MiRNA for regulating persimmon grafting selective affinity gene and application thereof

Abstract

The invention discloses miRNA for regulating and controlling a persimmon grafting selective affinity gene and application of the miRNA, and relates to the technical field of botany, the miRNA comprises miR8342, the sequence of the miR8342 is shown as SEQIDNO.1; the serial number of the target gene DkGH9B3 of the miR8342 in a genome is FY15.5 G009990.1, the sequence of the target gene DkGH9B3 of the miR8342 is as shown in SEQ ID NO.2, and the miR8342 acts on the target gene FY15.5 G009990.1. According to the application disclosed by the invention, 5 'RLM-RACE and GUS dyeing experiments prove that the miR8342 has a shearing effect on a target gene DkGH9B3, so that the miR8342 has a potential application value in persimmon grafting selective affinity regulation and control.

Description

Technical Field

[0001] This invention relates to the field of plant science, specifically to a miRNA that regulates selective affinity genes in persimmon grafting and its applications. Background Technology

[0002] Persimmons originated in my country and have abundant varieties in the Yellow River Basin, the Yangtze River Basin and areas south of it. Fresh persimmons are rich in nutrients and can be made into dried persimmons, dried fruit, candied fruit, fruit vinegar, fruit wine, and fruit juice, in addition to being eaten fresh. Given their early fruiting, long lifespan, high yield and high profitability, the development of the persimmon industry is of great significance to the current rural industrial revitalization and ecological civilization construction.

[0003] Persimmon trees are primarily propagated through grafting, a technique that demands considerable skill. Required rootstock characteristics include abundant seeds, high germination rate, well-developed root system, dwarfing ability, salt tolerance, and graft compatibility with the scion variety. Diospyros kaki, with its cold resistance and wide adaptability, has been considered an excellent rootstock for grafting persimmons in my country since ancient times. However, some high-quality varieties, such as 'Fuyou' and 'Taiqiu' from the "Fuyou" series, exhibit poor graft compatibility with Diospyros kaki. The phenomenon of "grafting selective compatibility" in intraspecific persimmon grafting has hindered the large-scale cultivation and promotion of high-quality sweet persimmon varieties like 'Fuyou' in my country. The molecular mechanisms underlying this phenomenon require further investigation.

[0004] Using 'Fuyu' and 'Jiro' as scions and *Persimmon spp.* as rootstock, two grafting combinations, one compatible and one incompatible, were constructed as research materials. Histological observation, transcriptomics data, small RNA sequencing data, and genomic comparative analysis were used to identify the persimmon grafting compatibility gene FY15.5G009990.1 and a miRNA that may regulate it. Therefore, identifying the specific miRNA regulating the FY15.5G009990.1 gene in persimmon and verifying the targeted regulatory relationship between them is of great significance for further clarifying the regulatory network of persimmon grafting selective compatibility and elucidating the molecular mechanism of persimmon grafting selective compatibility. Summary of the Invention

[0005] The purpose of this invention is to provide a miRNA that regulates selective affinity genes in persimmon grafting and its application; The objective of this invention is achieved through the following technical solutions: This invention provides a specific miRNA that regulates selective affinity genes in persimmon grafting: including miR8342, the sequence of which is shown in SEQ ID NO.1; the target gene of miR8342, DkGH9B3, is numbered FY15.5G009990.1 in the genome, and its sequence is shown in SEQ ID NO.2, and miR8342 acts on the target gene FY15.5G009990.1.

[0006] The sequence of miR8342 is shown in SEQ ID NO.1: 5'-GCTGCTGCTGCTCCCTGGTAT-3';

[0007] Compared with the prior art, the beneficial effects of the present invention are: The miRNA that regulates the selective affinity gene for persimmon grafting and its application were verified by 5'RLM-RACE and GUS staining experiments, which showed that miR8342 has a cleavage effect on the target gene DkGH9B3. Attached Figure Description

[0008] Figure 1 This invention provides an example of a 5'RLM-RACE experiment to verify the splicing relationship between the target gene and miRNA. Figure 2 GUS staining of DkGH9B3 in tobacco in Example 2 of this invention; Figure 3 This refers to the GUS activity of DkGH9B3 in tobacco in Example 2 of the present invention. Detailed Implementation

[0009] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless otherwise specified, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field, and the reagents and materials used in the following embodiments are all commercially available.

[0010] like Figures 1-3 As shown, the present invention provides a technical solution: a miRNA that regulates the grafting affinity gene of persimmon and its application, comprising miRNA miR8342, the sequence of miR8342 is shown in SEQ ID NO.1, the target gene of miR8342 is numbered FY15.5G009990.1 in the genome, the sequence of the target gene FY15.5G009990.1 is shown in SEQ ID NO.2, miR8342 acts on the target gene FY15.5G009990.1, and miR8342 regulates the application of the persimmon grafting affinity gene.

[0011] Example 1: 5'RLM-RACE experiment; (1) Select 'Fuyu' as the scion and 'Junqianzi' as the rootstock for micro-grafting. Take the graft union 7, 14, 21 and 28 days after grafting and store it at -80℃ for later use.

[0012] (2) Grafting junctions were collected at different grafting stages. RNA was extracted using the RNAplantPlusKit (Tiangen Biotech Ltd., Beijing, China) and cDNA was synthesized using the PrimeScript™ RTreagent Kit with gDNA Eraser (TaKaRa, Japan).

[0013] (3) Use the synthesized cDNA as a template for Sussou PCR; The first round of amplification primers are 5'RACEOuterPrimer:GCTGATGGCGATGAATGAACACTG (SEQ ID NO. 3-1) and OuterGeneSpecificPrimer:CTCCCTGTGTATATCGTGT (SEQ ID NO. 3-2).

[0014] The PCR reaction system consisted of 25 µL PrimeSTAR, 1 µL cDNA, 1.5 µL forward and reverse primers, and RNAfree H2O added to a final volume of 50 µL.

[0015] The quantitative PCR reaction conditions were: 94℃ for 3 min, followed by 94℃ for 30 s, 58℃ for 30 s, 72℃ for 40 s, for 35 cycles, and then 72℃ for 7 min.

[0016] The PCR product obtained from the first round of amplification was diluted 20-fold and used as a template for the second round of amplification.

[0017] The second round of amplification primers are 5'RACEInnerPrimer: CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG (SEQ ID NO. 3-3) and InnerGeneSpecificPrimer: TTTTGGCAGTCCGCAATAACG (SEQ ID NO. 3-4).

[0018] The PCR reaction system consisted of 25 µL PrimeSTAR, 1 µL of the first-round diluted product, 1.5 µL of forward and reverse primers, and RNAfree H2O added to a final volume of 50 µL.

[0019] The quantitative PCR reaction conditions were: 94℃ for 3 min, followed by 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, for 35 cycles, and then 72℃ for 7 min.

[0020] (4) 1% agarose gel electrophoresis was used to detect whether the PCR reaction product had any impurities, the size of the band, and the brightness of the band. If the PCR reaction product had no impurities, the size of the band met the expected size, and the band was bright, the PCR amplification product was purified and recovered using the AxyPrep-96 DNA gel recovery kit (Axygen, USA). The specific operation steps were as follows: ① Cut off the agarose gel containing the target DNA band under ultraviolet light, and blot the liquid off the surface of the gel with a paper towel; ② Add 3 times the gel volume of Buffer DE-A, mix well, and then incubate in a 75°C water bath to aid dissolution (about 7-8 minutes). During this time, gently invert and mix several times until the gel block is completely melted (at which point the solution is red). ③ Add 0.5 times the volume of BufferDE-A to BufferDE-B and mix thoroughly (the solution will turn yellow at this point; mix thoroughly to ensure a homogeneous yellow solution). When the isolated DNA fragment is less than 400 bp, add another gel volume of isopropanol. ④ Take the mixture from step 3 and transfer it to a DNA preparation tube (placed in a 2 mL centrifuge tube). Centrifuge at 12000 r / min for 1 min and discard the filtrate. ⑤ Place the preparation tube back into the 2mL centrifuge tube, add 500μL BufferW1, centrifuge at 12000r / min for 30s, and discard the filtrate; ⑥ Place the preparation tube back into a 2mL centrifuge tube, add 700μL BufferW2, centrifuge at 12000r / min for 30s, and discard the filtrate; wash again with 700μL BufferW2 in the same way, and centrifuge at 12000r / min for 1min. ⑦ Place the preparation tube back into the 2mL centrifuge tube and centrifuge at 12000r / min for 1min; ⑧ Place the preparation tube in a clean 1.5 mL centrifuge tube, add 25-30 μL of LEluent or deionized water to the center of the membrane, and let it stand at room temperature for 1 min. Centrifuge at 12000 r / min for 1 min to elute the DNA, and store at -20℃ for later use.

[0021] (5) The purified and recovered DNA product was ligated and transformed into the pEASY-BluntSimple vector (TransGenBiotech). 4 µL of the purified and recovered product was added to 1 µL of the pEASY-BluntSimple ligation vector and reacted at room temperature for 15 min. After the reaction, the centrifuge tubes were placed on ice. The ligation product was then transformed into E. coli competent cells Trans1-T (TransGen).

[0022] ① Add 5 μL of the ligation product to 50 μL of E. coli competent Trans1-T cells thawed in an ice bath, mix gently, and place in an ice bath for 30 min; ② Heat shock in a 42℃ water bath for 30 seconds, then quickly transfer the centrifuge tube to an ice bath for 2 minutes; ③ Add 250 μL of sterile LB (Luria-Bertani) medium (without antibiotics) to the centrifuge tube, mix well, and place in a shaker at 37°C for 1 h at 200 r / min to allow the bacteria to recover. ④ Centrifuge at 12000r / min for 1min to remove excess LB, retain 100μL of recovered competent cells, mix well and spread evenly on LB solid medium containing the corresponding antibiotic, invert the culture dish and place it in a 37℃ constant temperature incubator for overnight culture; ⑤ 12-16 hours after transformation, pick single colonies from the plate and transfer them to centrifuge tubes containing 500 μL LLB liquid medium with the corresponding antibiotic. Incubate at 37°C with shaking until the culture becomes turbid, and then identify positive clones.

[0023] ⑥ PCR system for positive clone identification: 5µL TaqMasterMix, 1µL cDNA, 0.25µL forward primer F: CAGGAAACAGCTATGAC (SEQ ID NO. 3-5), 0.25µL reverse primer: TGACCGGCAGCAAAATG (SEQ ID NO. 3-6), plus RNAfree H2O to a final volume of 10µL.

[0024] ⑦ The PCR reaction conditions for positive clone identification are: 94℃ for 3 min, followed by 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, run for 35 cycles, and then 72℃ for 5 min.

[0025] ⑧ Sequencing of the positive bacterial culture.

[0026] Sequencing analysis of the target fragment revealed that the cleavage site of miR8342 on DkGH9B3 is located at the 10th nucleotide at the 5' end of the complementary sequence of the two.

[0027] Example 2: GUS staining and GUS activity assay; (1) Carrier construction; ① Design primers containing the restriction enzyme sites XbalI and BamHI. The primer sequences are as follows: F: GAGAACACGGGGGACTCTAGAATGGCTTTGAGATGGGCAGC; (SEQ ID NO:4-1); R: GGACTGACCACCCCGGGGATCCAGGGGTCTTGCTCCCTGCA; (SEQ ID NO:4-2); The adapter sequence of DkGH9B3 was amplified by PCR. The PCR program was 94℃ for 3 min, 94℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, for 35 cycles, with an additional extension at 72℃ for 5 min. The PCR product was recovered by gel electrophoresis and ligated into the GUS vector by homologous recombination to construct a 35S:DkGH9B3:GUS fusion plasmid. After confirming the sequence accuracy by sequencing, the recombinant plasmid and the control were transformed into Agrobacterium GV3101 using a heat shock method.

[0028] ② Design primers containing the restriction enzyme sites XbalI and BamHI. The primer sequences are as follows: F: GAGAACACGGGGGACTCTCTAGACCAGGCCCGAGGGAGCGC; (SEQ ID NO:4-3); R: GGACTGACCCGGGGACTTCCTCAAGCCGCAACGTATCC; (SEQ ID NO:4-4); The adapter sequence of miR8342 was amplified by PCR. The PCR program was 94℃ for 3 min, 94℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, for 35 cycles, with an additional extension at 72℃ for 5 min. The PCR product was recovered by gel electrophoresis and ligated into a plant overexpression vector by homologous recombination to construct a 35S:miR8342: fusion plasmid. After confirming the sequence accuracy by sequencing, the recombinant plasmid and the control were transformed into Agrobacterium GV3101 using a heat shock method.

[0029] (2) Transformation of competent Agrobacterium; ① Remove Agrobacterium competent cells (GV3101) from the -80℃ freezer and freeze-thaw them on ice for 5-10 minutes; ②When the competent cells are completely melted, add 3-4µL of plasmid, quickly place it on ice for 5min, then quickly freeze it in liquid nitrogen for 5min, then quickly take it out and heat shock it in a 37℃ water bath for 5min, and finally take it out and put it in an ice bath for 5min. ③ Add 800µL of liquid LB medium (antibiotic-free) to the competent cells, place them in a shaker at 28℃ and shake at 250r / min for 2-3h to allow Agrobacterium to recover; ④ During the shaking process, add the corresponding antibiotic on the carrier to the solid LB medium cooled to 50°C, transfer it to a sterile petri dish, and wait for it to solidify; ⑤ When the bacterial solution turns golden yellow, remove the bacterial solution and centrifuge it at 8000 r / min for 2 min; ⑥ Discard 800µL of supernatant, and use a sterile pipette tip to mix the remaining bacterial culture; spread it evenly on the prepared solid LB medium, seal the plate, and incubate upside down at 28℃ for 48-60h; ⑦ After the colonies have grown, single clones are picked and positive PCR tests are performed. Positive plaques are then propagated and stored at -80℃ for later use.

[0030] (3) Transient expression in tobacco leaves; ① Add a single Agrobacterium vector containing DkGH9B3 and an empty control to 1 mL of LB broth containing the corresponding antibiotic and incubate at 28°C for 1 day; then add to 50 mL of LB broth containing the corresponding antibiotic and incubate overnight at 28°C and 250 rpm until OD. 600 The bacterial concentration should be 1.6-1.8 or the bacterial suspension should turn golden yellow; collect the bacterial cells by centrifugation at 4000×g for 10 min at 25℃; resuspend the bacterial suspension in osmotic buffer until the OD concentration is adjusted to 1.6-1.8. 600 The concentration was 0.2, and the permeate was sterile double-distilled water containing 10 mM MgCl2, 10 mM ES (pH=5.6) and 150 μM acetylsylgenone. Before injection infection, the resuspended bacterial solution was mixed in a certain proportion and cultured at 28℃ and 100 r / min for 3 h to pre-express genes involved in T-DNA transfer, thereby improving the infectivity of Agrobacterium.

[0031] ② The tobacco leaves of 6-week-old seedlings were injected using the injection permeation method. After the transformed tobacco was cultured for 2-3 days, the tobacco leaves were removed and placed in a petri dish. GUS dye solution was poured in, and the leaves were vacuum permeated for 15 minutes. The leaves were then placed in a 37°C incubator overnight for storage. The leaves were washed with 75% ethanol until the decolorization of the leaves was completed.

[0032] ③ Inject the GUS into 6-week-old tobacco leaves using the injection permeation method. After the transformed tobacco has been cultured for 2-3 days, take samples from the injection site using a punch and determine the GUS activity using a GUS activity assay kit.

[0033] GUS staining and GUS activity results are as follows: Figure 3 As shown, the GUS staining and GUS activity of the leaves co-transformed with 35S::miR8342 and 35S::DkGH9B3-GUS on the right side were significantly reduced compared with those co-transformed with EV and 35S::DkGH9B3-GUS on the left side; this proves that the expression of DkGH9B3 is inhibited by miR8342, and miR8342 cleaves DkGH9B3.

[0034] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended embodiments and their equivalents.

Images