Application of miR-92a / 25 / 30d / 30c and inhibitor of miR-92a / 25 / 30d / 30c in preparation of medicine for resisting metastasis of multiple cancer species

Abstract

The invention relates to the technical field of biological medicines, in particular to application of four micro RNAs (Ribonucleic Acid) of miR-92a, miR-25, miR-30d and miR-30c and inhibitors targeting the four micro RNAs to preparation of medicines for resisting metastasis of multiple cancer species such as breast cancer, colorectal cancer and melanoma. When the nucleic acid inhibitor anti-agomirs targeting at least one of a set consisting of miR-92a, miR-25, miR-30d and miR-30c is used for treating metastasis of multiple cancer species, the anti-metastasis effect is remarkable, the universality is high, and the nucleic acid inhibitor anti-agomirs can show a strong inhibition effect in three different tumor metastasis models of breast cancer, colorectal cancer and melanoma; especially, when the four inhibitors are combined for use, the synergistic effect is prominent, the colorectal cancer liver metastasis load can be reduced by 90% or above, the breast cancer metastasis rate is reduced by 80% or above, the melanoma metastasis inhibition rate is 65% or above, and the composition is suitable for treatment of multi-cancer metastasis.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to four microRNAs: miR-92a, miR-25, miR-30d, and miR-30c, and the use of inhibitors targeting them in the preparation of drugs for the treatment of multiple cancer metastases, including breast cancer, colorectal cancer, and melanoma. Background Technology

[0002] Tumor metastasis is the leading cause of death in cancer patients, and its complex pathological process is closely regulated by the interaction between the host microenvironment and tumor cells. With the increasing aging of the global population, the incidence of cancer in the elderly (≥60 years old) continues to rise. Clinical data show that advanced age has become an independent risk factor for increased risk of cancer metastasis, shortened time to metastasis after diagnosis, and poor prognosis, posing a huge challenge to clinical treatment.

[0003] However, the specific molecular mechanisms by which the aging microenvironment drives tumor metastasis have not been fully elucidated, and there is currently a lack of targeted intervention strategies and effective therapeutic drugs. Current clinical treatments for tumor metastasis (such as chemotherapy and targeted monotherapy) suffer from problems such as insufficient specificity, frequent drug resistance, and significant toxic side effects, especially with limited efficacy against age-related highly aggressive tumor metastases.

[0004] Existing research confirms that microRNAs (miRNAs), as key molecules regulating gene expression, play a crucial role in multiple stages of tumor metastasis, such as cell invasion, angiogenesis, and distant colonization. The liver, as a vital metabolic and immune organ, secretes extracellular vesicles (EVs) containing miRNAs, which can influence the systemic microenvironment through the circulatory system, thereby regulating the metastatic potential of tumor cells. However, no literature has yet disclosed the roles of miR-25 / 92a / 30c / 30d and their inhibitors in the metastasis of multiple cancer types. Summary of the Invention

[0005] (a) Technical problems to be solved

[0006] In view of the above-mentioned shortcomings and deficiencies of the prior art, the present invention provides the use of miR-25 / 92a / 30c / 30d and their inhibitors in the preparation of drugs against multiple cancer metastases, providing new ideas and solutions for the clinical treatment of aging-related tumor metastases.

[0007] (II) Technical Solution

[0008] In a first aspect, the present invention relates to the use of at least one of the group consisting of miR-92a, miR-25, miR-30d and miR-30c and its inhibitor in the preparation of an anti-multiple cancer metastasis drug.

[0009] Preferably, at least one of the following is selected as the detection target: miR-92a, miR-25, miR-30d, and miR-30c.

[0010] Preferably, the inhibitor is a nucleic acid inhibitor, antagomirs.

[0011] Preferably, the nucleotide sequence of the nucleic acid inhibitor antagomirs is as follows:

[0012] miR-92a-3p antagomir: 5'CAGGCCGGGACAAGUGCAAUA;

[0013] miR-25-3p antagomir: 5'UCAGACCGAGACAAGUGCAAUG;

[0014] miR-30d-5p antagomir: 5'UGUAAACAUCCCCGACUGGAAG;

[0015] miR-30c-5p antagomir: 5'GCUGAGAGUGUAGGAUGUUUACA.

[0016] Preferably, the multiple cancer types include breast cancer, colorectal cancer, and melanoma.

[0017] Although this application only exemplifies the above-mentioned specific nucleotide sequences of antagomirs, based on the principle that antagomirs and their corresponding miRNAs can bind completely complementaryly, other nucleotide sequences with high inhibition efficiency can also be designed.

[0018] In a second aspect, the present invention provides a drug for resisting the metastasis of multiple cancers, comprising antagomirs, nucleic acid inhibitors that target at least one of the group consisting of miR-92a, miR-25, miR-30d and miR-30c, wherein the multiple cancers are one of breast cancer, colorectal cancer and melanoma.

[0019] Preferably, the nucleotide sequence of the nucleic acid inhibitor antagomirs is as follows:

[0020] miR-92a-3p antagomir: 5'CAGGCCGGGACAAGUGCAAUA;

[0021] miR-25-3p antagomir: 5'UCAGACCGAGACAAGUGCAAUG;

[0022] miR-30d-5p antagomir: 5'UGUAAACAUCCCCGACUGGAAG;

[0023] miR-30c-5p antagomir: 5'GCUGAGAGUGUAGGAUGUUUACA.

[0024] Preferably, the nucleic acid inhibitor is a liver-targeting agent conjugated with GalNAc, which can specifically reduce the expression levels of miR-25, miR-92a, miR-30c, and miR-30d in liver tissue and serum extracellular vesicles (EVs).

[0025] Preferably, the drug is an intravenous injection.

[0026] Preferably, the drug contains antagomirs, nucleic acid inhibitors targeting at least two of miR-92a, miR-25, miR-30d, and miR-30c; more preferably, at least three. The anti-metastatic effect is optimal when the drug simultaneously contains antagomirs, nucleic acid inhibitors targeting all four miRNAs of miR-92a, miR-25, miR-30d, and miR-30c.

[0027] In this application, the nucleic acid inhibitor antagomirs, compared with ordinary inhibitors, has the characteristics of high stability, strong cell penetration, and high inhibitory efficiency. Antagomirs is a chemically modified single-stranded RNA molecule specifically designed to inhibit miRNAs. It inhibits the biological function by completely complementary binding to miRNAs, blocking their interaction with target mRNAs. As a novel chemically modified nucleic acid drug, it has the advantages of high stability, high cell penetration, and high specificity. The key chemical modifications of antagomirs include: 2'-O-methyl modification: enhances RNA stability, resists nuclease degradation, has high stability, and can circulate in vivo for several days. Thiophosphorylation modification: the phosphodiester bond is replaced with a thiophosphate bond, which strongly resists exonucleases / endonucleases, prolongs the half-life, and enhances serum protein binding, which is beneficial for in vivo circulation, ultimately improving serum stability and cellular uptake efficiency. Cholesterol conjugation modification: the hydrophobic group of cholesterol mediates cellular uptake, enters cells efficiently through the lipoprotein pathway (LDLR), enhances cell membrane penetration, and increases intracellular concentration. N-acetylgalactosamine (GalNAc) covalent conjugation modification: GalNAc specifically binds to the desialized glycoprotein receptor (ASGPR) on the surface of hepatocytes, exhibiting high affinity and high selectivity for endocytosis, resulting in a 10-100-fold increase in hepatocyte enrichment efficiency with lower doses and less systemic toxicity. Antagomirs can form stable double-stranded structures with target miRNAs, preventing them from binding to Argonaute proteins to form RISC complexes. The bound antagomir-miRNA complex is recognized and degraded by intracellular nucleases, reducing the expression level of the corresponding miRNA within the cell. Different antagomirs specifically inhibit only their corresponding miRNAs, without affecting the expression and function of other miRNAs.

[0028] (III) Beneficial Effects

[0029] The proposed use of antagomirs, a nucleic acid inhibitor targeting at least one of miR-92a, miR-25, miR-30d, and miR-30c, in the preparation of drugs against multiple cancer metastases demonstrates significant and universal anti-metastatic effects. It exhibits potent inhibitory effects in three different tumor metastasis models: breast cancer, colorectal cancer, and melanoma. In particular, the synergistic effect is outstanding when the four inhibitors are used in combination, reducing the liver metastasis burden of colorectal cancer by more than 90%, reducing the metastasis rate of breast cancer by more than 80%, and inhibiting the metastasis rate of melanoma by more than 65%. It is suitable for the treatment of multiple cancer metastases.

[0030] In a preferred embodiment, the nucleic acid inhibitor antagomirs further achieves liver-specific targeting by conjugating GalNAc, which can precisely reduce the expression of target miRNA in liver tissue and serum EVs, cut off the aging-related pro-metastasis signaling pathway at its source, avoid non-specific effects on other tissues, and improve treatment specificity.

[0031] The drug containing antagomirs targeting at least one of miR-92a, miR-25, miR-30d, and miR-30c exhibits high safety. Even after long-term administration, no significant pathological changes were observed in vital organs of experimental animals, and serum inflammatory factors and liver function indicators remained within normal ranges. There were no significant toxic side effects, providing a safe basis for clinical translation. At therapeutic concentrations, there were no significant toxic side effects, and no pathological damage was caused to vital organs such as the heart, liver, spleen, lungs, kidneys, brain, and muscles. It did not affect serum inflammatory factor (TNF-α, IL-6) levels or liver function indicators (AST, ALT).

[0032] The drug, containing antagomirs targeting at least one of miR-92a, miR-25, miR-30d, and miR-30c, is highly targeted, specifically addressing tumor metastasis driven by the aging microenvironment in elderly individuals (≥60 years old), thus overcoming the limited efficacy of existing treatments for this type of highly aggressive tumor metastasis. Experiments have demonstrated that it can significantly prolong the survival of tumor-bearing mice. The drug is suitable for in vivo injection (in the experiments, tail vein injection was used in mice), making administration convenient, safe, and rapid. Attached Figure Description

[0033] Figure 1 The results of the characteristic analysis of the breast cancer tumor metastasis models in young (2 months old) and old (18 months old) mice in Example 1 are shown.

[0034] Figure 2 The results of the characteristic analysis of the colorectal cancer liver metastasis models in young (2-month-old) and old (18-month-old) mice in Example 2 are shown.

[0035] Figure 3 The results of the characterization analysis of the young (2-month-old) and old (18-month-old) mouse melanoma models in Example 3 are shown.

[0036] Figure 4 The results are from the in vivo functional and preliminary safety verification experiments of liver-specific miR-25 / 30c / 30d / 92a antagomirs in Example 4.

[0037] Figure 5This represents the experimental results of miR-25 / 30c / 30d / 92a antagomirs used in Example 5 to inhibit liver metastasis of colon cancer.

[0038] Figure 6 This refers to the experimental results of miR-25 / 30c / 30d / 92a antagomirs used in Example 6 to inhibit breast cancer metastasis.

[0039] Figure 7 The results are from the experiment in Example 7 on the use of miR-25 / 30c / 30d / 92a antagomirs to inhibit melanoma metastasis. Detailed Implementation

[0040] To better explain and facilitate understanding of the present invention, the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0041] In previous studies, the inventors observed for the first time the abnormally high expression of miR-25, miR-92a, miR-30c, and miR-30d in aging livers. These miRNAs enter the circulatory system via liver-secreted extracellular fluid (EVs) and become key molecules driving age-related tumor metastasis. Targeting the expression of these miRNAs, or developing anti-metastatic drugs using them as targets, has significant clinical value in improving the metastatic prognosis and treatment efficacy in elderly cancer patients. Based on this, this invention focuses on miR-25 / 92a / 30c / 30d and their specific inhibitors, exploring and validating their therapeutic potential in multiple cancer metastases, providing new ideas and solutions for the clinical treatment of age-related tumor metastases.

[0042] The experimental materials and methods involved in the following examples are described below (and will not be repeated in the examples):

[0043] 1. Laboratory animals

[0044] All animal experiments were conducted at the Laboratory Animal Center of the Academy of Military Medical Sciences of the Chinese People's Liberation Army, following standard operating procedures and in an SPF-grade environment. The research experiments involved in this application were approved by the unit's Laboratory Animal Management and Use Committee (Approval No.: IACUC-DWZX-2024-P024). Eight-week-old male C57BL / 6J mice, female BALB / c wild-type mice, and BALB / c nude mice used in the experiments were all purchased from Beijing Spefol Biotechnology Co., Ltd. Aged mice were defined as 18 months old (corresponding to approximately 60 years old in humans), some were raised to the appropriate age in our laboratory, and some were purchased directly from Spefol.

[0045] 2. Construction of a mouse tumor metastasis model

[0046] To construct a preclinical mouse tumor metastasis model, the following methods were used:

[0047] (1) Colorectal cancer liver metastasis model: Well-grown MC38-luciferase cells (C57BL / 6 background) were digested with trypsin and resuspended in pre-cooled PBS, then mixed with an equal volume of matrix gel to prepare 1×10⁻⁶ cells. 6 Cell suspension containing 100 μL of MC38-luciferase cells / mL (cells to matrix gel volume ratio 1:1) was administered to mice via laparotomy on the left abdominal wall after isoflurane inhalation anesthesia. 5 HCT116-luciferase cells (1×10⁶ cells) were slowly injected into the spleen. As a human colorectal cancer liver metastasis model, HCT116-luciferase cells (1×10⁶ cells) were slowly injected into the spleen. 5 (One) was injected into the spleen of BALB / c nude mice using the same method.

[0048] (2) Breast cancer metastasis model: 4T1-luciferase cells (2.5×10⁻⁶) were used to create a breast cancer metastasis model. 5 MDA-MB-231-luciferase cells (2.5 × 10⁻⁶ cells) were injected into the mammary fat pads of female BALB / c mice to create a human breast cancer metastasis model. 5 (One) was injected into the mammary fat pad of female BALB / c nude mice.

[0049] (3) Melanoma metastasis model: B16-luciferase cells (2.5×10⁻⁶) were used to create a melanoma metastasis model. 5 (Number of mice) were injected intradermally into the dermis of the back of C57BL / 6J mice. Metastatic tumors were assessed by detecting bioluminescence signal intensity using in vivo imaging, visually counting visible tumor nodules, and measuring their area. After the experiment, tumor and non-tumor tissues were collected for histological analysis. Mice survival was monitored throughout the experiment, and the time of death was recorded for survival analysis.

[0050] 3. Treatment with miRNA mimics and inhibitors

[0051] miRNA mimics targeting miR-25, miR-26a, miR-30c, miR-30d, and miR-92a, or liver-targeting inhibitors of miR-25, miR-30c, miR-30d, and miR-92a conjugated with GalNAc (antagomirs) were dissolved in physiological saline and injected via the tail vein every other day into 8-week-old or 18-month-old C57BL / 6J mice (10 mg / kg).

[0052] After treatment with miRNA regulators, MC38-luciferase, B16-luciferase, and 4T1-luciferase cells were inoculated to establish a metastasis model, and the metastasis status was assessed within a pre-defined observation window after tumor cell inoculation.

[0053] 4. Histological analysis

[0054] All tissue samples (including tumor tissue and normal tissues such as heart, liver, spleen, lung, and kidney) were immediately fixed in 10% PBS-buffered formalin solution for 24-48 hours after ex vivo treatment. After fixation, the tissues were rinsed with running water overnight, followed by a gradient dehydration process involving 70% ethanol (2 hours), 80% ethanol (2 hours), 90% ethanol (1 hour), 95% ethanol (1 hour), and 100% ethanol I and II (30 minutes each). The dehydrated tissues were cleared by xylene I and II (20 minutes each), then embedded in paraffin (paraffin I and II, 1 hour each) to form paraffin blocks. The tissue blocks were serially sectioned to a thickness of 4 μm and dried overnight in a 37°C oven for later use.

[0055] Paraffin sections were dewaxed with xylene I and II (10 min each), then sequentially hydrated with 100% ethanol I and II (5 min each), 95% ethanol (3 min), 90% ethanol (3 min), and 80% ethanol (3 min), followed by rinsing with distilled water. Hematoxylin staining was performed for 5 min, followed by rinsing with running water for 10 min to achieve blue reversion, differentiation with 1% hydrochloric acid ethanol for 3 seconds, and rinsing again with running water for 15 min to achieve blue reversion. Subsequently, the sections were stained with 0.5% eosin alcohol solution for 3 min, dehydrated and cleared using standard methods, and mounted with neutral resin. The tissue morphology and structure were observed and images were acquired under an optical microscope (Nikon Eclipse Ci-L).

[0056] 5. In vivo imaging for monitoring tumor metastasis

[0057] To establish a preclinical metastasis model, MC38-luciferase cells, 4T1-luciferase cells, and B16-luciferase cells were seeded into the corresponding sites (MC38 cells were injected into the spleen to establish a liver metastasis model, and 4T1 and B16 cells were injected into the breast fat pad and subcutaneously to establish metastasis models, respectively).

[0058] Primary tumors and metastases were monitored using the IVIS Spectrum CT preclinical in vivo imaging system (Perkin Elmer). In vivo imaging was performed every two days from day 7 to day 21 post-cell seeding. Prior to each imaging session, mice were intraperitoneally injected with D-fluorescein potassium (150 mg / kg) and placed in the imaging chamber 10 minutes after injection, where they were maintained under isoflurane gas anesthesia. Acquisition conditions were set as follows: exposure time 30 seconds, aperture f / 1.2, and medium resolution scanning mode.

[0059] Imaging data were quantitatively analyzed using Living Image Software v.4.5 (Perkin Elmer). The luciferase signal intensity (in photons / second / cm² / steradian) of the tumor region was measured by delineating the region of interest (ROI), and this was used to assess tumor burden and metastatic progression. All imaging procedures were performed in a darkroom to ensure accurate signal acquisition.

[0060] 6. Statistical Analysis

[0061] The experimental results were statistically calculated and plotted using GraphPad Prism 8.0.1 software. Experimental data are expressed as mean ± standard deviation (mean ± SD). Comparisons between two groups were performed using either the independent samples t-test (for normally distributed groups with homogeneous variances) or the Mann-Whitney U test (for non-normally distributed groups or groups with unequal variances), depending on the data distribution. Comparisons among multiple groups were performed using one-way or two-way ANOVA, with post-hoc tests using the Bonferroni method when necessary. Correlation analysis between variables was performed using the Spearman nonparametric test. Unless otherwise specified, all tests were two-tailed. A p-value < 0.05 was considered statistically significant. Significance markers in the figures are as follows: NS indicates no significant difference compared to the control group (p > 0.05), *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0062] The following description is based on specific embodiments.

[0063] Example 1

[0064] This example demonstrates that aged mice with breast cancer exhibit a stronger metastatic burden.

[0065] Two-month-old Balb / c mice were used as young controls. Young and aged breast cancer tumor metastasis models (4T1-luciferase) were established in 18-month-old Balb / c mice, respectively. During model construction, mouse-derived 4T1 breast cancer cells expressing the luciferase reporter gene were surgically injected orally into the mammary fat pads of BALB / c mice, mimicking the natural development of breast cancer and allowing spontaneous distant metastasis of tumor cells (model construction procedure as follows). Figure 1 (a) The IVIS in vivo bioluminescence imaging system was used to monitor tumor growth and metastasis in real time, assess target organ metastatic burden, and evaluate the overall survival of tumor-bearing mice. Monitoring results are as follows: Figure 1 shown.

[0066] See Figure 1 Figure b shows the tumor growth and metastasis signals on days 7 and 21 after implantation of 4T1-luciferase cells into the mammary fat pads of young (2-month-old) and aged (18-month-old) mice (n=6 per group); figure c is a summary of the bioluminescence intensity of tumors implanted with 4T1-luciferase cells based on figure b. As shown in the figures above, weekly in vivo imaging from the first week after inoculation revealed significant differences between young and aged mice: the tumor signals in the young mouse group (2-month-old) were mainly confined to the primary site, while the imaging results of the aged mouse group (18-month-old) showed a highly invasive trend. Around the third week after inoculation, strong and diffuse metastatic signals appeared in the thoracic and abdominal cavities, indicating that cancer cells had spread extensively to distant organs.

[0067] See Figure 1 Figure d shows the change in tumor size within 35 days after injection of 4T1 cells into the mammary fat pad; figure e shows the Kaplan-Meier survival curves for young and old mice inoculated with 4T1 cells. P-values ​​were calculated using a log-rank test (n=10 per group). As shown in the figures, continuous weekly growth measurements of the primary tumor revealed no significant difference in volume before day 21. Interestingly, from day 28 onwards, the tumor volume in young mice was larger than that in older mice, suggesting that age-induced tumor invasiveness is not correlated with tumor size. Furthermore, survival analysis showed that the overall survival of tumor-bearing older mice was significantly shorter than that of younger mice.

[0068] See Figure 1 Image f is a representative H&E staining image (40x scan and magnification) of 4T1 breast cancer cell metastases in the lung, liver, and spleen, with red arrows indicating metastatic lesions; the scale bar for this image is: original image, 2 mm; magnified image, 200 μm. Figure 1 The image shown is a representative gross image of 4T1-luciferase cells metastasizing in the lung, liver, and spleen (n=6 per group); the scale bars are: lung, 2 mm; liver, 1 cm; spleen, 2 mm. Figure 1 h and i represent the results of 4T1 lung metastasis analysis based on ImageJ software: h represents the statistical results of the number of tumor lesions; and i represents the statistical results of the metastatic area. Figure 1 j and k represent the results of 4T1 liver metastasis analysis based on ImageJ software, where j represents the statistical result of the number of tumor lesions and k represents the statistical result of the metastatic area. Figure 1The values ​​of l and m represent the results of 4T1 spleen metastasis analysis based on ImageJ software, where l represents the statistical result of the number of tumor foci and m represents the statistical result of the metastatic area. As shown in the aforementioned figures, in vitro observation and microscopic pathological analysis of the major organs of mice on day 21 post-inoculation revealed only a few pinpoint metastatic foci on the surface of the lungs of young mice. In contrast, the lung lobes of aged mice were covered with dense white nodules of varying sizes, some even merging into patches, severely damaging the normal lung tissue structure. The livers of aged mice also showed blunt, rounded edges and an uneven surface, with numerous invasive metastatic tumors visible on the cut surface; the spleen was significantly enlarged due to extensive tumor invasion. Quantitative microscopic pathological analysis confirmed that the number and area of ​​metastatic foci in the lungs, liver, and spleen of aged mice were significantly higher than those in young mice.

[0069] Example 2

[0070] This example demonstrates that aging accelerates the early colonization of colorectal cancer liver metastases and worsens the prognosis.

[0071] Two-month-old C57BL / 6J mice were used as young controls. MC38-luciferase models of colorectal cancer liver metastasis were established in 18-month-old C57BL / 6J mice, representing both young and aged models. During model construction, MC38 cells were injected intrasplenically into the mice (model construction procedure as follows). Figure 2 (a) The IVIS in vivo bioluminescence imaging system was used to monitor tumor growth and metastasis in real time, assess target organ metastatic burden, and evaluate the overall survival of tumor-bearing mice. Monitoring results are as follows: Figure 2 As shown.

[0072] Specifically, Figure 2 b represents the assessment of MC38-luciferase cell implantation and metastasis in the spleen of young and old mice on day 14 (n=6 per group). Figure 2 c shows the bioluminescence intensity of tumor cells inoculated with MC38-luciferase cells. Figure 2 d represents the Kaplan-Meier survival curves of young and aged mice inoculated with MC38 cells in a colorectal cancer liver metastasis model. P-values ​​were calculated using a log-rank test (n=10 per group). As shown in the aforementioned figures, in the constructed colorectal cancer liver metastasis model, aging exhibits a more rapid and significant promoting effect on tumor metastasis. In vivo imaging data showed that on day 14 of tumor model establishment, the liver region of aged mice (18 months old) showed a much stronger bioluminescent signal than that of young (2 months old) controls, suggesting that the aging microenvironment significantly improved the early metastasis and colonization of colorectal cancer cells. This accelerated early metastasis directly led to a significant adverse outcome: aged tumor-bearing mice began to die successively in the middle of the experiment, and their overall survival was significantly shorter than that of young mice.

[0073] To further elucidate the dynamic process of tumor growth and metastasis, this embodiment of the experiment conducted macroscopic observations of primary splenic tumors and liver metastases in mice on days 3, 7, 14, and 28. See also... Figure 2 e to i. Among them, e and f are representative gross images on days 3, 7, 14, 21, and 28 after intrasplenic injection of MC38 cells: e is an image of splenic tumor, and f is an image of liver metastases (n=6 per group). Figure 2 Image g is a representative H&E staining image of MC38 cell liver metastases (40x magnification), image scale bar: 2 mm. Figure 2 h represents the ImageJ analysis results of the changes in spleen tumor weight (n=6 per group) corresponding to Figure e; i represents the ImageJ analysis results of the changes in liver metastatic area on days 3, 7, 14, and 28 after MC38 cell injection. As shown in the aforementioned figures, in the first 7 days, the primary lesions in the spleens of both groups of mice were small and there was no significant difference; however, from day 14 onwards, the younger mice had larger primary lesion volumes, which remained larger than those in the older group in the later stages; however, in contrast to the primary lesions, from day 7 onwards, older mice showed more and larger metastatic nodules on the liver surface, and some nodules merged with each other, occupying a large amount of normal liver tissue, while younger mice only showed sporadic small metastatic points at this stage. Quantitative analysis showed that the total burden of liver metastases in older mice was significantly higher than that in younger mice from day 7 onwards.

[0074] Example 3

[0075] This embodiment confirms the effect of aging in promoting melanoma metastasis. Two-month-old C57BL / 6J mice were used as young controls, and a B16-luciferase melanoma subcutaneous inoculation model was established in 18-month-old C57BL / 6J mice. During model construction, B16 melanoma cells were subcutaneously injected into the mice. The tumor growth and metastasis process were monitored in real time using an IVIS in vivo bioluminescence imaging system to assess the target organ metastatic burden and the overall survival of tumor-bearing mice. Monitoring results are as follows: Figure 3 .

[0076] in, Figure 3a shows the comparison of tumor growth and metastasis quantification on the 7th and 21st days after subcutaneous implantation of B16-luciferase cells in young and old C57BL / 6J mice (n = 6 per group); b shows the statistical results of the bioluminescence intensity of tumors inoculated with B16-luciferase cells as shown in Figure a; c shows the Kaplan-Meier survival curves of young and old mice inoculated with B16 cells. The P value was calculated by log-rank test (n = 10 per group); d shows the measurement results of tumor size within 35 days after subcutaneous injection of B16 cells. From the above results, it can be seen that compared with the young (2-month-old) control group, the old (18-month-old) tumor-bearing mice showed a more aggressive metastatic phenotype. In vivo imaging showed that the tumor cells in old mice not only grew at the primary site, but also showed a strong tendency of distal spread. The survival life of tumor-bearing old mice was significantly shorter than that of young mice. It is worth noting that there was no significant difference in the volume of the primary tumor between young and old mice before 21 days, and from 28 days, the young mice had a larger volume of the primary tumor than the old mice.

[0077] Further detailed examination of the ex vivo tissues. The detection results are as Figure 3 shown in e to i of Figure 3 e shows representative gross pictures of peritoneal metastasis of B16-luciferase cells in young and old mice on the 21st day (n = 6 per group); f shows representative gross pictures and H&E staining pictures of lung metastasis of B16-luciferase cells in young and old mice on the 21st day, scale bar: 2 mm. Figure 3 g and h of

[0078] This study systematically validated the role of aging in tumor metastasis by integrating retrospective analysis of clinical cohorts with validation using multiple preclinical animal models. The main findings are as follows: First, clinical data analysis showed that in breast and colorectal cancer patients, advanced age (≥60 years) was independently associated with shorter time to metastasis after diagnosis and a higher initial metastasis rate. Subsequently, experimental studies using three different mouse tumor metastasis models (breast cancer, colorectal cancer, and melanoma) confirmed that an aging host system environment significantly promotes distant metastasis and leads to shortened survival. In summary, the aforementioned research, from clinical observation to experimental validation, provides strong evidence that aging is a key and universal risk factor driving tumor metastasis.

[0079] Example 4

[0080] In this embodiment, liver-specific anagomirs (conjugated with GalNAc) targeting four miRNAs—miR-25, miR-30c, miR-30d, and miR-92a—were synthesized. The anagomir sequences are shown in Table 1 (synthesized by Gene Pharma). These anagomirs were administered to aged mice via systemic intravenous injection, and their functionality and safety were comprehensively evaluated.

[0081] Table 1: Primer sequences for miRNA inhibitors (antagomir)

[0082]

[0083] Experimental Methods: Antagomirs, liver-targeting inhibitors of miR-25, miR-30c, miR-30d, and miR-92a conjugated with GalNAc, were dissolved in physiological saline and administered via tail vein injection (10 mg / kg) to 8-week-old or 18-month-old C57BL / 6J mice every other day. Specifically, antagomirs targeting miR-25, miR-30c, miR-30d, and miR-92a were injected via tail vein every 2 days for 24 days. The control group received an equal dose of scramble, and all other procedures were the same as the experimental group. The safety of antagomirs was monitored and evaluated starting on day 3 post-injection. Monitoring results are shown below. Figure 4 .

[0084] See Figure 4As shown in Figure a, this is the immunofluorescence staining of liver tissue from C57BL / 6J mice treated with antagomirs for 3 days; red represents miR-25 staining; green represents miR-30c staining; purple represents miR-30d staining; yellow represents miR-92a staining; and blue represents DAPI (nucleus) staining. Figure 4 Figure b shows a representative particle size distribution of EVs derived from the serum of aged C57BL / 6J mice treated with scramble or antagomirs for 7 days. The X-axis represents vesicle diameter, and the Y-axis represents vesicle concentration (10^6 particles / mL). Here, "Scramble" refers to the untargeted control sequence. Figure 4 Figure c represents the qRT-PCR analysis results of the relative expression levels of miR-25, miR-30c, miR-30d, and miR-92a in serum EVs of aged mice treated with Scramble or antagomirs for 7 days. As shown in the figures above, antagomir treatment effectively reduces the expression levels of its target miRNAs in the liver tissue of aged mice. However, the treatment did not significantly affect the total level of extracellular vesicles (EVs) in serum, but it significantly reduced the levels of miR-25, miR-30c, miR-30d, and miR-92a in serum EVs.

[0085] Further safety assessments were conducted using systematic toxicological testing on mice that received long-term antagomir treatment. The results are as follows: Figure 4 As shown in Figure d, representative H&E stained images (40x scan) of the heart, liver, spleen, lungs, kidneys, brain, and muscle tissues of aged mice treated with Scramble or antagomirs for 24 days are presented. Original image scale: 2 mm; magnified image scale: 200 μm. The aforementioned histopathological analysis showed that after 24 days of continuous administration, no obvious pathological changes were observed in the important organs of mice, such as the heart, liver, spleen, lungs, kidneys, brain, and muscles. The tissue structure and cell morphology remained intact, and no obvious abnormal lesions such as inflammatory cell infiltration, necrosis, or fibrosis were found.

[0086] Serum biochemical parameters were measured in aged mice treated with Scramble or antagomirs for 24 days. Figure 4e to h represent the expression levels of TNF-α (e), IL-6 (f), AST (g), and ALT (h) in the serum of aged mice treated with Scramble or antagomirs for 24 days. The results show that the levels of inflammatory factors (TNF-α and IL-6) in the treatment group mice were not significantly different from those in the control group, remaining within the normal physiological range. Furthermore, the results of liver function tests for aspartate aminotransferase (AST) and alanine aminotransferase (ALT) showed that antagomir treatment did not cause hepatocellular damage or abnormal liver function, and all indicators were within the normal reference range.

[0087] Example 5

[0088] This embodiment uses miR-25 / 30c / 30d / 92a antagomirs to inhibit liver metastasis of colorectal cancer in animals. Specifically, the anti-metastatic efficacy of antagomirs targeting miR-25, miR-30c, miR-30d, and miR-92a under single-drug and combination therapy conditions was further systematically evaluated in an MC38 colorectal cancer liver metastasis model. The treatment method was as follows: liver-targeting inhibitors of miR-25, miR-30c, miR-30d, and miR-92a conjugated with GalNAc (antagomirs) were dissolved in physiological saline and injected intravenously into 18-month-old C57BL / 6J mice every other day (dose 10 mg / kg, every 2 days for 24 days). The control group received an equal dose of scramble. Three days after the scramble / antagomir injection, an MC38-luciferase cell line was injected into the spleen of aged C57BL / 6J mice to establish an MC38 colorectal cancer liver metastasis model.

[0089] See the experimental results. Figure 5 .like Figure 5Figures a through c show: a) representative gross images of primary splenic tumors and liver metastases 21 days after injection of MC38-luciferase cells; b) statistical analysis of the quantitative analysis results of liver metastasis area; and c) statistical analysis of the quantitative analysis results of the weight of primary splenic tumors in aged mice treated with antagomirs. As can be seen from the aforementioned figures, although single antagomir treatments all showed a certain anti-metastatic trend, none reached statistical significance. Among them, the miR-92a antagomir monotherapy group showed the most significant effect, reducing liver metastasis area by approximately 25%. Notably, the combination therapy with two drugs showed a significant synergistic enhancement effect. In particular, the miR-30d and miR-92a antagomir combination therapy group reduced liver metastasis area by more than 60%, a statistically significant difference (***p < 0.001), indicating a good synergistic tumor-suppressive effect among different antagomirs. The most significant anti-metastatic effect was observed in the four antagomir combination therapy groups (****p < 0.0001). The liver metastasis burden in this group of mice was reduced by more than 90% compared with the control group, the complete metastasis inhibition rate reached 50%, and the tumor growth was confined to the primary spleen site, with no obvious distant metastasis observed.

[0090] See Figure 5 Figure d shows the Kaplan-Meier survival curves for a tumor model established by intrasplenic injection of MC38-luciferase cells in aged (18-month-old) C57BL / 6J mice after tail vein injection of antagmirs. P-values ​​were calculated using the log-rank test (n=6 mice per group), with **P < 0.01 and ***P < 0.001. The aforementioned survival analysis further showed that the four-drug combination therapy significantly prolonged the survival of mice, with a highly statistically significant difference.

[0091] Example 6

[0092] This embodiment uses miR-25 / 30c / 30d / 92a antagomirs to inhibit breast cancer metastasis in animals. Specifically, the inhibitory effect of antagomirs targeting miR-25, miR-30c, miR-30d, and miR-92a on breast cancer metastasis was further evaluated in a 4T1 breast cancer metastasis model. The administration method was as follows: the GalNAc-conjugated inhibitors of miR-25, miR-30c, miR-30d, and miR-92a (antagomirs) were dissolved in physiological saline and injected intravenously into 18-month-old Balb / c mice every other day (dose 10 mg / kg, every 2 days for 24 days). The control group received an equivalent dose of Scramble. Three days after the completion of scramble / antagomir injection, a 4T1 breast cancer metastasis model was established in aged mice by injecting 4T1-luciferase cells into the mammary fat pads.

[0093] See the experimental results. Figure 6 The figures show: (a) representative bioluminescence imaging and percentage of tumor metastasis 21 days after injection (n=6 mice per group); (b) quantitative analysis of tumor bioluminescence intensity after injection of 4T1-luciferase cells. The results indicate that each antagomir, used alone, reduced the metastasis rate to varying degrees, with individual miR-25, miR-30c, miR-30d, and miR-92a antagomirs showing inhibition ranges of approximately 16.7%–33.3%. In monotherapy, antagomirs targeting miR-30c and miR-30d showed relatively better anti-metastatic effects, suggesting that different miRNAs may have differentiated functional contributions in breast cancer metastasis. Further analysis of the anti-metastatic effect of combination therapy revealed that the combination of two antagomirs significantly enhanced the inhibitory effect, increasing the reduction in metastasis rate to 33.3%–50.0%, showing a more pronounced inhibitory trend than monotherapy, indicating a synergistic effect between different miRNA-targeted interventions. Among the four antagomir combination therapy groups, the anti-metastasis effect was the most significant; compared with the control group, the metastasis rate of mice in this group was reduced by more than 80% (up to 83.3%), showing a strong ability to inhibit metastasis.

[0094] See further Figure 6 Figure c shows the Kaplan-Meier survival curves of mice remodeled after injection of antagomir. P-values ​​were calculated using the log-rank test (n=6 mice per group). The survival analysis results illustrated in the figure indicate that the combination of four antagomir treatments significantly prolonged the overall survival of mice (**p<0.01), suggesting that this combined intervention strategy has a significant advantage at the functional outcome level.

[0095] Example 7

[0096] This embodiment uses miR-25 / 30c / 30d / 92a antagomirs to inhibit melanoma metastasis in animals. Specifically, the inhibitory effect of antagomirs targeting miR-25, miR-30c, miR-30d, and miR-92a on melanoma metastasis was further evaluated in a B16 melanoma metastasis model. The administration method was as follows: the GalNAc-conjugated inhibitors of miR-25, miR-30c, miR-30d, and miR-92a (antagomirs) were dissolved in physiological saline and injected intravenously into 18-month-old C57BL / 6J mice every other day (dose 10 mg / kg, every 2 days for 24 days). The control group received an equivalent dose of Scramble. Three days after the completion of scramble / antagomir injection, a melanoma metastasis model was established in aged mice by subcutaneous injection of B16-luciferase cells.

[0097] See the experimental results. Figure 7 . Figure 7 Figure a shows a representative gross image and percentage of tumor metastasis 21 days after B16-luciferase cell injection; figure b shows quantitative analysis of tumor bioluminescence intensity; figure c shows Kaplan-Meier survival curves, with P-values ​​calculated using a log-rank test (n=6 mice per group). The experimental results shown in the figures indicate that the inhibitory effect of individual antagomir on tumor metastasis is relatively limited, with a metastasis rate reduction ranging from 0% to 16.6%, and no significant inhibitory advantage was observed overall. Further analysis of the combined treatment effect revealed that the combination of two antagomir significantly enhanced the anti-metastatic effect, increasing the metastasis rate reduction to 33.3%–66.6%, showing a more significant inhibitory trend than single-drug treatment. Among these, the metastasis rate of miR-25 / miR-92a was reduced to 16.7%, exhibiting the best inhibitory effect in the two-drug combination, suggesting a synergistic effect of different miRNA targeting interventions in this model. The anti-metastatic effect was also very significant in the four antagomir combination treatment groups (***p<0.001). Compared with the control group, the metastasis inhibition rate of this group of mice exceeded 65%, demonstrating a potent and stable metastasis inhibition ability. Meanwhile, survival analysis as shown in Figure c revealed that the combination of four antagomir treatments significantly prolonged the overall survival time of the mice, indicating that this combined intervention strategy has a clear advantage at the functional outcome level.

[0098] The combined experimental results from various tumor metastasis models, including MC38 colon cancer, 4T1 breast cancer, and B16 melanoma, demonstrate that antagomirs targeting miR-25, miR-30c, miR-30d, and miR-92a effectively inhibit tumor metastasis across different tumor types. Furthermore, the combined use of these antagomirs exhibits a more significant synergistic effect compared to monotherapy. These results functionally support the use of multi-miRNA combined targeting as a potential anti-metastatic therapeutic strategy.

[0099] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features. These modifications or substitutions, or combinations of technical features in the above embodiments that do not conflict with each other, can be made in accordance with the manner described in the embodiments. These modifications, substitutions or combinations do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of at least one of the groups consisting of miR-92a, miR-25, miR-30d and miR-30c and their inhibitors in the preparation of drugs for the treatment of multiple cancer metastases.

2. The use according to claim 1, characterized in that, At least one of the following is selected as the detection target: miR-92a, miR-25, miR-30d, and miR-30c.

3. The use according to claim 1, characterized in that, The inhibitor is the nucleic acid inhibitor antagomirs.

4. The use according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid inhibitor antagomirs is as follows: miR-92a-3p antagomir: 5'CAGGCCGGGACAAGUGCAAUA; miR-25-3p antagomir: 5'UCAGACCGAGACAAGUGCAAUG; miR-30d-5p antagomir: 5'UGUAAACAUCCCCGACUGGAAG; miR-30c-5p antagomir: 5'GCUGAGAGUGUAGGAUGUUUACA.

5. The use according to claim 1, characterized in that, The multiple cancer types mentioned include breast cancer, colorectal cancer, and melanoma.

6. A drug for inhibiting the metastasis of multiple cancer types, characterized in that, It includes antagomirs, nucleic acid inhibitors that target at least one of the group consisting of miR-92a, miR-25, miR-30d, and miR-30c, wherein the multiple cancers are one of breast cancer, colorectal cancer, and melanoma.

7. The drug according to claim 6, characterized in that, The nucleotide sequence of the nucleic acid inhibitor antagomirs is as follows: miR-92a-3p antagomir: 5'CAGGCCGGGACAAGUGCAAUA; miR-25-3p antagomir: 5'UCAGACCGAGACAAGUGCAAUG; miR-30d-5p antagomir: 5'UGUAAACAUCCCCGACUGGAAG; miR-30c-5p antagomir: 5'GCUGAGAGUGUAGGAUGUUUACA.

8. The drug according to claim 6, characterized in that, The nucleic acid inhibitor is a liver-targeting agent conjugated with GalNAc, which can specifically reduce the expression levels of miR-25, miR-92a, miR-30c, and miR-30d in liver tissue and serum extracellular vesicles (EVs).

9. The drug according to claim 6, characterized in that, The drug is an intravenous injection.

10. The medicament according to claim 6, characterized in that, The drug contains antagomirs, nucleic acid inhibitors that target at least two of miR-92a, miR-25, miR-30d, and miR-30c; preferably, the drug contains antagomirs, nucleic acid inhibitors that target four of the miRs that target miR-92a, miR-25, miR-30d, and miR-30c.

Images