, resulting in a net RNA weight of 0.300 g and an RNA yield of 0.120 g / g dry bacterial cells. In comparison, the RNA yield of BL21(DE3) pET28b-rrnB was increased by 73.3%.
[0111] Example 6
[0112] Overexpression of 23S rRNA using the trc promoter in Escherichia coli NCM3722 to increase its RNA content
[0113] Construction of recombinant plasmid pTrc99A-rrlB (rrlB encodes E. coli 23S rRNA): Using the genome of E. coli MG1655 as a template, primers WXW5-F were used... :TTCGAGCTCGGTACCCGGGGATCCGGTTAAGCGACTAAGCGTAC) (SEQ ID NO:6) and WXW6-R ( The rrlB fragment, 2953 bp in length, was obtained by PCR amplification using the formula (SEQ ID NO: 7). Primers WXW5-F and WXW6-R were attached upstream and downstream of the rrlB gene, respectively, and contained homologous arms required for homologous recombination with plasmid pTrc99A. The vector pTrc99A was digested with restriction endonucleases BamHI and HindIII to obtain a linear fragment. The vector and the target gene were then ligated via homologous recombination to obtain the recombinant plasmid pTrc99A-rrlB. Detailed procedures are described in Example 1. The constructed pTrc99A-rrlB plasmid map is shown below. Figure 10 .
[0114] Following the method in Example 1, the recombinant plasmid pTrc99A-rrlB was transformed into Escherichia coli NCM3722 to obtain the Escherichia coli strain NCM3722 pTrc99A-rrlB that overexpresses rrlB using the trc promoter.
[0115] The growth curves of NCM3722, NCM3722 pTrc99A, and NCM3722 pTrc99A-rrlB were determined, and the results are as follows: Figure 11 As shown in (a), it can be seen that the growth rates of the three are basically the same and there is no obvious difference.
[0116] The RNA content of the three strains was measured, and the results are as follows: Figure 11 (b) shows that the RNA content of NCM3722 pTrc99A-rrlB was significantly higher than that of the wild type at both 6 h and 24 h of culture. At 24 h of culture, the RNA content of NCM3722 pTrc99A-rrlB was 23.06%, which was 44.03% higher than that of wild-type NCM3722 (RNA content 16.01%). Therefore, overexpression of rrlB in Escherichia coli NCM3722 can increase the RNA content by 44.03% without affecting the growth of the strain.
[0117] RNA was extracted from *E. coli* NCM3722 pTrc99A-rrlB cultured for 24 h according to the method in Example 1. The RNA content of the obtained RNA powder was weighed and determined. The mass of the RNA powder extracted from the engineered *E. coli* NCM3722 pTrc99A-rrlB was 0.504 g, and the RNA content was found to be 80.6%, resulting in a net RNA content of 0.406 g and an RNA yield of 0.162 g / g dry bacterial cells. In contrast, the RNA yield of wild-type NCM3722 was 0.111 g / g dry bacterial cells (Example 1). The RNA yield of NCM3722 pTrc99A-rrlB was increased by 45.9%.
[0118] Example 7
[0119] Overexpression of 16S rRNA using the trc promoter in Escherichia coli NCM3722 to increase its RNA content
[0120] Construction of recombinant plasmid pTrc99A-rrsB (rrsB encodes E. coli 16S rRNA): Using the genome of E. coli MG1655 as a template, primers WXW1-F were used... :TTCGAGCTCGGTACCCGGGGATCCCGCTGAGAAAAAAGCGAAGCG) (SEQ ID NO:2) and WXW7-R ( The rrsB fragment, 1758 bp in length, was obtained by PCR amplification using the formula (SEQ ID NO: 8). Primers WXW1-F and WXW7-R were attached upstream and downstream of the rrsB gene, respectively, and contained homologous arms required for homologous recombination with plasmid pTrc99A. The vector pTrc99A was digested with restriction endonucleases BamHI and HindIII to obtain a linear fragment. The vector and the target gene were then ligated via homologous recombination to obtain the recombinant plasmid pTrc99A-rrsB. Detailed procedures are described in Example 1. The constructed pTrc99A-rrsB plasmid map is shown below. Figure 12 .
[0121] Following the method in Example 1, the recombinant plasmid pTrc99A-rrsB was transformed into Escherichia coli NCM3722 to obtain Escherichia coli strain NCM3722 pTrc99A-rrsB that overexpresses rrsB using the trc promoter.
[0122] The growth curves of NCM3722, NCM3722 pTrc99A, and NCM3722 pTrc99A-rrsB were determined, and the results are as follows: Figure 13 As shown in (a), it can be seen that the growth rates of the three are basically the same and there is no obvious difference.
[0123] The RNA content of the three strains was measured, and the results are as follows: Figure 13 (b) shows that the RNA content of NCM3722 pTrc99A-rrsB was significantly higher than that of the wild type at both 6 h and 24 h of culture. At 24 h of culture, the RNA content of NCM3722 pTrc99A-rrsB was 19.86%, which was 24.05% higher than that of wild-type NCM3722 (RNA content 16.01%). Therefore, overexpression of rrsB in Escherichia coli NCM3722 can increase the RNA content by 24.05% without affecting the growth of the strain.
[0124] RNA was extracted from *E. coli* NCM3722 pTrc99A-rrsB cultured for 24 h according to the method in Example 1. The RNA content of the obtained RNA powder was weighed and determined. The mass of the RNA powder extracted from the engineered *E. coli* NCM3722 pTrc99A-rrsB was 0.446 g, and the RNA content was found to be 81.0%, resulting in a net RNA content of 0.361 g and an RNA yield of 0.144 g / g dry bacterial cells. In contrast, the RNA yield of wild-type NCM3722 was 0.111 g / g dry bacterial cells (see Example 1). The RNA yield of NCM3722 pTrc99A-rrsB was 29.7% higher.
[0125] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, alterations, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A type of Escherichia coli with high RNA content, characterized in that, For introducing recombinant plasmids into E. coli, the recombinant plasmid contains an expression element consisting of a strong promoter, rDNA, and a terminator, wherein the rDNA is an rRNA coding sequence derived from an E. coli rDNA operon, the rDNA operon being selected from one or more of rrnA, rrnB, rrnC, rrnD, rrnE, rrnG, and rrnH, and the rRNA coding sequence includes 16S rDNA, 23S rDNA, and 5S rDNA in the corresponding operon.
2. The high RNA content *E. coli* according to claim 1, characterized in that, The rDNA operon includes E. coli 16S rDNA. rrsB 23S rDNA rrlB 5S rDNA rrfB .
3. The high RNA content *E. coli* according to claim 1, characterized in that, The strong promoters include one or more of the following: T7 promoter, lac promoter, trc promoter, tac promoter, trp promoter, PlacUV5 promoter, PBAD promoter, recA promoter, groESL promoter, pL / pR promoter, and J23119 promoter.
4. The high RNA content *E. coli* according to claim 1, characterized in that, The terminator includes one or more of the following: rrnB T1 terminator, rrnB T2 terminator, T7 terminator, His operon terminator, trpA terminator, E. coli thr operon T1 terminator, and TrrnC terminator.
5. The high RNA content *E. coli* according to claim 1, characterized in that, The plasmid is an expression plasmid with at least 10 copies in Escherichia coli.
6. The high RNA content *E. coli* according to claim 1, characterized in that, The plasmid is selected from one or more of pTrc99a, pET28a, pET28b, and pCDFDuet.
7. The high RNA content *E. coli* according to claim 1, characterized in that, The *Escherichia coli* strain is selected from one or more of NCM3722, MG1655, DH5a, Nissle 1917, BL21(DE3), W3110, or their derivative strains.
8. The method for constructing high RNA content *E. coli* according to any one of claims 1-7, characterized in that, The construction method includes: replacing the promoter of E. coli rDNA itself with a strong promoter to construct an expression element of "strong promoter + rDNA + terminator", and using a plasmid as a vector to transform the expression element into E. coli to obtain an engineered E. coli strain containing a recombinant plasmid.
9. The application of the high RNA content Escherichia coli according to any one of claims 1-7 or the high RNA content Escherichia coli obtained by the construction method according to claim 8 in RNA production.
10. The application according to claim 9, characterized in that, Includes the following steps: (1) The engineered Escherichia coli containing the expression element "strong promoter + rDNA + terminator" was cultured to obtain seed culture, and then inoculated into fermentation medium to obtain fermentation culture. IPTG was added to a final concentration of 0.2~2 mmol / L to induce fermentation, and the culture was continued for a period of time. The cells were collected by centrifugation to obtain Escherichia coli cells with high RNA production. (2) Prepare a bacterial suspension with a bacterial dry weight of 5% to 10%, then add sodium hydroxide for treatment, then add hydrochloric acid to neutralize to pH 6 to 8, centrifuge and take the supernatant; add 0.1% to 1% of bacterial dry weight of protease to the supernatant for treatment to inactivate the enzyme, centrifuge and take the supernatant; adjust the pH of the supernatant to 2 to 2.5, then add ethanol to fully precipitate the RNA, centrifuge, dry and pulverize to obtain RNA powder.