Molecular marker combination closely linked to maize plant height and ear height and application thereof

Abstract

The application provides a molecular marker combination closely linked with corn plant height and ear position height and application thereof, wherein the molecular marker combination comprises a first SNP site and a second SNP site, the first SNP site is located at 139,323,557 bp of the 7th chromosome of corn, and the nucleotide polymorphism is G / A; the second SNP site is located at 139,323,577 bp of the 7th chromosome of corn, and the nucleotide polymorphism is C / T, wherein the first SNP site and the second SNP site are completely linked in a natural population. The molecular marker combination of the application can be used for rapidly and accurately screening corn materials with ideal plant type at the seedling stage, and significantly improves the breeding efficiency.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker combination closely linked to maize plant height and ear height and its application. Background Technology

[0002] Maize (Zea mays L.) is an important crop used for both food and feed, and it also plays a vital role in various fields such as industrial raw materials and bioenergy. With population growth, the development of animal husbandry, and the expansion of the new energy industry, the demand for maize continues to increase. Drought, as a key abiotic stress factor, significantly affects the morphogenesis and physiological functions of maize, particularly its adverse effects on plant height and ear height.

[0003] Plant height and ear height are important agronomic traits that determine maize plant architecture. Appropriate plant height and a lower ear height not only enhance the plant's resistance to lodging—especially important given the increasing frequency of extreme weather events—but also improve the efficiency of mechanized harvesting. Furthermore, optimizing the ratio of plant height to ear height can improve canopy light penetration, increase photosynthetic efficiency and nutrient utilization efficiency, and promote the effective translocation and distribution of photosynthetic products to the ear, thereby increasing the harvest index per plant and achieving the goal of high and stable yields. Summary of the Invention

[0004] In view of this, the present invention provides a molecular marker combination closely linked to maize plant height and ear height and its application. This molecular marker combination can rapidly and accurately screen maize materials with ideal plant type (such as low plant height and ear height) during the seedling stage, significantly improving breeding efficiency.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a molecular marker combination comprising a first SNP site and a second SNP site, wherein the first SNP site is located at 139,323,557 bp on chromosome 7 of maize and has a nucleotide polymorphism of G / A; and the second SNP site is located at 139,323,577 bp on chromosome 7 of maize and has a nucleotide polymorphism of C / T, wherein the first SNP site and the second SNP site are completely linked in a natural population.

[0006] It should be noted that this invention is based on field trial data from seven locations over two years, and conducted a plant height phenotype survey on an associated population composed of 561 maize inbred lines. Combined with genome-wide association analysis (GWAS), two SNP loci that were significantly associated with plant height and ear height under all experimental conditions were identified: SNP_Chr7_139323557 and SNP_Chr7_139323577 (see Tables 1 and 2 for details).

[0007] Based on the maize B73 reference genome RefGen_v5, the two SNPs mentioned above are located at 139,323,557bp (G / A) and 139,323,577bp (C / T) on chromosome 7, respectively, 20bp apart. They are completely linked in the natural population and constitute a stable haplotype block.

[0008] Of the 561 inbred lines, 448 carried the B73 reference allele (GC), with a frequency of 0.7986; and 113 carried the mutant allele (AT), with a frequency of 0.2014. Sequence annotation showed that these two SNPs were located in the upstream promoter region of the gene Zm00001eb316960, and their haplotype variation was significantly correlated with maize plant height and ear height phenotypes.

[0009] The KASP molecular marker of this invention is designed based on the two fully linked SNP loci mentioned above. Individuals with the genotype GG / CC exhibit higher plant height and ear height, while individuals with the genotype AA / TT exhibit lower plant height and ear height. Therefore, the AT haplotype is a superior allelic combination for reducing plant height and ear height, and has important application value in plant architecture improvement breeding.

[0010] Secondly, the present invention provides a primer pair combination, the primer pair combination comprising: SNP_Chr7_139323577_F1, nucleotide sequence as shown in SEQ ID NO:1, specifically 5′-GAAGGTGACCAAGTTCATGCTGTTTGCACCAATTGACTGGTC-3′ SNP_Chr7_139323577_F2, nucleotide sequence as shown in SEQ ID NO:2, specifically 5′-GAAGGTCGGAGTCAACGGATTAATTTGCACCAATTGACTGGTT-3′ SNP_Chr7_139323577_R, nucleotide sequence as shown in SEQ ID NO:3, specifically 5′-TATAGGCAGTCTCGCAAGGCTAAT-3′.

[0011] Preferably, the nucleotide sequence of SNP_Chr7_139323577_F1 includes a universal tag for the FAM fluorescent channel, and the nucleotide sequence of SNP_Chr7_139323577_F2 includes a universal tag for the HEX fluorescent channel. It should be noted that in the nucleotide sequence of SNP_Chr7_139323577_F1, the prefix sequence GAAGGTGACCAAGTTCATGCT is a universal tag for the FAM fluorescent channel (corresponding to alleles G / C), and in the nucleotide sequence of SNP_Chr7_139323577_F2, GAAGGTCGGAGTCAACGGATT is a universal tag for the HEX fluorescent channel (corresponding to alleles A / T).

[0012] Thirdly, the present invention provides an application of the aforementioned molecular marker combination in detecting or predicting the phenotypic levels of maize plant height and ear height. When the genotypes of maize plants at the above two loci are GG / CC, they exhibit higher plant height and ear height; when the genotypes are AA / TT, they exhibit lower plant height and ear height.

[0013] Fourthly, the present invention provides an application of the aforementioned molecular marker combination in marker-assisted selection breeding of maize.

[0014] Fifthly, the present invention provides an application of the aforementioned molecular marker combination in the genetic improvement of maize germplasm resources.

[0015] Sixthly, the present invention provides a method for detecting maize plant height and ear height traits, comprising the following steps: S1. Extract genomic DNA from the maize sample to be tested; S2. Using the DNA as a template and the primer pair combination, add KASP genotyping premix to prepare the KASP reaction system. S3. Perform PCR amplification and genotyping the amplification products by fluorescence signal detection; S4. Determine the phenotypic tendency of maize plant height and ear height based on the genotyping results: If the genotypes of the first SNP locus and the second SNP locus are GG and CC respectively, the plant is determined to have a higher plant height and ear height; if the genotypes are AA and TT respectively, the plant is determined to have a lower plant height and ear height.

[0016] Preferably, in step S2, the KASP reaction system comprises: 2.5 μL of KASP 2×PCR Mix; 0.6 μL of primer premix; and 1.5 μL of template DNA.

[0017] Preferably, in step S3, the PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 61℃ annealing / extension for 60 s, for a total of 10 cycles, with the annealing temperature decreasing by 0.6℃ in each cycle; followed by 30 cycles: 95℃ denaturation for 15 s, 55℃ annealing / extension for 60 s; and finally incubation at 37℃ for 30 s.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) Based on field trial data from seven locations over two years, this invention investigated the plant height phenotype of an associated population composed of 561 maize inbred lines. Combined with genome-wide association analysis (GWAS), two SNP loci, SNP_Chr7_139323557 and SNP_Chr7_139323577, were identified as being highly significantly associated with plant height and ear height under all experimental conditions. This molecular marker combination can rapidly and accurately screen maize materials with ideal plant types (such as lower plant height and ear height) at the seedling stage, significantly improving breeding efficiency.

[0019] (2) This invention utilizes KASP genotyping technology to achieve rapid, low-cost, and high-throughput genotyping at the maize seedling stage without the need for enzyme digestion, electrophoresis, or sequencing. This method is simple to operate and reliable in terms of results, which can significantly reduce the workload of field phenotyping, shorten the breeding cycle, and provide an efficient tool for molecular design breeding of ideal maize plant types (short stalks, low ear position). Attached Figure Description

[0020] Figure 1 The Manhattan plots are based on the genome-wide association analysis (GWAS) results of the plant height trait of maize populations in Chengdu, Sichuan Province (CD) in 2024, as provided in Example 1, and are analyzed using the general linear model (GLM), Q model, and K model. Figure 2 The GWAS analysis results of the plant height trait of maize associated populations in Haidian District, Beijing (HD) in 2024 provided in Example 1 are based on Manhattan plots of GLM, Q model and K model; Figure 3 The GWAS analysis results of the plant height trait of maize associated populations in Tieling City, Liaoning Province (TL) in 2024 provided in Example 1 are based on Manhattan plots of GLM, Q model and K model; Figure 4 The GWAS analysis results of the plant height trait of maize associated populations in Harbin, Heilongjiang Province (HEB) in 2024 provided in Example 1 are based on Manhattan plots of GLM, Q model and K model; Figure 5The GWAS analysis results of the plant height trait of maize associated populations in Haidian District, Beijing (HD) in 2025 provided in Example 1 are based on Manhattan plots of GLM, Q model and K model; Figure 6 The GWAS analysis results of the plant height trait of maize associated populations in Tieling City, Liaoning Province (TL) in 2025 provided in Example 1 are based on Manhattan plots of GLM, Q model and K model; Figure 7 The GWAS analysis results of the plant height trait of maize associated populations in Gongzhuling City (GZL), Jilin Province in 2025, provided in Example 1, are based on Manhattan plots of GLM, Q model, and K model. Figure 8 Haplotype box plots of genotypes (GG / CC vs AA / TT) and plant height traits at SNP_Chr7_139323557 and SNP_Chr7_139323577 for the 561 related population inbred lines provided in Example 1; Figure 9 Box plots of genotypes (GG / CC vs AA / TT) and ear height traits at SNP_Chr7_139323557 and SNP_Chr7_139323577 for the 561 inbred lines from related populations provided in Example 1; Figure 10 The image shows the KASP genotyping results of the 40 maize inbred lines provided in Example 2.

[0021] Note: In Figure 8 Corresponding to the legend labels in the figure Figure 1-7 The test site, in Figure 9 Corresponding to the legend labels in the figure Figure 1-7 The test site Figure 10 - Blue square (FAM fluorescence channel): Represents genotype GG / CC (reference allele, corresponding to higher plant height and ear height); - Red square (HEX fluorescence channel): Represents genotype AA / TT (mutant allele, corresponding to lower plant height and ear height); - Black square: Negative control (NTC). (Note: Each material was tested twice in duplicate, and the results were consistent.) Detailed Implementation

[0022] The present invention will be further described in detail below with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention. Unless otherwise specified, the technical means used in the embodiments are all conventional methods in the art, and the reagents used are all commercially available. The maize materials used in the embodiments of the present invention are all from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0023] Example 1: GWAS and haplotype analysis related to plant height and ear height traits 1.1 Building Related Groups This embodiment uses 561 high-quality maize inbred lines with rich genetic backgrounds collected from multiple breeding units across the country as the associated population, covering major maize producing areas in my country (such as Northwest, Southwest, North China and Northeast regions).

[0024] 1.2 Field phenotypic survey Experimental materials were planted in Chengdu (CD), Sichuan Province; Haidian District, Beijing (HD), Beijing; Tieling City, Liaoning Province (TL), and Harbin City, Heilongjiang Province (HEB) in 2024. Planting continued in Haidian District, Beijing (HD), Tieling City, Liaoning Province (TL), and Gongzhuling City, Jilin Province (GZL) in 2025. Conventional water and fertilizer management was used. After pollen shedding, plant height (average height from ground to tassel tip) and ear height (average height from ground to ear node) were measured in centimeters (cm). Three plants were measured per row, and the average value was taken.

[0025] 1.3 GWAS analysis and SNP locus identification Whole-genome resequencing was performed on 561 accessions, yielding approximately 6.25 million high-quality SNP markers after quality control. GWAS analysis was conducted using TASSEL 5.0 software based on three models: (1) Generalized Linear Model (GLM); (2) GLM (Q model) with population structure correction added; (3) A hybrid linear model that integrates group structure and kinship (K model, MLM).

[0026] The results are as follows Figures 1 to 7 As shown, the analysis results identified two fully linked SNP loci on maize chromosome 7 that were significantly associated with plant height: SNP_Chr7_139323557 (Location: 139,323,557bp, Polymorphism: G / A) SNP_Chr7_139323577 (Location: 139,323,577bp, Polymorphism: C / T) The above loci were significantly correlated with plant height and ear height in all experimental years (2024-2025) and geographical locations (see Tables 1 and 2 for details). Analysis of the data in Tables 1 and 2 shows that the loci exhibited extremely high statistical significance (P values ​​all reached the significance level) in detection in different years and ecological zones, and the results were highly consistent, indicating that it has broad applicability.

[0027] Table 1. P-values ​​of significant SNP sites in maize plant height trait across multiple years and locations in GWAS (based on various models). Table 2. P-values ​​of significant differences in maize ear height phenotype based on SNP haplotype grouping under multi-location conditions in 2024–2025. 1.4 Haplotype-Phenotype Association Analysis Haplotypes were constructed based on two SNP loci: Reference haplotype (GG / CC): 448 materials (frequency 0.7986), corresponding to higher plant height and ear height; Mutant haplotype (AA / TT): 113 materials (frequency 0.2014), corresponding to lower plant height and ear height.

[0028] In 561 associated populations, the plant height and ear height phenotypes of the two haplotypes showed highly significant differences. Figure 8 , Figure 9 ).

[0029] Example 2: Development and validation of KASP molecular markers associated with maize plant height and ear height traits 2.1 Test Materials Forty maize inbred lines with significant differences in plant height and ear height were selected for KASP genotyping verification. Among them: High phenotypic group (20 copies): In the two-year, seven-location trial, the average plant height was ≥240cm and the ear height was ≥90cm; Low phenotype group (20 copies): average plant height ≤200cm, ear height ≤80cm.

[0030] All materials were obtained from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. Detailed SNP genotype and multi-site phenotypic data are shown in Tables 3 (plant height) and 4 (ear height). Statistical results showed that the average plant height of the GG / CC genotype materials was significantly higher than that of the AA / TT genotype materials. Furthermore, in the two-year, seven-site experiment, the plant height and ear height corresponding to the two genotypes showed highly significant differences, demonstrating the close linkage between this marker and the target trait.

[0031] Table 3 Plant height data and genotypes of 40 maize materials Table 4. Ear height data and genotypes of 40 maize materials 2.2 Development of KASP molecular markers Based on two fully linked SNP sites on chromosome 7 of the maize B73 reference genome (RefGen_v5)—SNP_Chr7_139323557 (G / A) and SNP_Chr7_139323577 (C / T)—200 bp flanking sequences were extracted upstream and downstream of each site for KASP primer design.

[0032] The developed KASP marker consists of three primers: Two allele-specific forward primers (corresponding to G / C and A / T alleles, respectively). A universal reverse primer.

[0033] The primer sequences are as follows (synthesized by Beijing Liuhe BGI Genomics Co., Ltd.): SNP_Chr7_139323577_F1 (SEQ ID NO:1): 5′- GAAGGTGACCAAGTTCATGCT GTTTGCACCAATTGACTGGTC-3′ SNP_Chr7_139323577_F2 (SEQ ID NO:2): 5′- GAAGGTCGGAGTCAACGGATT AATTTGCACCAATTGACTGGTT-3′ SNP_Chr7_139323577_R (SEQ ID NO:3): 5′-TATAGGCAGTCTCGCAAGGCTAAT-3′ The prefix GAAGGTGACCAAGTTCATGCT is a universal tag for the FAM fluorescence channel (corresponding to alleles G / C). The prefix GAAGGTCGGAGTCAACGGATT is a universal tag for the HEX fluorescence channel (corresponding to allele A / T).

[0034] Note: Although the primers are mainly named "139323577", this primer set can detect haplotypes formed by two sites simultaneously because the two SNPs are completely linked.

[0035] 2.3 Genomic DNA Extraction Genomic DNA was extracted from 46 fresh maize seedling leaves using a modified CTAB method. The specific steps are as follows: (1) Take 3-5 mg of leaf tissue, place it in a 2.0 mL centrifuge tube, add a steel ball, freeze it with liquid nitrogen, and then shake it for 30 s using an automatic grinder; (2) Add 500 μL of CTAB buffer (containing 2% β-mercaptoethanol) preheated to 65°C and mix gently; (3) Incubate in a water bath at 65℃ for 1 hour, inverting and mixing once every 15-20 minutes during the period; (4) After cooling to room temperature, centrifuge briefly, add 500 μL of chloroform:isoamyl alcohol (24:1), gently invert and mix, let stand for 30 min and mix again, repeat twice, centrifuge at 12,000 rpm for 10 min. (5) Pipette 400 μL of supernatant into a new tube, add an equal volume (400 μL) of pre-cooled isopropanol, and precipitate at -20℃ for 30 min; (6) Centrifuge at 4℃ and 12,000 rpm for 10 min, and discard the supernatant; (7) Add 300 μL of 70% ethanol to wash the precipitate, centrifuge at 12,000 rpm for 5 min, and air dry at room temperature; (8) Dissolve the DNA in 50 μL ddH2O.

[0036] DNA quality testing: Integrity was verified by agarose gel electrophoresis (1%, 60V, 35min); NanoDrop determines concentration and purity to ensure OD 260 / 280 The ratio is between 1.8 and 2.0.

[0037] 2.4 KASP Genotyping and Validation Dilute the DNA sample to a final concentration of 15-30 ng / μL, and perform two technical replicates for each sample. The KASP reaction system (5 μL) consists of the following: KASP 2×PCR Mix: 2.5 μL; Primer premix: 0.6 μL (mix 10 μM of SEQ ID NO:1, NO:2, NO:3 with ddH2O in a volume ratio of 1:1:2:6*). Template DNA (15-30 ng / μL): 1.5 μL.

[0038] Note: The standard KASP primer mixing ratio is usually F1:F2:R=1:1:2, and the total primer concentration needs to be balanced.

[0039] PCR amplification procedure: Pre-denaturation at 95℃ for 10 min; 95℃ denaturation for 15s, 61℃ annealing / extending for 60s, 10 cycles (annealing temperature decreases by 0.6℃ per cycle); 95℃ denaturation for 15s, 55℃ annealing / extending for 60s, 30 cycles; Incubate at 37℃ for 30 seconds, and collect FAM and HEX dual-channel fluorescence signals (QuantStudio™ Design & Analysis Software v1.5.2).

[0040] Interpretation of classification results: Blue clusters (strong FAM signal): Genotype GG / CC, corresponding to higher plant height and ear height; Red clusters (strong HEX signal): Genotype AA / TT, corresponding to lower plant height and ear height; Black dots: Negative control (NTC), no amplification.

[0041] Compared with whole-genome resequencing results, KASP genotyping accuracy reached 100%. Figure 10 This confirms that the tag was successfully developed.

[0042] Therefore, the KASP molecular marker of the present invention can be used efficiently and accurately for seedling prediction and screening of superior maize plant type materials with low plant height and high ear position, significantly improving the efficiency of molecular-assisted breeding.

[0043] 2.5 Application Value The KASP tag has the following advantages: (1) High accuracy: 100% interpretation accuracy was achieved in 40 extreme phenotypic materials; (2) Wide adaptability: It showed stability in 7 ecological zones spanning Northeast, North, and Southwest China; (3) Breeding practicality: Selection can be completed during the seedling stage, avoiding large-scale phenotypic identification in the field, and significantly reducing labor and land costs.

[0044] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.

[0045] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A primer pair combination, characterized in that, The primer pair combinations include: SNP_Chr7_139323577_F1, nucleotide sequence as shown in SEQ ID NO:1; SNP_Chr7_139323577_F2, nucleotide sequence as shown in SEQ ID NO:2; SNP_Chr7_139323577_R, nucleotide sequence as shown in SEQ ID NO:3; The nucleotide sequence of SNP_Chr7_139323577_F1 includes a universal tag for the FAM fluorescent channel, and the nucleotide sequence of SNP_Chr7_139323577_F2 includes a universal tag for the HEX fluorescent channel.

2. The application of a molecular marker combination in detecting or predicting the phenotypic levels of maize plant height and ear height, characterized in that, When the genotypes of maize plants at the first SNP locus and the second SNP locus are GG / CC, they exhibit higher plant height and ear height; when the genotypes are AA / TT, they exhibit lower plant height and ear height. Based on the maize B73 reference genome RefGen_v5, the first SNP site is located at 139,323,557 bp on maize chromosome 7, with a nucleotide polymorphism of G / A; the second SNP site is located at 139,323,577 bp on maize chromosome 7, with a nucleotide polymorphism of C / T. The first and second SNP sites are completely linked in the natural population.

3. Application of a molecular marker combination in marker-assisted selection breeding of maize, wherein the molecular marker combination includes: The first SNP site, based on the maize B73 reference genome RefGen_v5, is located at 139,323,557 bp on chromosome 7 of maize, with a nucleotide polymorphism of G / A; The second SNP site, based on the maize B73 reference genome RefGen_v5, is located at 139,323,577 bp on chromosome 7 of maize, with a nucleotide polymorphism of C / T. The first SNP site and the second SNP site are completely linked in the natural population. When the genotypes of maize plants at the first SNP locus and the second SNP locus are GG / CC, they exhibit higher plant height and ear height; when the genotypes are AA / TT, they exhibit lower plant height and ear height.

4. Application of a molecular marker combination in the genetic improvement of maize germplasm resources, wherein the molecular marker combination includes: The first SNP site, based on the maize B73 reference genome RefGen_v5, is located at 139,323,557 bp on chromosome 7 of maize, with a nucleotide polymorphism of G / A; The second SNP site, based on the maize B73 reference genome RefGen_v5, is located at 139,323,577 bp on chromosome 7 of maize, with a nucleotide polymorphism of C / T. The first SNP site and the second SNP site are completely linked in the natural population. When the genotypes of maize plants at the first SNP locus and the second SNP locus are GG / CC, they exhibit higher plant height and ear height; when the genotypes are AA / TT, they exhibit lower plant height and ear height.

5. A method for detecting maize plant height and ear height traits, characterized in that, Includes the following steps: S1. Extract genomic DNA from the maize sample to be tested; S2. Using the DNA as a template, and employing the primer pair combination described in claim 1, add KASP genotyping premix to prepare the KASP reaction system. S3. Perform PCR amplification and genotyping the amplification products by fluorescence signal detection; S4. Determine the phenotypic tendency of maize plant height and ear height based on genotyping results: If the genotypes of the first SNP locus and the second SNP locus are GG and CC respectively, then the maize plant is determined to have a higher plant height and ear height; if the genotypes are AA and TT respectively, then the maize plant is determined to have a lower plant height and ear height. The first SNP site, based on the maize B73 reference genome RefGen_v5, is located at 139,323,557 bp on chromosome 7 of maize, with a nucleotide polymorphism of G / A; The second SNP site, based on the maize B73 reference genome RefGen_v5, is located at 139,323,577 bp on chromosome 7 of maize, with a nucleotide polymorphism of C / T. The first and second SNP sites are completely linked in the natural population.

6. The detection method according to claim 5, characterized in that, In step S2, the KASP reaction system comprises: 2.5 μL of KASP 2×PCR Mix; 0.6 μL of primer premix; and 1.5 μL of template DNA.

7. The detection method according to claim 5, characterized in that, In step S3, the PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 61℃ annealing / extension for 60 s, for a total of 10 cycles, with the annealing temperature decreasing by 0.6℃ in each cycle; followed by 30 cycles: 95℃ denaturation for 15 s, 55℃ annealing / extension for 60 s; and finally incubation at 37℃ for 30 s.

Images