Application of PhCHS-R1 gene in regulating and controlling color of plant petals
By regulating the expression of the PhCHS-R1 gene in Phalaenopsis orchids through gene editing and transgenic technology, the specific mechanism of petal color regulation has been solved, enabling precise improvement of petal color and variety, improving breeding efficiency and economic value, and showing broad application prospects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- TOBACCO RESEARCH INSTITUTE OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES (QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO COMPANY)
- Filing Date
- 2026-03-20
- Publication Date
- 2026-05-15
AI Technical Summary
Current technologies have failed to clarify the specific role of the PhCHS-R1 gene in petal color regulation in Phalaenopsis orchids, lack empirical protocols and metabolic pathway network analysis, have a narrow scope of application, and cannot meet the needs of the flower industry for flower color improvement.
By regulating the expression or activity of the PhCHS-R1 gene through gene editing, affecting the accumulation of metabolites in the anthocyanin biosynthesis pathway, recombinant plants were created using transgenic technology. The nucleotide and protein sequences of the PhCHS-R1 gene were included, and the changes in petal color were verified by combining transcriptomic and metabolomics analysis.
The key role of the PhCHS-R1 gene in the regulation of petal color in Phalaenopsis orchids has been clarified, providing a molecular breeding target, enabling precise regulation of petal color and variety improvement, enhancing breeding efficiency and economic value, and expanding its application to other ornamental plants and crops.
Smart Images

Figure CN122038459A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application of the PhCHS-R1 gene in regulating the color of plant petals. Background Technology
[0002] Chalcone synthase (CHS) is a key enzyme in the anthocyanin biosynthesis pathway, serving as the starting point for anthocyanin synthesis and a branch point in the flavonoid metabolic network, regulating flower color formation in various plants. Existing research indicates that in Arabidopsis, UV-B activates CHS through the UVR8-HY5 signaling pathway, promoting anthocyanin synthesis (Marc et al., 2012). In petunias, MYB-bHLH complexes (such as AN2-AN1) regulate CHS in petal petals, determining flower color variation (Qiu et al., 2021). In rice, CHS deficiency leads to colorless glumes (e.g., chs1 mutant), while overexpression may enhance disease resistance (Wang et al., 2024). Furthermore, public databases (such as GO and KEGG) have been used to annotate the pathways of CHS-related genes, but existing research has largely focused on model plants (such as Arabidopsis and rice), lacking specific exploration of ornamental plants (such as Phalaenopsis orchids). For example, genomic analysis has identified the expression patterns of CHS family members in common soybeans (Wang et al., 2024), but has failed to elucidate the functional mechanisms of CHS genes in Phalaenopsis orchids.
[0003] Limitations and shortcomings of existing technologies: Although existing technologies have conducted preliminary research on the CHS gene, they have the following major limitations and shortcomings: 1. Unclear gene function mechanisms: Current technologies have failed to identify the specific roles of CHS genes (such as PhCHS-R1) in the regulation of petal color in Phalaenopsis orchids. For example, although CHS is known to be involved in anthocyanin synthesis, the molecular pathways (such as metabolite accumulation and signaling pathways) by which the PhCHS-R1 gene regulates the petal color of Phalaenopsis orchids have not yet been elucidated.
[0004] 2. Lack of Empirical Evidence: There is a lack of empirical evidence for directly regulating petal color through gene editing. Existing studies are mostly limited to expression analysis and do not provide experimental evidence to verify gene function through transgenic technologies (such as CRISPR or Agrobacterium-mediated transformation), making them unsuitable for application in molecular breeding.
[0005] 3. Unclear metabolic pathway network: Insufficient elucidation of metabolic pathways (such as flavonoid biosynthesis) involved by the PhCHS-R1 gene. Current technologies have failed to clarify the regulatory relationship between PhCHS-R1 and key metabolites (such as colorless cyanidin and luteolin) through multi-omics combined analysis (such as transcriptomics and metabolomics), thus limiting target discovery.
[0006] 4. Narrow scope of application: Existing CHS research focuses on crops (such as rice) and lacks targeted applications for ornamental plants (such as Phalaenopsis orchids), which cannot meet the needs of the flower industry for flower color improvement.
[0007] These limitations prevent existing technologies from providing effective molecular targets and breeding strategies, hindering the improvement of varieties of ornamental plants such as Phalaenopsis orchids. Therefore, studying the specific mechanisms of Phalaenopsis orchid petal color regulation to achieve targeted improvement of petal color is of great significance. Summary of the Invention
[0008] The purpose of this invention is to overcome the deficiencies of the prior art and to provide the application of the PhCHS-R1 gene in regulating the color of plant petals. This invention provides a method for regulating petal color through gene editing by analyzing the function of the PhCHS-R1 gene, thus filling the gap in the prior art.
[0009] To achieve the above objectives, the present invention is implemented as follows: In a first aspect of the invention, an application of the PhCHS-R1 gene in regulating plant petal color is provided, the application comprising: The color of petals can be altered by regulating the expression or activity of the PhCHS-R1 gene to affect the accumulation of metabolites in the anthocyanin biosynthesis pathway; wherein the nucleotide sequence of the PhCHS-R1 gene contains the sequence shown in SEQ ID NO:1 or a variant thereof having at least 90% sequence identity.
[0010] Furthermore, the plant in question is a Phalaenopsis orchid.
[0011] Furthermore, the regulation of PhCHS-R1 gene expression is achieved through gene editing, RNA interference, or overexpression techniques.
[0012] Furthermore, the metabolites include colorless cyanidin and luteolin, the changes in their content being confirmed by metabolomics analysis.
[0013] Furthermore, the application also includes the creation of recombinant plants through transgenic technology, wherein the transgenic technology includes linking the PhCHS-R1 gene into an expression vector and transforming the host plant via Agrobacterium-mediated transformation.
[0014] Furthermore, the expression vector is the pDC45 vector, and PCR amplification is performed using primers PhCHS-R1-F and PhCHS-R1-R.
[0015] Furthermore, the protein sequence of the PhCHS-R1 gene comprises the amino acid sequence shown in SEQ ID NO:2 or a variant thereof having at least 85% sequence identity.
[0016] In a second aspect of the invention, a recombinant DNA vector is provided containing the nucleotide sequence of the PhCHS-R1 gene, as shown in SEQ ID NO:1, and the vector is used to express the PhCHS-R1 protein in plants to regulate petal color.
[0017] In a third aspect of the invention, a transgenic plant is provided, the plant comprising an exogenously introduced PhCHS-R1 gene or a silenced construct thereof, and the introduction of the gene causes a change in petal color.
[0018] In a fourth aspect of the present invention, a method for regulating the color of plant petals is provided, the method comprising the following steps: a. Detect the expression level of the PhCHS-R1 gene in plant tissues; b. Regulate the expression of the PhCHS-R1 gene using gene editing tools; c. Verify the changes in petal color and the content of related metabolites.
[0019] The beneficial effects of this invention are: 1. This invention is the first to clearly define the key role of the PhCHS-R1 gene in the regulation of petal color in Phalaenopsis orchids. Through combined transcriptomic and metabolomic analysis, this invention is the first to confirm that the PhCHS-R1 gene is a core regulator of the flavonoid biosynthesis pathway in Phalaenopsis orchids. This gene directly participates in the petal color formation mechanism by positively regulating the accumulation of anthocyanin metabolites such as colorless cyanidin and luteolin, filling a research gap in this field.
[0020] 2. A complete gene function verification system has been established. This invention provides a complete technical solution from gene identification to function verification, including standardized procedures such as specific primer design, vector construction, genetic transformation, and phenotypic analysis. This system is highly operable, ensuring that those skilled in the art can implement it smoothly.
[0021] 3. The discovery of the PhCHS-R1 gene provides a reliable molecular breeding target, offering a clear molecular target for improving the petal color of Phalaenopsis orchids. Through gene editing or overexpression techniques, precise control of flower color can be achieved, laying a theoretical foundation for breeding Phalaenopsis orchid varieties with novel flower colors.
[0022] 4. Significantly Improved Breeding Efficiency and Precision: Compared with traditional hybridization breeding, molecular breeding technology based on the PhCHS-R1 gene can significantly shorten the breeding cycle and improve the precision of obtaining target traits. Experiments have shown that regulating the expression of this gene can stably achieve directional changes in petal color.
[0023] 5. This invention has broad application prospects and scalability. It is not only applicable to Phalaenopsis orchids, but its technical principles and implementation methods can be extended to the improvement of flower color in other ornamental plants and crops. The PhCHS-R1 gene, as a member of the chalcone synthase family, is functionally conserved in many plants.
[0024] 6. Promoted the innovative application of multi-omics technologies. This invention successfully integrates transcriptomics, metabolomics and bioinformatics analysis methods, establishes a multi-dimensional research system, and provides a reference research paradigm for the analysis of molecular mechanisms of similar plant traits.
[0025] 7. Enhanced the economic value of the flower industry: Through innovation in flower color improvement technology, this invention helps to cultivate new Phalaenopsis orchid varieties with higher ornamental value and market competitiveness, thereby enhancing the economic benefits of the flower industry and meeting the market demand for diversified ornamental plants.
[0026] 8. Significant ecological and social benefits: The green breeding technology provided by this invention helps reduce dependence on chemical dyes and is in line with the concept of ecological agriculture development.
[0027] 9. It has enriched the public disclosure of PhCHS-R1 gene sequence, functional information and related technical solutions in the plant gene resource bank, providing valuable gene resources and technical reserves for plant flower color regulation research, and has important scientific value.
[0028] 10. The technical solution is mature and reliable, and easy to promote. The experimental scheme provided by this invention has clear parameters and standardized operation. All aspects from vector construction to transgenic material identification have been verified, and it has good repeatability and scalability. Attached Figure Description
[0029] Figure 1 : Enrichment map of flavonoid biosynthesis pathway (illustrative, based on transcription-metabolism combined analysis).
[0030] Figure 2 WGCNA analysis network diagram (illustrated, showing the central node role of PhCHS-R1 in the network). (A) Module identification; (B) KEGG enrichment chord diagram of MeBlue module genes; (C) Visualization analysis of protein-protein interaction network; (D) Heatmap of PhCHS-R1 correlation with differential metabolites.
[0031] Figure 3 Sequence alignment of TT4 and PhCHS-R1 showed homology.
[0032] Figure 4The regulatory relationship between PhCHS-R1 and key metabolites, including seed coat color comparison and metabolite statistics. Specifically, (A) comparison of seed coat colors between Col-0 and PhCHS-R1; (B) statistical analysis of colorless cornflower content in Col-0 and PhCHS-R1; and (C) statistical analysis of luteolin content in Col-0 and PhCHS-R1. Detailed Implementation
[0033] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.
[0034] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.
[0035] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or by existing methods.
[0036] Unless otherwise specified, the techniques used are conventional techniques well known to those skilled in the art; the experimental methods used are all conventional methods and can be performed according to the described recombinant techniques (see Molecular Cloning, Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); and the materials and reagents used are all commercially available.
[0037] Reagents and instruments used in the experiments of this invention: To solve the technical problem of this invention, the technical solution of this invention is as follows: The applicant conducted a joint analysis of Phalaenopsis transcriptome and metabolome data, identifying a common enriched metabolic pathway, namely the flavonoid biosynthesis pathway (e.g., Figure 1 ), after WGCNA analysis (such as Figure 2 ) and NCBI-BLAST homologous sequence alignment (such as Figure 3 We screened a gene encoding CHS, PhCHS-R1, which is a homolog of Arabidopsis thaliana TT4 and a key central node in the protein-protein interaction network.
[0038] Subsequently, the applicant constructed PhCHS-R1 gene mutant materials in Arabidopsis thaliana and observed their seed color. They found that after PhCHS-R1 was silenced, the color of tobacco petals changed from the initial brown to white, and the content of colorless cyanidin and luteolin, which are related to red pigments, was significantly reduced. This demonstrates that the PhCHS-R1 gene can control petal color by positively regulating the content of colorless cyanidin and luteolin (e.g., ...). Figure 4 ).
[0039] The present invention will now be described in detail with reference to the embodiments.
[0040] Example 1 PhCHS-R1 Gene identification and sequence analysis I. Experimental Objective This experiment aims to identify PhCHS-R1, a key gene regulating the color of Phalaenopsis orchid petals, through combined transcriptomic and metabolomic analysis, and to verify its correlation with the flavonoid biosynthesis pathway. The experimental objectives include: identifying co-enriched metabolic pathways, screening homologous genes, and providing a foundation for subsequent functional validation.
[0041] II. Experimental Methods 1. Transcriptome sequencing: (1) Sample processing: Phalaenopsis petal tissue was taken and total RNA was extracted using the TRIzol Reagent method.
[0042] (2) Library construction: cDNA libraries were constructed using the Illumina® Stranded mRNA Prep, Ligation method and sequenced using the Illumina platform. (3) Data analysis: Differentially expressed genes were annotated using the GO database (http: / / geneontology.org / ) and classified into biological processes (BP), cellular components (CC), and molecular functions (MF); pathway enrichment analysis was performed using the KEGG database (https: / / www.genome.jp / kegg / ), focusing on the flavonoid biosynthesis pathway.
[0043] 2. Metabolomics analysis: (1) Sample preparation: 100 mg of Phalaenopsis petals were placed in a 2 mL centrifuge tube, and a 6 mm diameter grinding bead was added. 800 μL of extraction buffer (methanol:water = 4:1 (v:v)) containing four internal standards (L-2-chlorophenylalanine (0.02 mg / mL), etc.) was used to extract metabolites. The sample solution was ground in a cryo-tissue homogenizer for 6 min (-10℃, 50 Hz), and then extracted by low-temperature ultrasonication for 30 min (5℃, 40 kHz). The sample was placed at -20℃ for 30 min, centrifuged for 15 min (4℃, 13000 g), and the supernatant was transferred to a vial with an inner tube for analysis. (2) LC-MS detection: After the LC-MS was completed, the raw LC-MS data were imported into the metabolomics processing software Progenesis QI (Waters Corporation, Milford, USA) for baseline filtering, peak identification, integration, retention time correction, and peak alignment. Finally, a data matrix of retention time, mass-to-charge ratio, and peak intensity was obtained. At the same time, the MS and MSMS mass spectrometry information was matched with the public metabolic databases HMDB (http: / / www.hmdb.ca / ) and Metlin (https: / / metlin.scripps.edu / ) as well as the self-built database of Meiji to obtain metabolite information. (3) Pathway analysis: Differential metabolites were annotated using the KEGG database (https: / / www.kegg.jp / kegg / pathway.html) to obtain the pathways involved by the differential metabolites. The Python package scipy.stats was used for pathway enrichment analysis, and Fisher's exact test was used to obtain the biological pathways most relevant to the experimental treatment.
[0044] 3. Gene screening: CHS genes homologous to Arabidopsis thaliana TT4 were screened by WGCNA analysis network and NCBI-BLAST homology sequence comparison.
[0045] III. Experimental Results Results of combined transcriptomic and metabolomic analysis: Figure 2 As shown, the flavonoid biosynthesis pathway was significantly enriched. A gene encoding chalcone synthase, PhCHS-R1, was screened; it is a homolog of Arabidopsis thaliana TT4 and serves as a key central node in the protein-protein interaction network. Sequence alignment confirmed that PhCHS-R1 and TT4 have high homology, supporting their functional conservation. Figure 3 The results indicate that PhCHS-R1 is a candidate key gene for regulating the petal color of Phalaenopsis orchids.
[0046] Example 2: PhCHS-R1 gene function verification I. Experimental Objective This experiment compared wild-type and PhCHS-R1-edited Arabidopsis materials to verify the regulatory effect of this gene on petal color (represented by the seed coat) and related metabolites, and to clarify its molecular mechanism.
[0047] II. Experimental Methods 1. Carrier construction: (1) PCR amplification: Using Phalaenopsis petal cDNA as a template, primers sgPhCHS-R1-F and sgPhCHS-R1-R were used to amplify the PhCHS-R1 gene knockout target site (sequence as SEQ ID NO:5, GAGCTAGAGAGCTGAGGGCC).
[0048] Using sgPhCHS-R1 gene primers: sgPhCHS-R1-F: 5'-TGCAGAGCTCAGAGAGCTGAGGGCC-3' (SEQ ID NO: 3).
[0049] sgPhCHS-R1-R: 5'-AAACGGCCCTCAGCTCTCTGAGCTC-3' (SEQ ID NO: 4).
[0050] (2) Synthesis of sticky-terminated double-stranded gRNA: Take 5 μl (10 μM) of sgPhCHS-R1-F and sgPhCHS-R1-R respectively, add 40 μl of 0.5 x TE buffer, mix well and put into the PCR instrument, heat at 98℃ for 4 min, then take out the PCR tube directly and cool to room temperature.
[0051] (3) Ligation vector: The obtained PCR product was ligated into the pDC45 expression vector digested with restriction endonuclease BsaI using the Gibson Assembly method. The vector was sequenced to confirm the results, and finally the PhCHS-R1 gene editing vector that can be used for genetic transformation was obtained. The sequence was confirmed to be correct.
[0052] 2. Genetic transformation: Inflorescence infection method: Culture Agrobacterium-containing bacterial solution to an OD600 of 0.6-0.8, centrifuge and discard the supernatant. Resuspend the bacterial cells in pre-cooled MS0 to an OD600 of approximately 0.8. Place the entire inflorescence in the bacterial solution and infect for 30 seconds to 1 minute. Remove the inflorescence and cover the entire tray with a black plastic bag to create a high-humidity environment. Incubate in the dark for 16-24 hours. Afterward, remove the covering and incubate under normal photoperiod and temperature / humidity. Once the fruit pods have completely turned yellow and dried, collect and dry the T1 generation seeds. Sow the T1 generation seeds in MS medium containing hygromycin. After 7-14 days, green seedlings that can normally root and develop true leaves are transferred to soil for cultivation, and T2 generation seeds are harvested. Use specific primers to identify positive seedlings and conduct relevant experiments.
[0053] 3. Functional validation of PhCHS-R1 in Arabidopsis thaliana Seeds of wild-type Arabidopsis thaliana and Arabidopsis thaliana mutants were collected, and the differences in seed coat color were observed. The content of pigment-related metabolites was also detected.
[0054] 4. Metabolite detection: (1) Sample extraction: Seed coat tissue was taken, and metabolites were extracted using the metabolomics method described in Example 1. (2) Content analysis: The content of colorless cyanidin and luteolin was quantitatively detected by LC-MS, and the significance was analyzed by t-test using statistical software (such as SPSS).
[0055] 5. Gene expression validation: PhCHS-R1 expression level was detected by real-time PCR using primers F: TCAACCGATTCATGCTCTAC and R: GAGGGAATCAAGATGGGATT.
[0056] III. Experimental Results The results are as follows Figure 4 As shown, after PhCHS-R1 editing, the seed coat color of Arabidopsis thaliana changed from brown in the wild type to white, indicating that the deletion of this gene led to the inhibition of anthocyanin synthesis. Metabolite analysis showed that the content of colorless cyanidin and luteolin was significantly reduced in the mutant (p<0.05), and Real-time PCR confirmed the downregulation of PhCHS-R1 expression. These results demonstrate that PhCHS-R1 affects color by positively regulating key metabolites.
[0057] In summary, PhCHS-R1 is a key gene for petal color regulation and can provide a target for molecular breeding of Phalaenopsis orchids. This gene plays a central role in the flavonoid pathway, and petal color can be effectively regulated through transgenic technology. This invention provides a new strategy for ornamental plant breeding.
[0058] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.
[0059] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.
[0060] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, then... This invention is also intended to include these modifications and variations.
Claims
1. An application of the PhCHS-R1 gene in regulating plant petal color, characterized in that, The applications include: The color of petals can be altered by regulating the expression or activity of the PhCHS-R1 gene to affect the accumulation of metabolites in the anthocyanin biosynthesis pathway; wherein the nucleotide sequence of the PhCHS-R1 gene contains the sequence shown in SEQ ID NO:1 or a variant thereof having at least 90% sequence identity.
2. The application according to claim 1, characterized in that, The plant in question is a Phalaenopsis orchid.
3. The application according to claim 1, characterized in that, The regulation of PhCHS-R1 gene expression is achieved through gene editing, RNA interference, or overexpression techniques.
4. The application according to claim 1, characterized in that, The metabolites include colorless cyanidin and luteolin, and their content variations were confirmed by metabolomics analysis.
5. The application according to claim 1, characterized in that, The application also includes the creation of recombinant plants through transgenic technology, wherein the transgenic technology includes linking the PhCHS-R1 gene into an expression vector and transforming the host plant using Agrobacterium-mediated transformation.
6. The application according to claim 5, characterized in that, The expression vector is the pDC45 vector, and PCR amplification was performed using the primers shown in SEQ ID NO:3-4.
7. The application according to claim 1, characterized in that, The protein sequence of the PhCHS-R1 gene contains the amino acid sequence shown in SEQ ID NO:2 or a variant thereof having at least 85% sequence identity.
8. A recombinant DNA vector, characterized in that, The vector contains the nucleotide sequence of the PhCHS-R1 gene, as shown in SEQ ID NO:1, and is used to express the PhCHS-R1 protein in plants to regulate petal color.
9. A transgenic plant, characterized in that, The plant contains an exogenously introduced PhCHS-R1 gene or its silenced construct, and the introduction of the gene causes a change in petal color.
10. A method for regulating the color of plant petals, characterized in that, Includes the following steps: a. Detect the expression level of the PhCHS-R1 gene in plant tissues; b. Regulate the expression of the PhCHS-R1 gene using gene editing tools; c. Verify the changes in petal color and the content of related metabolites.