Application of lprR gene in regulation and control of predatory ability of stenotrophomonas maltophilia

By inhibiting or reducing the content or activity of LprR protein in Stenotrophomonas maltophilia, especially by knocking out or dephosphorylating LprR protein, the unknown problem of the regulatory mechanism of predatory behavior of Stenotrophomonas maltophilia was solved, and its predatory ability was significantly improved, especially under oligotrophic conditions.

CN122038259APending Publication Date: 2026-05-15INST OF MICROBIOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-26
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

The regulatory mechanisms of predatory behavior in Stenotrophomonas maltophilia are still unclear. In particular, the role of lysine signaling in the expression of predatory genes and phenotype formation has not been revealed, which limits the in-depth understanding and application development of its predatory ability.

Method used

By inhibiting or reducing the content or activity of LprR protein, including knocking out or dephosphorylating the LprR protein-encoding gene in the genome of Stenotrophomonas maltophilia, the expression of LprR protein can be regulated using specific nucleic acid molecules or reagents to enhance the predation ability of Stenotrophomonas maltophilia.

Benefits of technology

The predation ability of Stenotrophomonas maltophilia under oligotrophic conditions was significantly improved, especially its predation ability against Xanthomonas. The predation ability of the mutant under starvation conditions was significantly improved, and the predation ability of the complementary strain was restored to be basically consistent with that of the wild type.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses an application of an lprR gene in regulating and controlling the predation capability of stenotrophomonas maltophilia. The invention provides a substance for inhibiting or reducing or down-regulating the content or activity of LprR protein, or a substance for inhibiting or reducing or down-regulating the expression of an LprR protein coding gene, and any one of the following applications: 1) improving the predatory ability of stenotrophomonas maltophilia; experiments prove that after the lprR gene is knocked out, the predatory ability of the mutant under the hungry condition is remarkably improved, the predatory ability of a complementary strain basically recovers to be consistent with that of a wild type, and in an NYG culture medium, the predatory ability of the mutant, the predatory ability of the complementary strain and the predatory ability of the wild type are not remarkably different.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to... lprR Application of genes in regulating the predatory ability of Stenotrophomonas maltophilia. Background Technology

[0002] Stenotrophomonas maltophilia ( Stenotrophomonas maltophilia Stenotrophomonas maltophilia is a Gram-negative bacterium widely distributed in natural environments such as soil and water, and can colonize the surface and interior of plants and animals. It is an opportunistic pathogen, typically causing infection only when the host's immune function is weakened. In addition to its potential pathogenicity, Stenotrophomonas maltophilia also exhibits significant predatory characteristics, capable of preying on a variety of bacteria and fungi, indicating its significant development value in fields such as biocontrol.

[0003] However, research on the predatory behavior of Stenotrophomonas maltophilia is still in its early stages. The specific process, mode of action, and regulatory mechanism of its predation are not yet clear, and the relevant functional genes and regulatory networks have not been systematically reported, which seriously restricts the in-depth understanding and application development of its predatory ability.

[0004] In bacterial behavior regulation, the perception and response to environmental signals are crucial. Lysine, as one of the essential amino acids for bacteria, is not only a precursor to protein synthesis but also acts as a signaling molecule, participating in the regulation of bacterial physiological metabolism, group behavior, and environmental adaptation. Existing studies have confirmed that various bacteria can sense changes in lysine concentration through specific signaling systems, thereby adjusting their survival strategies and interspecies interaction patterns. Stenotrophomonas maltophilia, as a bacterium possessing both environmental adaptability and predatory capabilities, likely exhibits predatory behavior precisely regulated by signaling molecules such as lysine in the environment. However, current research has not revealed whether and how lysine affects the predatory activity of this bacterium.

[0005] Therefore, research gaps remain regarding the regulatory mechanisms of predatory behavior in Stenotrophomonas maltophilia, particularly the role of lysine signaling in the expression of predatory-related genes and phenotype formation. Elucidating the lysine-mediated signal transduction pathway and its regulatory network on predatory behavior will not only fill the research gaps in the molecular mechanisms of predation in this bacterium but also provide a new perspective on understanding the function of amino acid signaling in microbial interactions. Furthermore, it will contribute to the theoretical basis and technological foundation for signal-based optimization of predatory capabilities and applications in biocontrol. Summary of the Invention

[0006] The technical problem solved by this invention is to provide lprR Application of genes in regulating the predatory ability of Stenotrophomonas maltophilia.

[0007] To address this technical problem, the first aspect of the present invention provides a substance that inhibits, reduces, or downregulates the content or activity of LprR protein, or a substance that inhibits, reduces, or downregulates the expression of the LprR protein-encoding gene, in any of the following applications:

[0008] A1) Enhance the predatory ability of Stenotrophomonas maltophilia; A2) Prepare products that enhance the predatory ability of Stenotrophomonas maltophilia; The LprR protein is any one of the following: The protein shown in B1 includes the amino acid residues shown in sequence 2; The protein shown in B2) has more than 80% amino acid sequence identity with the protein shown in B1) and has the same function; The protein shown in B3) is obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in B1) or B2) to obtain the protein with the sequence shown.

[0009] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0010] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0011] In the above applications, the substance is a reagent that knocks out the LprR protein-coding gene in the genome of Stenotrophomonas maltophilia or a reagent that dephosphorylates the LprR protein-coding gene in the genome of Stenotrophomonas maltophilia.

[0012] In the above applications, the knockout of the Stenotrophomonas maltophilia genome lprR The gene reagent is any one of the following: C1) inhibits, reduces, or downregulates the expression of the LprR protein-encoded gene in the first aspect, C2) expresses the gene encoding the nucleic acid molecule described in C1). C3) contains the expression cassette of the gene described in C2). C4) A recombinant vector containing the gene described in C2), or a recombinant vector containing the expression cassette described in C3). C5) A recombinant microorganism containing the gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4).

[0013] In some embodiments, the nucleotide sequence of the nucleic acid molecule that inhibits, reduces, or downregulates the expression of the LprR protein-encoding gene in the first aspect is sequence 3.

[0014] In the above-described application, the reagent that dephosphorylates the LprR protein encoding gene in the Stenotrophomonas maltophilia genome is a reagent that causes a mutation at position 52 (D) of the LprR protein amino acid sequence.

[0015] In some embodiments, the reagent that causes the D at position 52 of the LprR protein amino acid sequence is a reagent that causes the D at position 52 of the LprR protein amino acid sequence (Sequence 2) to be mutated to A.

[0016] In some embodiments, the reagent that mutates position 52 (D to A) of the LprR protein amino acid sequence (Sequence 2) includes: lprR D52A -A: AACAGCTATGACATGATTACGAATTCCCCGGTTGTACAACCGGC; lprR D52A -B: AGCGAGCAGGACCAGGGCGGGCTTGTCGGCC; lprR D52A -C: CCCGCCCTGGTCCTGCTCGCTGTCGGCCTGC; lprR D52A -D:GTAAAACGACGGCCAGTGCCAAGCTTTCATCCCCATGCCGAGCG.

[0017] In the above-described application, the enhancement of Stenotrophomonas maltophilia's predatory ability refers to enhancing Stenotrophomonas maltophilia's predatory ability against Xanthomonas.

[0018] In some embodiments, the enhancement of Stenotrophomonas maltophilia’s predation ability on Xanthomonas maltophilia is to enhance Stenotrophomonas maltophilia’s predation ability on Xanthomonas maltophilia under oligotrophic conditions (natural or organic conditions).

[0019] In a second aspect, the present invention provides substances that inhibit, reduce, or downregulate the content or activity of LprR protein as described in the first aspect, or substances that inhibit, reduce, or downregulate the expression of LprR protein-encoding genes.

[0020] Thirdly, the present invention provides a method for improving the predatory ability of Stenotrophomonas maltophilia, comprising the following steps: inhibiting or reducing or downregulating the content or activity of the LprR protein described in the first aspect in Stenotrophomonas maltophilia, or inhibiting or reducing or downregulating the expression of the LprR protein encoding gene described in the first aspect in Stenotrophomonas maltophilia, thereby improving the predatory ability of Stenotrophomonas maltophilia.

[0021] Fourthly, the present invention provides a method for improving the predatory ability of Stenotrophomonas maltophilia, comprising the following steps: knocking out the full length or part of the LprR protein-coding gene described in the first aspect in Stenotrophomonas maltophilia to inhibit, reduce or downregulate the expression of the LprR protein-coding gene described in the first aspect in Stenotrophomonas maltophilia, thereby improving the predatory ability of Stenotrophomonas maltophilia.

[0022] Fifthly, the present invention provides a method for improving the predatory ability of Stenotrophomonas maltophilia, comprising the following steps: dephosphorylating the LprR protein encoding gene described in the first aspect in the Stenotrophomonas maltophilia genome to improve the predatory ability of Stenotrophomonas maltophilia.

[0023] In some implementations, the method is carried out under natural or organic conditions, or in an oligotrophic system or under starvation conditions.

[0024] In some embodiments, the oligotrophic system may be an oligotrophic culture medium.

[0025] In some embodiments, the oligotrophic medium is MMX medium.

[0026] The experiments of this invention demonstrate that, lprR After gene knockout, the predation ability of the mutants under starvation conditions was significantly enhanced, while the predation ability of the complementary strains returned to essentially the same as that of the wild type. In NYG medium, there was no significant difference in predation ability between the mutants, complementary strains, and wild type. Attached Figure Description

[0027] Figure 1Image A shows the secondary structure of the LprR protein and the mutant phenotype; Image B shows the secondary structure of the LprR protein; Image C shows the wild-type protein. lprR Plate phenotypes of five genetic strains, including mutants and complementary strains; C represents wild-type strains all carrying the overexpression vector. lprR Quantitative results of mutants and complementary three strains in MMX liquid medium; D represents wild-type strains all carrying the overexpression vector. lprR Quantitative results of mutant and complementary trivariate strains in NYG liquid medium. Unpaired two-tailed Student's test was used, where "ns" indicates no significant difference; "Indicates a highly significant difference and a p-value less than 0.001;" "" indicates that the difference is significant and the P value is less than 0.1.

[0028] Figure 2 for lprR The point mutant strain phenotype was determined; an unpaired two-tailed Student's t-test was used, in which " "" indicates that the difference is extremely significant and the P value is less than 0.001.

[0029] Figure 3 Wild-type cells, all carrying the overexpression vector lprR Growth counting curves of mutant and complementary three strains. Detailed Implementation

[0030] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0032] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0033] The maltophilic stenotrophomonas strain used in the following examples S. maltophilia CGMCC 1.1788, originating from the Microbial Culture Collection Center of the Institute of Microbiology, Chinese Academy of Sciences, has the strain number CGMCC 1.1788 (hereinafter referred to as CGMCC 1.1788).Sma CGMCC 1.1788).

[0034] The following examples are of Xanthomonas aeruginosa ( Xanthomonas campestris pv. campestris 8004, hereinafter referred to as Xcc 8004) is described in the following literature: Wang H, Shi C, Xie Q, Wang Y, Liu S, Li C, He C, Tao J. Genome-wide analysis of β-Galactosidases in Xanthomonas campestris pv. campestris 8004. Front Microbiol. 2018 May 11; 9:957. doi:10.3389 / fmicb.2018.00957. PMID: 29867862; PMCID: PMC5958218. The name of this material in the literature is... Xanthomonas campestris pv. campestris 8004.

[0035] The following examples describe liquid culture medium components in 1 L of each medium with pH adjusted to 7.0. If a solid culture medium is to be prepared, 15 g of agar powder can be added.

[0036] LB medium: 10 g peptone, 5 g yeast extract, 10 g sodium chloride, and the remainder is water.

[0037] 210 Culture medium: 5 g sucrose, 8 g enzymatically hydrolyzed casein, 4 g yeast extract, 3 g K2HPO4, 0.3 g MgSO4·7H2O, balance water; MMX medium: 4 g K2HPO4, 6 g KH2PO4, 2 g (NH4)2SO4, 1 g trisodium citrate, 0.2 g MgSO4·7H2O, 5 g glucose, balance water.

[0038] NYG medium: 5 g peptone, 3 g yeast extract, 20 ml glycerol, 2 g K2HPO4, 0.5 g KH2PO4, with the remainder being water.

[0039] Example 1: Application of reducing LprR protein activity in enhancing the predatory ability of Stenotrophomonas maltophilia. Stenotrophomonas maltophilia SmaCGMCC 1.1788 exhibits significant predatory activity against various bacteria, including Staphylococcus aureus, Escherichia coli, Xanthomonas, and Bacterium tumefaciens, the causal agent of rice bacterial blight. Predatory-related genes were identified through screening a Tn5 transposon mutant library and TAIL-PCR identification. lprR This gene encodes the protein LprR.

[0040] lprR The nucleotide sequence of the gene is sequence 1, and the amino acid sequence of the protein LprR it encodes is sequence 2. Figure 1 A represents the secondary structure of the LprR protein.

[0041] I. lprR In-frame deletion of mutant strain Δ lprR and its functional verification 1. lprR In-frame deletion of mutant strain Δ lprR Construction (1) Extracted Sma Using CGMCC 1.1788 genomic DNA as a template, the gene to be deleted was amplified by PCR. ​ The DNA sequences flanking the fragment were purified by agarose gel to obtain the up fragment (562 bp) and the down fragment (276 bp). The primers for amplifying the above-mentioned up fragment are as follows: Primer LprR - A: AACAGCTATGACATGATTACGAATTCATCAGGATCAGCAGCAGGAT; Primer LprR - B : GTCGAAGACGATGAGCAGCCGGAACGGATCAA; The primers for amplifying the down fragment are as follows: Primer LprR - C: CCGGCTGCTCATCGTCTTCGACCAGTACGATATC; Primer LprR - D: GTAAAACGACGGCCAGTGCCAAGCTTTGCGTCAGTCGCTTTGCT; (2) The up fragment and down fragment were respectively ligated into the pTOPO-TA vector (Kangrun Biotechnology; catalog number T185-100), transformed into DH5α competent cells, and the correct clones were selected and plasmids were extracted for sequencing verification; (3) Using the Seamless Cloning Kit (Kangrun Biotechnology, catalog number T197) 100) The upstream homologous arm (up fragment) and the downstream homologous arm (down fragment) were ligated into the pK18mobSacB vector digested with EcoRI and HindIII (Kangrun Biotechnology, catalog number T185). 100), construct recombinant plasmid pK18mobSacB up The ligation product was transformed into DH5α competent cells, positive clones were picked and plasmids were extracted, and sequenced using M13 primers for verification.

[0042] The recombinant plasmid pK18mobSacB-up-down is a vector obtained by replacing the DNA fragment shown in sequence 3 with the fragment between the EcoRI and HindIII restriction sites of the suicide vector pK18mobSacB.

[0043] In the DNA fragment shown in Sequence 3, positions 1-550 are the up fragment, and positions 551-816 are the down fragment.

[0044] (4) The recombinant plasmid pK18mobSacB-up-down was converted to [a specific plasmid] by electroporation. ​ CGMCC 1.1788 competent cells were cultured at 28℃ (Note: the growth temperature for culturing the two bacteria separately) for 2-3 days, and single clones that could grow on LB plates containing 50 μg / mL kanamycin were selected.

[0045] by ​ Using CGMCC 1.1788 DNA as a control, PCR amplification was performed using outer primers (primer VF and primer VR) for the up and down sequences of the gene fragment to be deleted. Strains that did not amplify the corresponding wild-type band (955bp) were selected as first-time exchange positive strains. ​ CGMCC 1.1788 is the wild-type control.

[0046] VF:CCATGTGATTGAAGGCAT VR:GTTTTGTAACAGCATCAGGCT.

[0047] (5) Inoculate the positive strain of the first exchange into 10 mL of LB liquid medium containing 50 μg / mL kanamycin and culture overnight at 28°C and 230 rpm with shaking. Take 1 mL of the overnight bacterial culture, centrifuge at 6000 rpm for 2 minutes to collect the bacterial cells, wash 3 times with LB medium, and resuspend in 10 mL of LB liquid medium. Culture at 28°C and 230 rpm with shaking for 2-4 hours to induce the second exchange. (6) The bacterial culture was serially diluted, and 100 μL of each was spread on LB plates containing 20% ​​sucrose and incubated at 28°C for 2-3 days; (7) Pick single clones from LB plates containing 20% ​​sucrose and inoculate them into LB (LK) plates and LB plates containing 50 μg / mL kanamycin, respectively, to screen for single clones that cannot grow on LK plates but can grow on LB plates.

[0048] Genomic DNA was extracted from the above monoclonal samples and colony PCR was performed using the outer primers (primer VF and primer VR) to verify the positive strain. The strain with a length of 364 bp was identified.

[0049] Positive strains and ​ Sequencing results of CGMCC 1.1788 (wild type) PCR products showed that the length of the PCR products of the positive strain was reduced compared to the wild type by the size of the corresponding deleted fragment.

[0050] Therefore, the above-mentioned positive strains are recorded as ​ Delete mutant strain Δ within the read frame ​ .

[0051] ​ Delete mutant strain Δ within the read frame ​ To be ​ CGMCC 1.1788 genome ​ The strain was obtained by knocking out bases 29-621 of the gene (sequence 1) while leaving the other base sequences unchanged.

[0052] 2. Construction of complementary strains 1) Construct complementary plasmids pBBR1MCS2- ​ To make the sequence shown in Sequence 1 ​ The vector was obtained by replacing the fragment between the KpnI and HindIII restriction sites in the pBBR1MCS2 vector (Newp Biotech, V000592).

[0053] 2) Complementary strains The above complementary plasmid pBBR1MCS2- ​ The mutant strain Δ was prepared by importing the above method 1. ​ In this process, complementary strain Δ was obtained. ​ - ​ .

[0054] To eliminate the interference of the complementary plasmid itself on the experimental results, the pBBR1MCS2 plasmid was transformed into both the wild-type strain and the constructed deletion mutant strain to observe the phenotypic changes, as detailed below: The complementary plasmid backbone pBBR1MCS2 was introduced into the mutant strain Δ obtained by step 1 above. ​ In the process, complementary control strain Δ was obtained. ​ -EV.

[0055] The complementary plasmid backbone pBBR1MCS2 was introduced into the wild-type strain. ​ In CGMCC 1.1788, the complementary control strain WT-EV was obtained.

[0056] 3. Detect and delete ​ Gene pair ​ CGMCC 1.1788: Adjusting Predation Effects To observe the predation extent of bacteria, this study used the mixed plaque culture method on solid culture medium: The bacteria to be tested and the prey bacteria ​ 8004 was cultured overnight at 28°C in the corresponding NYG liquid medium to obtain the bacterial suspensions of the test bacteria and the prey bacteria. The OD values ​​of all bacterial suspensions were then measured using a UV spectrophotometer. 600 The pH value was uniformly adjusted to 0.4. Then, the bacterial suspension of the test bacteria and the bacterial suspension of the prey bacteria were mixed at a volume ratio of 1:3 to obtain a mixed bacterial suspension. 5 μL of the mixed bacterial suspension was spotted onto MMX solid medium (oligotrophic medium, simulating the natural state). After the bacterial suspension was dried in a clean bench, the plate was placed in an incubator at 30°C for incubation.

[0057] The bacteria to be tested are ​ CGMCC 1.1788 Wide Type (WT), WT-EV, Δ ​ Δ ​ -EV and Δ ​ - ​ .

[0058] With prey ​ 8004, Predator ​ CGMCC 1.1788 (referred to in the image) ​Individual culture was used as a control.

[0059] The results of a spot experiment in which prey and predators were cultured together in MMX medium at a ratio of 3:1 are as follows: ​ As shown in B, in the left figure ​ Group 8004 represents prey ​ 8004 cultured separately. ​ Group representation ​ CGMCC 1.1788 (predator) cultured alone, it can be seen that... ​ and ​ The growth of 8004 on MMX medium showed significant differences: ​ 8004 can grow in large quantities, while ​ There was virtually no growth; in the right figure, the WT-EV group represents WT-EV and... ​ 8004 mixed culture, Δ ​ -EV group represents Δ ​ -EV and ​ 8004 mixed culture, Δ ​ - ​ Group represents Δ ​ - ​ and ​ 8004 Mixed Culture. It can be seen that, with a high prey ratio, only a small amount of prey is observed after WT-EV mixed culture. ​ 8004 was preyed upon, creating a void in the middle; this state can serve as a reference point for subsequent observations; Δ ​ -EV and ​ Colony morphology of 8004 mixed culture and WT-EV ​ The colony morphology of the 8004 mixed culture showed significant differences, exhibiting the following characteristics: ​ 8004 was clearly preyed upon, and the mixed colonies showed obvious cavities. ​ 8004 only exists on the edge of the circle. This indicates that... ​ Gene deletions all lead to ​ Their predatory abilities are significantly enhanced. And Δ ​ - ​ ( ​ Missing strain replacement ​ Because the target gene was reintroduced, the colony morphology of the bacteria recovered to a state close to that of WT-EV, further validating the role of this gene in regulation. ​ It plays an important role in predation ability.

[0060] ​ The enhanced predatory ability induced by gene deletion, and the restoration of the phenotype after replacement, strongly suggest... ​ Genes in​ It plays a negative regulatory role in the predation control network.

[0061] 4. Observation of predator-prey interaction counting in liquid culture medium To achieve the control of Stenotrophomonas maltophilia ( ​ For quantitative analysis of ), this study employed the gradient dilution plate method in liquid environments. ​ The number of viable bacteria in the prey is counted. The specific procedure is as follows: Strain pretreatment: The bacteria to be tested are mixed with the prey bacteria. ​ 8004 cells were inoculated into the corresponding NYG liquid medium and incubated overnight at 28°C. After incubation, the cells were washed three times with the corresponding medium, and finally resuspended in MMX liquid medium by centrifugation to obtain the bacterial suspension. The OD of the bacterial suspension was measured using a UV spectrophotometer. 600 The OD values ​​of all bacterial cultures were determined using MMX liquid medium. 600 The value has been uniformly adjusted to 0.4.

[0062] Mixed bacterial suspensions: Subsequently, the bacterial suspensions of the test bacteria and the prey bacteria were mixed at a volume ratio of 1:1. ​ 8004 bacterial suspension mixture (200 μL of test bacteria suspension : 200 μL of prey bacteria suspension).

[0063] Control group bacterial suspension: The test bacterial suspension or the prey bacterial suspension alone was mixed with MMX liquid medium at a ratio of 1:1 (200 μL test bacterial suspension : 200 μL corresponding medium), and the treatment method was the same as that of the mixed group.

[0064] The bacteria tested were WT-EV and Δ. ​ -EV and Δ ​ .

[0065] The mixed group and control group bacterial cultures were incubated in a shaker at 30°C for 24 hours, and samples were taken for testing. The liquid cultures to be tested were serially diluted 10-fold using sterile physiological saline or the appropriate liquid culture medium, successively diluted to 10⁻⁶. - ¹ to 10 -7 Different concentrations (the specific dilution factor can be adjusted flexibly according to the estimated bacterial density in the sample to ensure that the number of colonies growing on the subsequent plates is within the suitable counting range of 30-300). Then, take 0.1 mL of bacterial solution from each dilution and spread it evenly on an NYG plate; if it is necessary to distinguish between the two for counting, a selective medium can be used (such as a medium containing a specific antibiotic for the bacteria to be tested, or a corresponding medium selected according to the difference in nutritional requirements of the two). At least 3 parallel plates should be set up for each dilution to reduce experimental error.

[0066] After plating, the plates were inverted and incubated at 28°C. Once clearly identifiable single colonies had grown on the plates, the number of colonies on each plate was counted. Finally, the logarithm of the viable cell concentration (CFU / mL) was calculated to determine the number of test bacteria and prey bacteria in the liquid environment, and the ratio of the counts of the two bacteria in the mixed group to the counts of their respective control groups was statistically analyzed.

[0067] prey ​ 8004 and ​ The quantitative results of the survival index co-cultured in MMX liquid medium are shown in Figure 1C. The left figure shows the predator bacteria to be tested (denoted as predator in the figure). ​ The right figure uses the predator as the target, reflecting the survival ratio of "co-culture / iso-culture" (i.e., predation index, number of bacteria in the mixed group / number of bacteria in the test bacteria culture alone); the right figure uses the prey as the target. ​ 8004 is the target (referred to as prey in the diagram). ​ 8004), reflecting its survival index in "co-culture / iso-culture" (i.e., survival index, number of bacteria in the mixed group / ​ 8004 (number of bacteria in culture alone). It can be seen that, compared to the wild-type empty vector group (WT-EV), Δ ​ -EV ( ​ The survival index of gene-deleted strains transformed with empty vectors was significantly altered, and predator-measured Δ... ​ The predation index of the -EV group increased significantly, while the survival index of prey in this group decreased significantly, indicating that... ​ Gene deletion affects predator-prey interactions; while gene replacement strains (Δ) ​ The survival index of the group approached that of the WT-EV group, echoing the phenotype observed in the aforementioned dot experiment, thus quantitatively verifying the role of this gene in... ​ It fosters the core function of negative regulation of predation ability.

[0068] 5. Nutritional environment ​ Effects of gene function The only difference from method 4 above is as follows: Strain pretreatment: The bacteria to be tested are mixed with the prey bacteria. ​ 8004 was inoculated into the corresponding NYG liquid medium and incubated overnight at 28°C to obtain bacterial suspensions. The OD of the bacterial suspensions was measured using a UV spectrophotometer. 600 Value, the OD of all bacterial cultures 600 The value has been uniformly adjusted to 0.4.

[0069] Mixed bacterial suspensions: Subsequently, the bacterial suspensions of the test bacteria and the prey bacteria were mixed at a volume ratio of 1:1. ​8004 bacterial suspension mixture (200 μL of test bacteria suspension : 200 μL of prey bacteria suspension).

[0070] Control group bacterial suspension: The bacterial suspension of the test bacteria alone or the bacterial suspension of the prey bacteria alone was mixed with NYG liquid medium at a ratio of 1:1 (200 μL of test bacterial suspension : 200 μL of corresponding medium), and the treatment method was the same as that of the mixed group.

[0071] prey ​ 8004 and ​ The quantitative results of the survival index co-cultured in NYG liquid medium are shown in Figure 1D. It can be seen that the left figure shows the predator bacteria being tested (denoted as predator in the figure). ​ The study used the predation index (Δ) to reflect the survival ratio of bacteria in co-culture / iso-culture (i.e., the predation index, the number of bacteria in the mixed culture / the number of bacteria in the isolated culture of the tested bacteria). Compared with the WT-EV group, Δ ​ -EV and Δ ​ There were no significant differences between the groups. The right figure shows the prey. ​ 8004 is the target (referred to as prey in the diagram). ​ 8004), reflecting its survival index (i.e., survival index, number of bacteria in the mixed group / ) in "co-culture / iso-culture". ​ 8004 (number of bacteria in culture alone); compared with the WT-EV group, Δ ​ -EV and Δ ​ There were no significant differences between the groups.

[0072] The above results indicate that in a nutrient-rich environment (NYG medium), prR does not significantly regulate interspecific interaction survival ability, which is significantly different from an oligotrophic environment (MMX medium, simulating the natural environment). This suggests that rich nutrition may compensate for the effects of gene deletion, demonstrating that gene function may be environmentally dependent on nutritional conditions.

[0073] II. Dynamic Regulation of LprR Phosphorylation ​ The impact of predation ability 1. Point mutant strains Point mutant strains, including constitutive activated phosphorylation mutants ( ​ D52E Simulating a persistent phosphorylation state) and removing phosphorylation mutants ( ​ D52A (Blocks phosphorylation transmission).

[0074] 1) Preparation of point mutant plasmids Extracted ​Using CGMCC 1.1788 genomic DNA as a template, the following primers were used. ​ D52A -A / ​ D52A -B and ​ D52A -C / ​ D52A -D was used for amplification, yielding a 750 bp fragment AB and a 537 bp fragment CD; the fragments were then amplified using a seamless cloning kit (Kangrun Biotechnology, catalog number T197). 100) Ligate AB and CD to the pK18mobSacB vector digested with EcoRI and HindIII (Kangrun Biotechnology, catalog number T185) 100), resulting in plasmid pK18mobSacB-LprR H230A .

[0075] ​ D52A -A : AACAGCTATGACATGATTACGAATTCCCCGGTTGTACAACCGGC ​ D52A -B : AGCGAGCAGGACCAGGGCGGGCTTGTCGGCC ​ D52A -C : CCCGCCCTGGTCCTGCTCGCTGTCGGCCTGC ​ D52A -D : GTAAAACGACGGCCAGTGCCAAGCTTTCATCCCCATGCCGAGCG pK18mobSacB- ​ D52A To be ​ D52A The mutant encoding gene was replaced with a fragment between the EcoRI and HindIII restriction sites in the pK18mobSacB vector to obtain the vector.

[0076] ​ D52A The amino acid sequence of the mutant is obtained by mutating D at position 52 of sequence 2 to A.

[0077] ​ D52A The nucleotide sequence of the gene encoding the mutant is formed by mutating the A nucleotide at position 155 of sequence 1 to a C nucleotide.

[0078] Extracted ​ Using CGMCC 1.1788 genomic DNA as a template, the following primers were used. ​ D52E -A / ​ D52E -B and ​ D52E -C / ​ D52E -D was used for amplification, yielding a 750 bp fragment AB and a 537 bp fragment CD; the fragments were then amplified using a seamless cloning kit (Kangrun Biotechnology, catalog number T197). 100) Ligate AB and CD to the pK18mobSacB vector digested with EcoRI and HindIII (Kangrun Biotechnology, catalog number T185) 100), resulting in pK18mobSacB- ​ D52E .

[0079] ​ D52E -A : AACAGCTATGACATGATTACGAATTCCCCGGTTGTACAACCGGC ​ D52E -B : AGCGAGCAGGACCAGGGCGGGCTTGTCGGCC ​ D52E -C : CCCGCCCTGGTCCTGCTCGAAGTCGGCCTGC ​ D52E -D : GTAAAACGACGGCCAGTGCCAAGCTTTCATCCCCATGCCGAGCG pK18mobSacB- ​ D52E To be ​ D52E The mutant encoding gene was replaced with a fragment between the EcoRI and HindIII restriction sites in the pK18mobSacB vector to obtain the vector.

[0080] ​ D52E The amino acid sequence of the mutant is obtained by mutating D at position 52 of sequence 2 to E.

[0081] ​ D52EThe nucleotide sequence of the gene encoding the mutant is that the T nucleotide at position 156 of sequence 1 is mutated to an A nucleotide.

[0082] 2) Preparation of point mutant strains The above-mentioned vector pK18mobSacB- ​ D52A and pK18mobSacB- ​ D52E Transfer to each ​ In CGMCC1.1788, point mutant strains were obtained through secondary homologous recombination, plate screening, and PCR verification. ​ D52A and point mutant bacteria ​ D52E 。

[0083] 2. The predatory ability of the point mutant strain was determined. Strain pretreatment: The bacteria to be tested are mixed with the prey bacteria. ​ 8004 cells were inoculated into the corresponding NYG liquid medium and incubated overnight at 28°C. After incubation, the cells were washed three times with MMX liquid medium, and finally resuspended in MMX liquid medium by centrifugation to obtain the bacterial suspension. The OD of the bacterial suspension was measured using a UV spectrophotometer. 600 Value, the OD of all bacterial cultures 600 The value has been uniformly adjusted to 0.4.

[0084] Mixed bacterial suspensions: Subsequently, the bacterial suspensions of the test bacteria and the prey bacteria were mixed at a volume ratio of 1:1. ​ Mix 8004 bacterial suspensions (200 μL of test bacteria suspension : 200 μL of prey bacteria suspension).

[0085] Control group bacterial culture: The test bacterial culture or the prey bacteria culture was mixed with MMX liquid medium at a ratio of 1:1 (200 μL test bacterial culture : 200 μL corresponding medium), and the treatment method was the same as that of the mixed group.

[0086] The bacteria to be tested are ​ CGMCC 1.1788 (denoted as WT in the figure), point mutant strain ​ D52A and point mutant strains ​ D52E .

[0087] The mixed group and control group bacterial cultures were incubated in a shaker at 28°C for the set time, and samples were taken for testing. The liquid cultures to be tested were serially diluted 10-fold using sterile physiological saline or the appropriate liquid culture medium, successively diluted to 10⁻⁶. -¹ to 10 -7 Different concentrations (the specific dilution factor can be adjusted flexibly according to the estimated bacterial density in the sample to ensure that the number of colonies growing on the subsequent plates is within the suitable counting range of 30-300). Then, take 0.1 mL of bacterial solution from each dilution and spread it evenly on an NYG plate; if it is necessary to distinguish between the two for counting, a selective medium can be used (such as a medium containing a specific antibiotic for the bacteria to be tested, or a corresponding medium selected according to the difference in nutritional requirements of the two). At least 3 parallel plates should be set up for each dilution to reduce experimental error.

[0088] After plating, the plates were inverted and incubated at 28°C. Once clearly identifiable single colonies had grown on the plates, the number of colonies on each plate was counted. Finally, the logarithm of the viable cell concentration (CFU / mL) was calculated to determine the viable cell count in the liquid environment. ​ The number of bacteria in the prey was compared with the count of each type of bacteria in the mixed group and the ratio of the count of each type of bacteria to the count of their respective control groups.

[0089] The results are shown in Figure 2. It can be seen that the left figure shows the predator bacteria being tested (denoted as predator in the figure). ​ The image on the right shows the prey as the subject. ​ 8004 is the target (referred to as prey in the diagram). ​ 8004), and wild-type strain ​ Compared to CGMCC1.1788 (WT), the phosphorylation-removed point mutant strain ​ D52A The strain exhibited significantly enhanced predatory ability while prey survival was reduced, consistent with the knockout mutant phenotype, directly verifying that LprR phosphorylation plays a crucial inhibitory role in predatory behavior. LprR constitutively activated phosphorylation mutant strains ​ D52E Its predatory ability is lower than that of the phosphorylation-removed mutant. ​ D52A However, its predation index is still higher than that of the wild type, which indicates that even when the constitutive activating mutant is in a hyperphosphorylated state, it does not produce the strongest inhibitory effect.

[0090] This phenomenon indicates that LprR does not exhibit stronger inhibitory effects at higher phosphorylation levels; rather, it may be more effective at inhibiting predation behavior at lower phosphorylation levels. This characteristic of "strong inhibition at low phosphorylation" may be closely related to the dynamic balance of phosphorylation and dephosphorylation in the wild-type strain: the phosphorylation level of LprR in the wild type fluctuates with environmental signals, maintaining a moderately low level that precisely matches its optimal inhibitory function; while the constitutive activation mutant, due to persistent high phosphorylation, deviates from this range, thus weakening the inhibitory effect and resulting in a higher predation index than the wild type. This suggests that in the natural state, the phosphorylation of the LprR system is not simply a "continuous activation" mode, but rather a fine-tuning of predation ability through dynamic switching between phosphorylation and dephosphorylation: when prey signals are present in the environment, the system may enhance phosphorylation, causing LprR to enter a high phosphorylation state, temporarily weakening the inhibitory effect, allowing... S. ​ The predatory ability is moderately enhanced to obtain nutrients; when predation reaches a certain level or environmental signals change, LprR enters a hypophosphorylated state by removing phosphorylation, thus avoiding the adverse effects of over-predation on its own survival within the ecological niche.

[0091] three, ​ Effect on population size ​ As ​ The core signaling pathway genes regulating predation behavior in this bacterium, through precise regulation via phosphorylation dynamic balance, are likely key to maintaining the stability of its populations and the rational allocation of biomass among other microorganisms in its niche. Specifically... ​ In predator-prey relationships, the proper functioning of this system may directly impact the ebb and flow of population size and the dynamic balance of biomass accumulation. For example, its influence on... ​ If the inhibition of predation behavior exists, it can prevent the predator population from over-proliferating and the prey population from declining sharply; otherwise, it may disrupt the interspecific balance.

[0092] To investigate ​ Genes in regulation ​ This study investigated the ecological functions of predation, particularly the impact of its absence on the dynamic balance of predator-prey communities, in MMX liquid medium. S. ​ and ​ Long-term co-culture experiment of 8004.

[0093] Strain pretreatment: The bacteria to be tested are mixed with the prey bacteria. ​8004 was inoculated into the corresponding NYG or LB liquid medium and incubated overnight at 28°C. After incubation, the cells were washed three times with MMX liquid medium, and finally resuspended in MMX liquid medium to obtain the bacterial suspension. The OD of the bacterial suspension was measured using a UV spectrophotometer. 600 Value, the OD of all bacterial cultures 600 The value has been uniformly adjusted to 0.4.

[0094] Mixed bacterial suspensions: Subsequently, the bacterial suspensions of the test bacteria and the prey bacteria were mixed at a volume ratio of 1:1. ​ Mix 8004 bacterial suspensions (200 μL of test bacteria suspension : 200 μL of prey bacteria suspension).

[0095] Control group bacterial suspension: The test bacterial suspension or the prey bacteria suspension alone was mixed with the culture medium at a ratio of 1:1 (200 μL test bacterial suspension : 200 μL corresponding culture medium), and the treatment method was the same as that of the mixed group.

[0096] The bacteria to be tested were WT-EV and Δ ​ -EV and Δ ​ - ​ .

[0097] The mixed group and control group bacterial cultures were incubated in a shaker at 28°C for the set time, and samples were taken for testing. The liquid cultures to be tested were serially diluted 10-fold using sterile physiological saline or the appropriate liquid culture medium, successively diluted to 10⁻⁶. - ¹ to 10 -7 Different concentrations (the specific dilution factor can be adjusted flexibly according to the estimated bacterial density in the sample to ensure that the number of colonies growing on the subsequent plates is within the suitable counting range of 30-300). Then, take 0.1 mL of bacterial solution from each dilution and spread it evenly on an NYG plate; if it is necessary to distinguish between the two for counting, a selective medium can be used (such as a medium containing a specific antibiotic for the bacteria to be tested, or a corresponding medium selected according to the difference in nutritional requirements of the two). At least 3 parallel plates should be set up for each dilution to reduce experimental error.

[0098] By taking samples at regular intervals and counting viable bacteria, the dynamic changes in the population size of wild-type and mutant strains during 120 hours of co-culture were systematically tracked.

[0099] The individual growth dynamics of the test bacteria in MMX liquid medium were evaluated to investigate ​ Self-sustaining functions in the absence of prey.

[0100] As shown in Figure 3, during the initial culture period (0–24 hours), the population sizes of different genotypes were essentially the same, indicating that wild-type and mutant strains had similar growth initiation capabilities in the relatively nutrient-rich initial stage, and MMX medium could support different strains to simultaneously enter the growth state. With prolonged culture time (24–120 hours), during continuous culture under oligotrophic conditions, the wild-type strain carrying the empty vector (WT-EV) exhibited a slow but stable population decline trend, maintaining a relatively constant level overall, reflecting its strong environmental adaptability. This result suggests that complete... ​ Working in synergy with other regulatory networks, it helps strains optimize metabolic allocation and regulate energy consumption in nutrient-deprived environments, thereby achieving dynamic balance in population size. Δ ​ The population size of the -EV mutant decreased significantly in the later stages, with a significantly higher decay rate than the WT-EV group. Combined with previous functional analysis, lprR As a response regulatory protein involved in the integration and output regulation of various environmental signals, its deficiency may lead to the loss of key regulatory nodes in strains when coping with nutrient limitations, hindering the effective coordination of stress responses, metabolic reprogramming, and survival strategies, thereby accelerating population decline. It is noteworthy that after gene reintroduction expression, Δ lprR - lprR The growth dynamics of all strains recovered to near-wild-type levels to varying degrees, with the recovery being particularly significant, indicating that exogenous expression of LprR protein is sufficient to effectively rebuild regulatory function. This result further confirms... lprR Functional integrity for S. maltophilia Long-term survival in oligotrophic environments is crucial.

[0101] Therefore, LprR not only regulates predation intensity in the predator-prey interaction, but also... S. maltophilia It plays a central role in coping with oligotrophic stress and maintaining population stability. LprR enhances the adaptability of strains under resource-limited conditions by sensing signals from the internal and external environment and coordinating metabolic and survival strategies, demonstrating the important biological functions of this two-component system at both the individual survival and interspecific interaction levels.

[0102] Correlation analysis between single-strain growth data and predator-prey co-culture results revealed that LprR... S. maltophilia The regulation of this process has a "dual nature": it acts on both the balance regulation of interspecific predation behavior, influencing the population distribution within a community, and the survival adaptation of individual strains in the trophic environment, maintaining their own population stability. This multi-dimensional regulatory model is crucial for a deeper understanding of... S. maltophilia This provides crucial evidence for niche adaptation mechanisms in complex micro-ecosystems and the functional expansion of LprR.

[0103] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A substance that inhibits, reduces, or downregulates the content or activity of LprR protein, or a substance that inhibits, reduces, or downregulates the expression of the LprR protein-encoding gene, in any of the following applications: A1) Enhance the predatory ability of Stenotrophomonas maltophilia; A2) Prepare products that enhance the predatory ability of Stenotrophomonas maltophilia; The LprR protein is any one of the following: The protein shown in B1 includes the amino acid residues shown in sequence 2; The protein shown in B2) has more than 80% amino acid sequence identity with the protein shown in B1) and has the same function; The protein shown in B3) is obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in B1) or B2) to obtain the protein with the sequence shown.

2. The application according to claim 1, characterized in that: The substance is a reagent that knocks out the LprR protein-encoding gene in the genome of Stenotrophomonas maltophilia or a reagent that dephosphorylates the LprR protein-encoding gene in the genome of Stenotrophomonas maltophilia.

3. The application according to claim 1, characterized in that: The reagent used to knock out the LprR protein-encoding gene in the genome of Stenotrophomonas maltophilia is any one of the following: C1) Nucleic acid molecules that inhibit, reduce, or downregulate the expression of the LprR protein-encoding gene in claim 1. C2) expresses the gene encoding the nucleic acid molecule described in C1). C3) contains the expression cassette of the gene described in C2). C4) A recombinant vector containing the gene described in C2), or a recombinant vector containing the expression cassette described in C3). C5) A recombinant microorganism containing the gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4).

4. The application according to claim 2, characterized in that: The reagent used to dephosphorylate the LprR protein encoding gene in the Stenotrophomonas maltophilia genome is a reagent that causes a mutation at position 52 (D) of the LprR protein amino acid sequence.

5. The application according to any one of claims 1-4, characterized in that: The improvement of Stenotrophomonas maltophilia's predation ability refers to enhancing Stenotrophomonas maltophilia's predation ability against Xanthomonas.

6. The substance that inhibits, reduces, or downregulates the content or activity of LprR protein as described in any one of claims 1-5, or the substance that inhibits, reduces, or downregulates the expression of the LprR protein-encoding gene.

7. A method for improving the predatory ability of Stenotrophomonas maltophilia, comprising the following steps: inhibiting or reducing or downregulating the content or activity of the LprR protein in Stenotrophomonas maltophilia as described in claim 1, or inhibiting or reducing or downregulating the expression of the gene encoding the LprR protein in Stenotrophomonas maltophilia as described in claim 1, thereby improving the predatory ability of Stenotrophomonas maltophilia.

8. A method for improving the predatory ability of Stenotrophomonas maltophilia, comprising the following steps: knocking out the full length or part of the LprR protein-coding gene of Stenotrophomonas maltophilia as described in claim 1 to inhibit, reduce or downregulate the expression of the LprR protein-coding gene of Stenotrophomonas maltophilia as described in claim 1, thereby improving the predatory ability of Stenotrophomonas maltophilia.

9. A method for improving the predatory ability of Stenotrophomonas maltophilia, comprising the following steps: dephosphorylating the LprR protein encoding gene as described in claim 1 in the Stenotrophomonas maltophilia genome to improve the predatory ability of Stenotrophomonas maltophilia.