CRISPR-Cas3 (clustered regularly interspaced short palindromic repeats-associated 3) system for targeted removal of IMP-4 drug-resistant gene

Abstract

The invention provides an sgRNA molecule of a targeted IMP-4 gene and a biomacromolecular compound containing the sgRNA molecule, the biomacromolecular compound forms a CRISPR-Cas3 system for targeted removal of the IMP-4 drug-resistant gene, and the invention also provides a method for targeted removal of the IMP-4 drug-resistant gene in a strain by using the system. According to the CRISPR-Cas3 system provided by the invention, the directed gene clearance rate of the strain carrying the IMP-4 drug-resistant gene can reach 100%. The minimum inhibitory concentration of the Escherichia coli subjected to targeted removal of IMP-4 to meropenem is averagely reduced by 71.11 times compared with that of a strain without targeted removal of IMP-4.

Description

Technical Field

[0001] This invention discloses a CRISPR-Cas3 system for targeted removal of target genes, belonging to the field of gene editing technology. Background Technology

[0002] Carbapenems are broad-spectrum β-lactamase-killing antibiotics used clinically to treat serious infections. Stable against β-lactamases, they are considered one of the most important antibiotics for human anti-infective therapy. However, due to the global overuse of carbapenems, the number and types of resistant bacteria are gradually increasing. Klebsiella pneumoniae is relatively common among carbapenem-resistant bacteria. Klebsiella pneumoniae's resistance to carbapenems is due to the production of IMP-type carbapenemases, with the IMP-4 genotype being the most common and frequently observed in my country.

[0003] Due to the slow pace of new antibiotic development and the ease with which bacteria develop resistance to antibiotics, new technological solutions are urgently needed to address the escalating problem of bacterial resistance. Furthermore, new technologies are required to block the horizontal transfer of resistance genes. Therefore, directly targeting and eliminating resistance genes carried by pathogens to eradicate bacterial resistance is of paramount importance.

[0004] The purpose of this invention is to provide a kit for targeting and eliminating the IMP-4 resistance gene carried by bacteria using the CRISPR-Cas3 system, and a method for targeting and eliminating the IMP-4 resistance gene carried by bacteria using the kit. Summary of the Invention

[0005] To achieve the above objectives, this invention first provides an sgRNA molecule targeting the IMP-4 gene, wherein the sgRNA molecule targets the spacer downstream of PAM as shown in SEQ ID NO.1. The IMP-4 gene described in this invention refers to the gene encoding type 4 IMP-type carbapenemases (genbank ID MF344566).

[0006] The type 4 IMP carbapenemase induces resistance in Klebsiella pneumoniae to carbapenem antibiotics. The sgRNA (single guide RNA) described in this invention refers to an RNA molecule formed by the artificial fusion of a scaffold-functioning tracRNA and a specific crRNA. The sgRNA guides a CRISPR-associated protein (Cas protein) to target and cleave the target gene. The target gene sequence is shown in SEQ ID NO.1, and the sequence is a spacer sequence located at 290bp-323b in the IMP-4 gene. This sequence is the specific sequence in the IMP-4 resistance gene targeted by the sgRNA described in this invention. The spacer is an antisense strand immediately 34 bp upstream of the PAM (proximal spacer motif), where PAM in this invention is GAA.

[0007] In a preferred embodiment, the sequence of the sgRNA molecule is shown in SEQ ID NO.2.

[0008] Secondly, this invention provides a complex containing the aforementioned sgRNA molecule, wherein the biomacromolecule complex further contains a CRISPR-related protein. The complex constitutes a CRISPR-Cas system, where the sgRNA recognizes spacer sequences and PAM sequences specifically complementary to the crRNA, and the CRISPR-related protein performs the cleavage or editing function of the targeted gene.

[0009] In a preferred embodiment, the CRISPR-related protein is a Cas3 protein, and the CRISPR-Cas system is a CRISPR-Cas3 system. In this invention, the CRISPR-Cas3 system uses GAA as the PAM (protospacer adjacent motif) and the spacer is an antisense strand immediately upstream of the PAM (34 bp fragment).

[0010] More preferably, the sequence of the Cas3 protein is shown in SEQ ID NO. 9.

[0011] Secondly, the present invention provides a plasmid encoding the aforementioned complex, the plasmid containing the aforementioned sgRNA molecule and a DNA molecule encoding the Cas3 protein. In one specific embodiment of the present invention, the plasmid is pCas3-i constructed from the pCas3 plasmid.

[0012] Finally, this invention provides a method for targeting and eliminating the bacterial IMP-4 gene using the aforementioned plasmid, the method comprising the step of transforming the plasmid into bacteria whose IMP-4 gene needs to be eliminated. In this invention, the bacteria include any bacteria containing the IMP-4 gene, such as, but not limited to, *Escherichia coli*, *Klebsiella pneumoniae*, *Acinetobacter baumannii*, and *Pseudomonas aeruginosa*.

[0013] In a preferred embodiment, the method further includes a step of rhamnose induction in bacteria transformed into the plasmid.

[0014] In a more preferred embodiment, the method further includes the step of identifying the IMP-4 gene in the rhamnose-induced bacteria.

[0015] In a particularly preferred embodiment, the identification is a PCR identification, and the sequences of the upstream and downstream primers for the PCR identification are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0016] The sgRNA molecule targeting the IMP-4 gene provided by this invention, along with the CRISPR-Cas system pCas3-i plasmid carrying the sgRNA molecule, can perform targeted gene clearance of strains carrying the IMP-4 resistance gene, achieving a clearance rate of 100%. After 2 hours of CRISPR-Cas3 system treatment, pCas3-i cleared approximately 99.35% of the resistance plasmid pIMP-4; after 4 hours, the experimental group of pCas3-i cleared approximately 99.86% of the resistance plasmid pIMP-4. Furthermore, the CRISPR-Cas3 system continued to function for the next 28 hours, maintaining a clearance efficiency of 99.96%, with the copy number of the resistance plasmid remaining at an extremely low level; no rebound in the copy number of the resistance plasmid was observed. The minimum inhibitory concentration of meropenem in E. coli that was targeted to clear IMP-4 was reduced by an average of 71.11 times compared to that of E. coli that was not targeted to clear IMP-4, demonstrating the application prospects of the sgRNA molecule provided by this invention and the CRISPR-Cas system carrying the sgRNA molecule in targeted clearance of the IMP-4 gene. Attached Figure Description

[0017] Figure 1 Map of the CRISPR-Cas3 system plasmid pCas3-i targeting the IMP-4 gene; Figure 2 PCR detection and agarose gel electrophoresis results of pCas3-i targeting the elimination of IMP-4 resistance genes; Figure 3 Time curve of pCas3-i plasmid targeting and clearing IMP-4 resistance gene; Figure 4 Statistical results of colony counts of drug-resistant model bacteria transformed with pCas3-i and control materials in petri dishes containing meropenem antibiotic; Figure 5Statistical results of the minimum inhibitory concentration of meropenem E-test antimicrobial susceptibility test strips against drug-resistant model bacteria transformed with pCas3-i and control materials. Detailed Implementation

[0018] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result of the description. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0019] Example 1. Construction of a targeted CRISPR-Cas3 system 1. Experimental Materials The pCas3 plasmid (stored and sold by Addgene, Inc. in the United States, and purchased by its Chinese agent, Zhongyuan Company) contains the amino acid sequence of the Cas3 protein as shown in SEQ ID NO.9 and the nucleic acid coding sequence as shown in SEQ ID NO.10.

[0020] PCR and nucleic acid gel electrophoresis reagents: 2×Gold Star Best Master Mix (CWBIO), original imported Spanish agarose (SANTAIBIO), 50×TAE buffer (Solarbio), standard molecular weight nucleic acid DNA marker DL2000, nucleic acid dye (Biotium).

[0021] Molecular cloning-related reagents: Restriction endonuclease Bsa I (New England Biolabs, Beijing LTD), Rapid ligation kit (New England Biolabs, Beijing LTD), 10×CutSmart Buffer (New England Biolabs, Beijing LTD), ddH2O, 6×Loading Buffer (TaKaRa), Promega genuine Wizard® SV Gel and PCR Clean-Up System (Promega), QIAGEN Plasmid Plus Midi Kit (QIAGEN), SOC sterile liquid culture medium (Sangon Biotech), TransEasy ultra-efficient competent cell preparation kit (GeneCopoeia), Qubit™ 1×dsDNA HS and BR Assay Kits double-stranded DNA detection kit (Invitrogen).

[0022] Reagents for real-time PCR: Probe qPCR Mix (TaKaRa), nucleic acid extraction or purification reagents (Hangzhou Borui Technology Co., Ltd.).

[0023] Reagents for drug susceptibility testing: BD Phoenix ID Broth, Phoenix drug susceptibility broth tubes, Phoenix drug susceptibility indicators, and Phoenix NMIC / ID-4 were all purchased from BD Biosciences. The drug susceptibility E-test test strips were from Liofilchem.

[0024] Culture media: LB liquid medium, LB solid medium, and MH culture powder were purchased from OXID.

[0025] Meropenem powder: TMRM / Tanmo Quality Inspection.

[0026] Gentamicin: MACGENE, cell culture grade, 50 mg / mL.

[0027] Rhamnose: Mreda, purity: HPLC ≥ 98%.

[0028] Primers and probes were synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.

[0029] 2. Design of the target spacer for the IMP-4 resistance gene CRISPR-Cas3 system The pCas3 plasmid carries a CRISPR-Cas3 system with GAA as the PAM and the spacer being the antisense strand immediately upstream of the PAM (34 bp). The full sequence of the IMP-4 resistance gene (genbank ID MF344566) was downloaded from the NCBI website, and the following sequence was selected as the target spacer for the IMP-4 gene CRISPR-Cas3 system: 5'ATAGTGACAGCACGGGCGGAATAGAGTGGCTTAA 3' (SEQ ID NO.1) The sequence is located in the spacer interval sequence of the IMP-4 gene from 290bp to 323b, and is a specific sequence in the IMP-4 resistance gene that is targeted by the sgRNA described in this invention.

[0030] 3. Synthesize spacer single-chain (1) Using this specific spacer sequence as a template, synthesize reverse complementary oligonucleotide single strands. Since the pCas3 cloning site contains a Bsa I restriction site, the synthesized reverse complementary oligonucleotide single strands need to have corresponding restriction sites. Add GAAAC to the 5' end and G to the 3' end of the forward oligonucleotide sequence, and add GCGAC to the 5' end and G to the 3' end of the reverse oligonucleotide. After annealing, the forward and reverse oligonucleotides can form fragments with Bsa I restriction sites at both ends. The synthesized sequence is as follows: iF: 5' GAAAC ATAGTGACAGCACGGGCGGAATAGAGTGGCTTAA G 3' (SEQ ID NO.3) iR: 5' GCGAC TTAAGCCACTCTATTCCGCCCGTGCTGTCACTAT G 3' (SEQ ID NO.4) Table 1. Phosphorylation and annealing reaction system of spacer oligonucleotide chains

[0031] Reaction conditions: Place the mixture in a PCR instrument and anneal at 95 °C for 20 mins. Immediately after annealing, turn off the PCR instrument and allow it to cool naturally for 90 mins. Place the annealed product on ice.

[0032] (2) Weigh 0.5 g of agar powder into a 100 mL Erlenmeyer flask, add 50 mL of 1×TAE solution into the Erlenmeyer flask, place it in a microwave oven and add until the agar powder dissolves, add 5 μL of nucleic acid dye (1:10000), mix well and pour into a gel mold and wait 30 mins for it to solidify, mix the annealing product with 2 μL of 6×loading buffer and add it all to the gel electrophoresis lane, set the voltage to 150 V, the current to 400 mA, and the electrophoresis time to 30 mins.

[0033] (3) The electrophoretic bands that meet the recovery criteria were cut off using an ultrathin blue light gel cutter and placed in a 2 mL EP tube. The successfully annealed spacer double-stranded DNA sequence was recovered using a DNA gel recovery kit. Positive link: 5' GAAAC ATAGTGACAGCACGGGCGGAATAGAGTGGCTTAA G 3' anti-link: 3' G TATCACTGTCGTGCCCGCCTTATCTCACCGAATT CAGCG 5' Measure and record the concentration of the recovered DNA.

[0034] 4. Preparation and recovery of linearized pCas3 vector (1) The pCas3 plasmid was digested with restriction endonuclease BsaⅠ. The mixing system is as follows: Table 2. pCas3 digestion system

[0035] The enzyme digestion products were placed in a 37 ℃ four-well digital display constant temperature water bath for overnight digestion.

[0036] (2) Weigh 1.5 g of agar powder into a 300 mL Erlenmeyer flask, add 150 mL of 1×TAE solution into the Erlenmeyer flask, place it in a microwave oven and add until the agar powder dissolves, add 15 μL of nucleic acid dye (1:10000), mix well and pour into a gel mold and wait 30 mins for it to solidify, mix the enzyme digestion product with 5.5 μL of 10×loading buffer and add it all to the gel electrophoresis lane, set the voltage to 150 V, the current to 400 mA, and the electrophoresis time to 30 mins.

[0037] (3) Cut the electrophoretic bands that meet the recovery criteria using an ultra-thin blue light gel cutter and place them in a 2 mL EP tube. Use a DNA gel recovery kit to recover the linearized plasmid vector, and measure and record the concentration of the recovered DNA.

[0038] 5. Ligation of spacer double-stranded fragments with linearized pCas3 vectors (1) The purified spacer fragment and the linearized pCas3 plasmid vector were ligated using the NEB rapid ligation kit. The ligation system is as follows: Table 3. pCas3 enzyme ligation system

[0039] Place the above mixture in a PCR instrument, set the temperature to 25 °C, incubate for 4 h, and immediately place it on ice after the incubation period.

[0040] (2) Mix the ligation product thoroughly with DH5α competent cells and place on ice for about 30 mins.

[0041] (3) Place the mixture from the previous step in a 42°C four-hole digital display constant temperature water bath for about 90 seconds, and then place it on ice for about 3 minutes.

[0042] (4) Take 900 μL of SOC medium preheated to 37 ℃ and add it to the mixture of competent cells and ligation products, and place it in a constant temperature shaker at 37 ℃ and shake at 220 rpm for 1-2 h.

[0043] (5) Centrifuge the bacterial culture at 3000 rpm for 5 mins using a low-temperature centrifuge, discard 800 μL of supernatant, mix the remaining precipitate by pipetting, spread it all onto LB solid plates containing gentamicin resistance (20-50 μg / mL), and incubate in a constant temperature incubator at 37℃ for 12-14 h.

[0044] (6) Using a 10 μL pipette tip, pick up a single colony from the previous step and place it in 50 μL of PBS. Mix well by pipetting. Add 5 μL of the suspension to the PCR system. Send the PCR product for sequencing to identify whether the spacer sequence has been constructed into the pCas3 vector. The identification primer sequences are: pCas3-F 5'-GTCGATTTTTCAAGATACAGCGTG-3' (SEQ ID NO.5) pCas3-R 5'-ATTTACCCAAgTCATgCAACAgAC-3' (SEQ ID NO.6) Table 4. PCR reaction system

[0045] Table 5. PCR reaction conditions

[0046] 6. Construct a CRISPR-Cas3 system plasmid targeting the IMP-4 gene, named pCas3-i.

[0047] The pCas3-i plasmid inserts a spacer targeting the IMP-4 resistance gene. Upon rhamnose induction, it transcribes a targeting sgRNA (SEQ ID NO.2), which guides the nuclease complex expressed by the CRISPR-Cas3 system to cleave the IMP-4 resistance gene target. The plasmid map is shown below. Figure 1 As shown. The rhaB promoter is a rhamnose-induced promoter derived from the E. coli rhamnose regulator, and the DR (Direct Repeat) sequence is a repeat sequence located at both ends of the spacer in the CRISPR cluster. Both the rhaB promoter and DR are sequences from the original pCas3 vector shoelace.

[0048] Example 2. Validation of the clearance of IMP-4 resistance genes by a targeted CRISPR-Cas3 system. 1. Colony PCR validation of the CRISPR-Cas3 system's ability to eliminate the drug resistance gene IMP-4. The constructed pIMP-4 resistance plasmid was transformed into *E. coli* DH5α competent cells to establish a drug-resistant model bacterium. The targeting pCas3-i plasmid (experimental group) and pCas3 plasmid (control group) were transformed into *E. coli* model bacteria carrying the pIMP-4 resistance plasmid, respectively. Transformation procedure: First, *E. coli* model bacteria competent cells carrying the pIMP-4 resistance plasmid were prepared using an *E. coli* competent cell preparation kit (GeneCopoei brand). The pCas3-i plasmid and pCas3 control plasmid were incubated with the model bacteria competent cells on ice for 30 min, followed by heat shock for 90 s, and then incubated on ice again for 2 min. Finally, all bacterial cultures were plated onto LB agar plates containing gentamicin.

[0049] After induction with rhamnose in the culture medium, the pCas3 plasmid transformed into bacterial cells transcribed sgRNA, guiding the CRISPR-Cas3 system to perform targeted cleavage. Transformant colonies were picked and PCR was used to detect whether the pCas3 plasmid had transformed into bacteria, and the clearance of IMP-4 resistance plasmids. Figure 2 As shown, after the IMP-4 resistance gene was targeted and cleaved by the CRISPR-Cas3 system, no IMP-4 electrophoretic bands were detected in the five transformants of the experimental group, while the IMP-4 gene was still detected in the control group colonies. This indicates that the clearance rate of the IMP-4 resistance gene by the CRISPR-Cas3 system was 100% (5 / 5). The primer sequences used for colony PCR were: pCas3-F 5'GTCGATTTTTCAAGATACAGCGTG 3' (SEQ ID NO.5) pCas3-R 5'ATTTACCCAAgTCATgCAACAgAC 3' (SEQ ID NO.6) IMP-4 F: 5'AAAACTTGATGAAGGCGTTTATGTT 3' (SEQ ID NO.7) IMP-4 R: 5'AATGTAAGTTTTCAAGAGTGATGCG 3' (SEQ ID NO.8) 2. The clearance efficiency of the CRISPR-Cas3 system for drug-resistant plasmids This invention uses the addition of rhamnose to induce sgRNA transcription as the first time point (0 h). Nucleic acid was extracted from bacterial culture, and quantitative real-time PCR was used to analyze the drug resistance genes carried by the bacteria, detecting changes in intracellular pIMP-4. As shown in Figure 3, after 2 h of treatment with the CRISPR-Cas3 system, the pIMP-4 copy number in the experimental group was reduced by 99.35% compared to the control group, indicating that pCas3-i achieved 99.35% clearance of the drug-resistant plasmid pIMP-4. After 4 h of treatment with the CRISPR-Cas3 system, the experimental group's pCas3-i cleared 99.86% of the drug-resistant plasmid pIMP-4, and the CRISPR-Cas3 system continued to function for the next 28 h, achieving a clearance efficiency of 99.96%. The copy number of the drug-resistant plasmid remained at an extremely low level, and no rebound in the copy number of the drug-resistant plasmid was observed.

[0050] Example 3. Evaluation of the efficacy of bacterial resistance eradication 1. Colony counting verifies the reduction in the number of drug-resistant bacteria. The drug-resistant model bacteria transformed by the CRISPR-Cas3 system were plated onto petri dishes containing meropenem (4 μg / mL). A cotton swab was used to pick up the bacterial suspension and spread it across the entire petri dish. The dish was then rotated 60° and the plating was repeated five times. The dishes were then incubated overnight at 37°C. Colony counts for the experimental and control groups were as follows: Figure 4 The results showed that the number of colonies on the experimental group plates was significantly lower than the average number of bacteria in the control group culture dishes. The ratio of control group to experimental group was 6,350,000:0, indicating that the CRISPR-Cas3 system can restore the bactericidal efficacy of meropenem antibiotic against drug-resistant model bacteria.

[0051] 2. Drug susceptibility testing verifies the elimination of bacterial resistance. The changes in the MIC values ​​of drug-resistant bacteria after the IMP-4 resistance gene was cleared using the Liofilchem ​​E-test meropenem susceptibility test strip were detected using the CRISPR-Cas3 system. A swab was used to apply the transformed bacterial suspension to the entire culture dish. The dish was then rotated 60° to repeat the application, a process repeated five times. The E-test susceptibility test strip was then carefully placed in the center of the dish and incubated overnight at 37°C. The inhibition rate on the test strip was then observed. Figure 5As shown, the meropenem E-test susceptibility test strip experiment demonstrated that CRISPR-Cas3 targeted cleavage of IMP-4 to sensitize drug-resistant E. coli. Compared with the control group, the MIC value (minimum inhibitory concentration) of the experimental group decreased by an average of 71.11 times (control group: 28 μg / mL; experimental group: 0.39 μg / mL), indicating that the drug-resistant model bacteria showed a significant reduction in resistance to meropenem after being treated by the CRISPR-Cas3 system.

Claims

1. An sgRNA molecule targeting the IMP-4 gene, characterized in that, The sgRNA molecule targets the spacer, a sequence downstream of PAM and GAA, as shown in SEQ ID NO.

1.

2. The sgRNA molecule according to claim 1, characterized in that, The sequence of the sgRNA molecule is shown in SEQ ID NO.

2.

3. A biomacromolecule complex containing the sgRNA molecule of claim 1 or 2, characterized in that, The biomacromolecule complex also contains CRISPR-related proteins.

4. The biomacromolecule complex according to claim 3, characterized in that, The CRISPR-related protein is the Cas3 protein.

5. The biomacromolecule complex according to claim 4, characterized in that, The sequence of the Cas3 protein is shown in SEQ ID NO.

9.

6. A plasmid encoding the biomacromolecule complex of claim 5, characterized in that, The plasmid contains the sgRNA molecule as described in claim 1 or 2 and a DNA molecule encoding the Cas3 protein.

7. A method for targeting and eliminating the bacterial IMP-4 gene using the plasmid as described in claim 6, characterized in that, The method includes the step of transforming the plasmid into bacteria from which the IMP-4 gene is to be eliminated.

8. The method according to claim 7, characterized in that, The method further includes a step of rhamnose induction in bacteria transformed into the plasmid.

9. The method according to claim 8, characterized in that, The method also includes a step of identifying the IMP-4 gene in bacteria induced by rhamnose.

10. The method according to claim 9, characterized in that, The identification is a PCR identification, and the sequences of the upstream and downstream primers for the PCR identification are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

Images