Capture primer group and kit for targeting Salivirus genome sequencing and application of capture primer group and kit

Abstract

The invention provides a capture primer group and a kit for targeted Salivirus genome sequencing and application of the capture primer group and the kit, and belongs to the technical field of genome sequencing. The targeted capture primer group of the Salivirus virus genome comprises a primer 1 and a primer 2, the nucleotide sequence of the primer 1 is as shown in SEQ ID NO. 1, and the nucleotide sequence of the primer 2 is as shown in SEQ ID NO. 2. According to the invention, a universal reverse transcription oligo-T primer and the Salivirus specific primer group provided by the invention are put into the reverse transcription step at the same time, so that not only is a macro transcription effect achieved, but also a Salivirus sequence in a sample is synchronously identified for specific capture. According to the method, the complete Salivirus genome sequence can be efficiently obtained, and the method has good coverage and sequencing adaptability to the virus genome.

Description

Technical Field

[0001] This invention belongs to the field of genome sequencing technology, and in particular relates to a capture primer set, kit, and application for targeted sequencing of the Salivirus genome. Background Technology

[0002] Salivirus is a newly discovered small RNA virus. It was first discovered in a stool sample from a child in Australia in 2009, and was also found in the stool of a child with non-polio acute flaccid paralysis in Nigeria in the same year. Subsequently, the virus has been detected in stool samples and sewage from children with gastroenteritis in multiple countries around the world, suggesting that Salivirus infection may be associated with acute gastroenteritis.

[0003] The Salivirus genome is a single-stranded positive-sense RNA, approximately 8021 nucleotides in length (excluding the poly(A) tail), encoding a polyprotein, which is cleaved by a virus-encoded enzyme to form the final functional protein. Salivirus exhibits significant genetic diversity, particularly in the VP1 region, with amino acid homology between different genotypes ranging from 84.7% to 87.2%.

[0004] Obtaining the viral genome is a prerequisite for accurate typing, tracing transmission chains, identifying recombinant strains, and assessing zoonotic disease risks. It is also crucial for early warning of emerging variant strains. Currently, there are no reports of successful in vitro culture of Salivirus. Its genome is primarily obtained through viral nucleic acid in samples, and there is currently no method available for rapidly and efficiently obtaining the complete genome sequence information of Salivirus. Summary of the Invention

[0005] In view of this, one of the objectives of the present invention is to provide a set of primers for targeted capture of the Salivirus genome.

[0006] The second objective of this invention is to provide a sequencing reagent that targets the genome of the Salivirus.

[0007] The third objective of this invention is to provide a sequencing kit that targets the genome of the Salivirus.

[0008] The fourth objective of this invention is to provide the application of the targeted capture primer set, the sequencing reagent, or the sequencing kit in the sequencing of Salivirus metaviomes.

[0009] The fifth objective of this invention is to provide a method for sequencing the metaviromome of Salivirus.

[0010] The sixth objective of this invention is to provide the application of the targeted capture primer set, the sequencing reagent, the sequencing kit, or the method in any one of the following: the preparation of products for monitoring Salivirus, the preparation of products for Salivirus prevention and control, and the preparation of products for Salivirus typing.

[0011] To achieve the above-mentioned objectives, the present invention provides the following technical solution: A targeted capture primer set for the Salivirus genome, comprising primer 1 and primer 2; the nucleotide sequence of primer 1 is shown in SEQ ID NO.1, and the nucleotide sequence of primer 2 is shown in SEQ ID NO.2.

[0012] The present invention also provides a sequencing reagent targeting the Salivirus genome, the sequencing reagent comprising the aforementioned targeting capture primer set.

[0013] The present invention also provides a sequencing kit for targeting the Salivirus genome, the sequencing kit comprising the targeted capture primer set or the sequencing reagent.

[0014] The present invention also provides the application of the aforementioned targeted capture primer set, the aforementioned sequencing reagent, or the aforementioned sequencing kit in the sequencing of Salivirus metavitomy.

[0015] This invention also provides a method for sequencing the metavinomic genome of Salivirus, comprising the following steps: RNA was extracted from the sample to be tested; Reverse transcription amplification was performed using the aforementioned targeted capture primer set; After the reverse transcription amplification product is fragmented, a library is constructed and sequenced.

[0016] Preferably, the reverse transcription amplification system comprises: 10 μL RNA template, 2 μL 10×RT Mix, 2 μL HiScriptIII Enzyme Mix, and Oligo (dT). 20 VN 1 μL, the capture primer set 1 μL, and nuclease-free double-distilled water 4 μL.

[0017] Preferably, the working concentration of the capture primer set is 2 μM.

[0018] Preferably, the reverse transcription amplification procedure is as follows: under a hot cap at 105°C, 25°C for 5 minutes, 37°C for 30 minutes, 85°C for 5 seconds, and then cooled to 4°C.

[0019] Preferably, the reverse transcription amplification product fragmentation is performed using Tn5 transposase to fragment the reverse transcription amplification product.

[0020] The present invention also provides the application of the target capture primer set, the sequencing reagent, the sequencing kit, or the method thereof in any one of the following (1) to (3), (1) Prepare products for monitoring Salivirus; (2) Prepare products for the prevention and control of Salivirus; (3) Prepare products for Salivirus typing.

[0021] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a targeted capture primer set for the Salivirus genome. Based on the theory of Transposase-assisted RNA-DNA hybrids Co-tagmEntation (TRACE-seq), this invention designs a targeted capture primer set for transcription sequencing. During the reverse transcription step, both a general reverse transcription oligo-T primer and the Salivirus-specific primer set provided by this invention are simultaneously applied, achieving both macrotranscription and simultaneous recognition and specific capture of Salivirus sequences in the sample. The TRACE-seq method does not require the design of PCR primers approximately 20 bp in length; only short reverse transcription primers of 12-14 bp are needed to efficiently complete the specific reverse transcription step. The primer set of this invention can target Salivirus-specific reverse transcription, performing preliminary screening and enrichment of the Salivirus, increasing the concentration of effective sequences, and improving the success rate of library extraction.

[0022] This invention's sequencing method utilizes the Tn5 transposase's ability to specifically recognize and simultaneously fragment RNA-cDNA double strands, without relying on sonication. The transposase method results in more stable fragment sizes. This invention automatically adds universal fragments during fragmentation, requiring only one step to add the index, reducing library construction steps and saving time. For diarrheal virus samples, this invention can simultaneously complete macrotranscription library construction and targeted library construction for key diarrheal infectious disease viruses of concern at ports of entry, achieving simultaneous "macro" and "targeted" completion, improving the breadth, specificity, and efficiency of viral sequence recognition. Attached Figure Description

[0023] Figure 1 This describes the metaviromic sequencing process for Salivirus. Detailed Implementation

[0024] This invention provides a targeted capture primer set for the Salivirus genome, comprising primer 1 and primer 2. The nucleotide sequence of primer 1 is shown in SEQ ID NO.1: (target 5'-3')GCAGCAACTACATGGCTTAGGGTCC, and the nucleotide sequence of primer 2 is shown in SEQ ID NO.2: (target 5'-3')GAGGGNCCAGGAGTGACAAG. N represents the degenerate bases: N=A / T / C / G. The primer set provided by this invention can achieve metatranscription and simultaneously identify and specifically capture Salivirus sequences in the sample. This primer set can perform preliminary screening and enrichment of Salivirus, increasing the concentration of effective sequences and improving the success rate of library extraction.

[0025] This invention also provides a sequencing reagent targeting the Salivirus genome, the sequencing reagent comprising the aforementioned targeting capture primer set. This invention also provides a sequencing kit targeting the Salivirus genome, the sequencing kit comprising either the aforementioned targeting capture primer set or the aforementioned sequencing reagent.

[0026] This invention also provides the application of the targeted capture primer set, the sequencing reagent, or the sequencing kit in Salivirus metavitomy sequencing. This invention utilizes the targeted capture primer set to target Salivirus-specific reverse transcription for preliminary screening and enrichment of the Salivirus, increasing the concentration of effective sequences and improving the library success rate. Using the primer set provided by this invention, sequence fragments covering almost the entire Salivirus genome can be obtained, providing high-depth, comprehensive sequence data support for genomic research of this virus.

[0027] This invention also provides a method for Salivirus metaviromic sequencing, comprising the following steps: extracting RNA from the sample to be tested; performing reverse transcription amplification using the aforementioned targeted capture primer set; fragmenting the reverse transcription amplification product, and then constructing a library and sequencing. The method described in this invention is for non-disease diagnosis or treatment purposes, and the sequencing process is as follows: Figure 1 As shown.

[0028] The present invention preferably uses a commercially available kit to extract total RNA from the sample to be tested; the total RNA is preferably quality controlled using a bioanalyzer, with a RIN (RNA integrity index) value ≥7; the extracted total RNA is preferably pre-denatured and genomic DNA is removed.

[0029] In this invention, the reverse transcription amplification system is as follows: 10 μL RNA template, 2 μL 10×RT Mix, 2 μL HiScriptIII Enzyme Mix, and Oligo (dT). 20 The system contains 1 μL of VN, 1 μL of the capture primer set, and 4 μL of nuclease-free double-distilled water. In the reverse transcription amplification system of this invention, the preferred amount of RNA template is 10 ng; the preferred capture primer set is a 1:1 volume ratio mixture of primer 1 and primer 2, with the same concentration of primer 1 and primer 2; the preferred working concentration of the capture primer set is 2 μM. The reverse transcription amplification program is as follows: under a heat-sealed 105°C environment, 25°C for 5 minutes, 37°C for 30 minutes, 85°C for 5 seconds, and then cooled to 4°C. This invention simultaneously introduces universal reverse transcription oligo-T primers and Salivirus-specific primers during the reverse transcription step, achieving both macrotranscription and simultaneous specific capture of the Salivirus sequence in the sample.

[0030] In this invention, the fragmentation of the reverse transcription amplification product is performed using Tn5 transposase. The preferred fragmentation steps of this invention include: adding 10 μL of tagment buffer and 5 μL of Tn5 VR1 enzyme to 20 μL of reverse transcription amplification product, mixing well, and then performing PCR reaction 1; the PCR reaction 1 program is as follows: under a heated lid at 105°C, incubate at 55°C for 15 minutes, and after the reaction, cool to 10°C and remove to obtain reaction product 1; add TStop Solution to the above reaction product 1 to terminate the reaction; the preferred volume ratio of reaction product 1 to TStop Solution is 35 μL: 2 μL. In this invention, after adding TStop Solution, incubate at 105°C under a heated lid at 37°C for 5 minutes, and after the reaction, cool to 10°C and remove to obtain reaction product 2.

[0031] In this invention, reaction product 2 is used for library amplification. The reaction system consists of: 37 μL of reaction product 2, 50 μL of HiFi Amplification Mix, 1 μL of TSE, 5 μL of N5XX, 5 μL of N7XX, and 2 μL of nuclease-free double-distilled water. The reaction solution is collected to the bottom of the tube by centrifugation; the centrifugation is preferably instantaneous centrifugation. N5XX and N7XX are index primers specifically for library amplification, which can be selected according to the sample quantity, index pairing strategy, and sequencing equipment. The library amplification reaction program is as follows: under a heated cap at 105℃, 72℃ for 3 minutes; 95℃ for 3 minutes; 98℃ for 20 seconds, 60℃ for 15 seconds, 72℃ for 30 seconds, 17 cycles; 72℃ for 5 minutes; cooled to 4℃ and removed to obtain the library amplification product.

[0032] The library amplification products of this invention are purified using magnetic beads to enrich library DNA fragments that meet the length requirements, remove free primers, short fragments of impurities, and residual reagents in the PCR reaction system, thereby improving the uniformity of the subsequent sequencing template and the quality of sequencing data. This invention preferably uses 80.0 μL (0.8×) DNA Clean Beads to purify the library.

[0033] The present invention preferably uses a sequencing platform that matches the index primer to perform 2×150 bp paired-end sequencing; the sequencing platform preferably includes terminal terminator sequencing platforms such as Illumina sequencing platform and Zhenmai sequencing platform.

[0034] The present invention also provides the application of the target capture primer set, the sequencing reagent, the sequencing kit, or the method thereof in any one of the following (1) to (3), (1) Prepare products for monitoring Salivirus; (2) Prepare products for the prevention and control of Salivirus; (3) Prepare products for Salivirus typing.

[0035] This invention establishes a rapid Salivirus library construction method based on specific reverse transcription primers and transposase technology. This method can significantly increase the proportion of viral sequences, reduce background interference, and improve the genomic coverage and integrity of low viral load samples, enabling early molecular tracing of epidemics and providing key technical support for epidemiological investigation, pollution source determination, and prevention and control measures formulation.

[0036] In the specific embodiments of the present invention, the materials and reagents used can be obtained commercially unless otherwise specified.

[0037] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0038] Example 1 1. Targeted capture primer set for synthesizing the Salivirus genome: Suzhou Genewiz Biotechnology Co., Ltd. was commissioned to synthesize a set of targeted capture primers for the Salivirus genome. The primer sequence is shown in Table 1.

[0039] Table 1. Targeted capture primer sequences

[0040] Note: N is the representative letter for degenerate bases: N = A / T / C / G.

[0041] The concentrations of synthesized primers 1 and 2 were both 10 μM. Primers 1 and 2 were mixed in equal volumes to obtain the capture primer set, which was then diluted to 2 μM for later use.

[0042] 2. Viral RNA extraction: 2.1 Total RNA was extracted from the samples using the viral nucleic acid extraction kit from ShuoShi Biotechnology.

[0043] After total RNA extraction, quality control was performed using a bioanalyzer (Qsep100NGS bioanalyzer from Guangding Biotechnology), with a RIN value ≥ 7.

[0044] Total RNA concentration was measured; the total RNA input during reverse transcription was 10 ng.

[0045] 2.2 Total RNA pre-denaturation and genomic DNA removal: Take 8 μL of extracted RNA, heat at 65℃ for 5 minutes, quickly place on ice to cool, and let stand on ice for 2 minutes. Add 2 μL of 5×gDNA wiper Mix, gently mix with a pipette, place the PCR tube in the PCR instrument, and perform the reaction program as follows: heat at 105℃ with a hot cap, 42℃ for 2 minutes, 85℃ for 30 seconds. After the reaction is complete, cool to 4℃ and remove to obtain the RNA template.

[0046] 3. Reverse transcription reaction: Prepare the reagents for thawing at room temperature by inverting the tube and mixing thoroughly. Thaw 10×RT Mix at room temperature and gently tap the tube wall to check for any precipitate. If precipitate is present, vortex to dissolve it.

[0047] Prepare the following reaction mixture in a nuclease-free PCR tube: 10 μL RNA template, 2 μL 10×RT Mix, 2 μL HiScript III Enzyme Mix, and Oligo (dT). 20 VN (Nanjing Novizan Biotechnology Co., Ltd.) 1 μL, capture primer set (2 μM) 1 μL, nuclease-free double-distilled water 4 μL.

[0048] The reverse transcription amplification procedure was as follows: under heat treatment at 105℃, 25℃ for 5 minutes, 37℃ for 30 minutes, 85℃ for 5 seconds, and then cooled to 4℃.

[0049] 4. Fragmentation of reverse transcription amplification products: Prepare the reagents for thawing at room temperature by inverting the tube and mixing thoroughly. Confirm that the TStop Solution is at room temperature and gently tap the tube wall to check for any precipitate. If precipitate is present, heat at 37°C to dissolve it.

[0050] Prepare the following reaction system in a nuclease-free PCR tube: 20 μL reverse transcription amplification product, 10 μL tagment buffer, and 5 μL Tn5 VR1 enzyme (Nanjing Novizan Biotechnology Co., Ltd.); mix well, centrifuge briefly, collect the reaction solution to the bottom of the tube, and perform PCR reaction 1: heat at 105℃ for 15 minutes, and after the reaction is completed, cool to 10℃ and remove to obtain reaction product 1.

[0051] Add 2 μL of TStop Solution to 35 μL of reaction product 1, mix well, centrifuge (instant centrifugation to collect the reaction solution to the bottom of the tube), incubate at 37°C for 5 minutes under a hot cap at 105°C, and after the reaction is complete, cool down to 10°C and remove to obtain reaction product 2.

[0052] 5. Library expansion: Prepare the reagents needed for thawing at room temperature by inverting the container and mixing thoroughly before use.

[0053] The following reaction mixture was prepared in a nuclease-free PCR tube: 37 μL reaction product 2, 50 μL HiFi Amplification Mix, 1 μL TSE, 5 μL N5XX, 5 μL N7XX, and 2 μL double-distilled water with nuclease removed; mix well and centrifuge (collect the reaction solution to the bottom of the tube by instant centrifugation); N5XX and N7XX were purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0054] The reaction procedure for library amplification was as follows: under a hot cap at 105℃, 72℃ for 3 minutes; 95℃ for 3 minutes; 98℃ for 20 seconds, 60℃ for 15 seconds, 72℃ for 30 seconds, for 17 cycles; 72℃ for 5 minutes, then cooled to 4℃ and removed to obtain the library amplification product.

[0055] 6. Library purification: The library was purified using 80.0 μL (0.8×) DNA Clean Beads. Before use, the beads were equilibrated to room temperature and vortexed thoroughly.

[0056] Vortex the DNA purification beads to mix well, and add 80.0 μL to 100.0 μL of the library amplification product. Mix thoroughly and incubate at room temperature for 5 minutes.

[0057] Briefly centrifuge the reaction tube and place it on a magnetic rack to separate the magnetic beads from the liquid. After the solution has clarified (about 5 minutes), carefully remove the supernatant.

[0058] Keep the reaction tube on the magnetic rack at all times, add 200.0 μL of freshly prepared 80% v / v ethanol to rinse the magnetic beads, incubate at room temperature for 30 s, carefully remove the supernatant, and rinse twice.

[0059] Keep the reaction tube on the magnetic rack and allow it to air dry for about 5 minutes.

[0060] Remove the reaction tube from the magnetic rack and add 22.0 μL of nuclease-removed double-distilled water to elute. Mix thoroughly and incubate at room temperature for 5 minutes.

[0061] Briefly centrifuge the reaction tube and place it on a magnetic rack to separate the magnetic beads from the liquid. After the solution has clarified (about 5 minutes), carefully aspirate 20.0 μL of supernatant into a new sterile PCR tube and store at -20 ℃.

[0062] 7. Library Quantitative Analysis and Quality Control: The purified library was quantified using a spectrophotometer, and the library distribution was detected before sequencing to ensure that the library fragment sizes were correct.

[0063] 8. Library sequencing: Sequencing was performed using 2×150 bp paired-end sequencing on Illumina's Novaseq platform.

[0064] Example 2 1. Sequencing analysis results of positive samples.

[0065] For one Salivirus positive sample, it was diluted 10-fold each time to different gradients and labeled as sample 1 to sample 7. One diarrhea negative sample was selected and labeled as sample 8, for a total of 8 samples.

[0066] Samples 1 through 8 were first tested using real-time PCR to determine their CT values. The primers were (Mao, Tongyao. Establishment of a multiplex real-time PCR detection method for diarrhea-associated viruses [D]. North China University of Technology, 2021.): Upstream primer (KLA-F SEQ ID NO.3): TCTGCTTGGTGCCAACCTC; Downstream primer (KLA-R SEQ ID NO.4): CCARGCACACACATGAGRGGATAC; Probe (KLA-TP FAM SEQ ID NO.5): TGCGGGAGTGCTCT; Where R is the representative letter of a degenerate base: R = A / G.

[0067] The upstream and downstream primers were synthesized at the same concentration. The upstream and downstream primers were mixed in equal volumes and diluted to 20 µM to obtain mixed primers.

[0068] Reaction system: Add 1µL of mixed primer (20µM) and 0.5µL of probe (20µM) to DNA Detection Lyophilized Master Mix premix (Zhejiang Biotechnology), and then add sterile, enzyme-free water to a final volume of 36µL.

[0069] Reaction program: 37℃ for 2 min, 94℃ for 2 min; 93℃ for 15 sec, 60℃ for 60 sec, 45 cycles. Single-point fluorescence detection was programmed at 60℃.

[0070] Samples 1 to 8 were sequenced using the method described in Example 1, and the results are shown in Table 2.

[0071] Table 2. Targeted sequencing genotyping results of samples 1-8

[0072] As shown in Table 2, the quantitative PCR and sequencing results for the diarrhea-negative sample (sample 8) were both negative. After dilution, the positive sample still yielded 93.1% of the sequence at a CT value of 35 and 28.8% at a CT value of 40. This demonstrates that the primer set and sequencing method of this invention can obtain the complete viral sequence even with high viral loads and a greater number of viral sequences even with low viral loads. Homology comparison allows for the detection and identification of the virus. The sequencing method provided by this invention exhibits high sensitivity and specificity for detecting Salivirus.

[0073] 2. The method described in Example 1 was used to test diarrhea samples: A total of 660 diarrhea samples collected in 2025 were sequenced using the method described in Example 1 of this invention, and the results are shown in Table 3.

[0074] Of the 660 samples, 17 were Saliviruses, and 9 samples had sequence coverage exceeding 90%. The sequences also included multiple salivirus types from human sources, such as Salivirus FHB, Salivirus CH, and Salivirus ETH_P14. This indicates that the present invention can efficiently obtain the complete genome sequence of Salivirus and has good coverage and sequencing adaptability for the viral genome.

[0075] Table 3. Salivirus screening results in samples.

[0076] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A set of primers for targeting the genome of a Salivirus, characterized in that, The capture primer set includes primer 1 and primer 2; the nucleotide sequence of primer 1 is shown in SEQ ID NO.1, and the nucleotide sequence of primer 2 is shown in SEQ ID NO.

2.

2. A sequencing reagent targeting the Salivirus genome, characterized in that, The sequencing reagent comprises the targeted capture primer set as described in claim 1.

3. A sequencing kit targeting the Salivirus genome, characterized in that, The sequencing kit includes the targeted capture primer set of claim 1 or the sequencing reagent of claim 2.

4. The application of the targeted capture primer set of claim 1, the sequencing reagent of claim 2, or the sequencing kit of claim 3 in the sequencing of Salivirus metavitomy.

5. A method for sequencing the metavinomic genome of Salivirus, characterized in that, Includes the following steps: RNA was extracted from the sample to be tested; Reverse transcription amplification was performed using the targeted capture primer set described in claim 1; After the reverse transcription amplification product is fragmented, a library is constructed and sequenced.

6. The method according to claim 5, characterized in that, The reverse transcription amplification system consisted of: 10 μL RNA template, 2 μL 10×RT Mix, 2 μL HiScript III Enzyme Mix, and Oligo (dT). 20 VN 1 μL, the capture primer set of claim 1 1 μL, and nuclease-free double-distilled water 4 μL.

7. The method according to claim 6, characterized in that, The working concentration of the capture primer set is 2 μM.

8. The method according to claim 5, characterized in that, The reverse transcription amplification procedure is as follows: under a hot cap at 105°C, 25°C for 5 minutes, 37°C for 30 minutes, 85°C for 5 seconds, and then cooled to 4°C.

9. The method according to claim 5, characterized in that, The reverse transcription amplification product fragmentation is performed using Tn5 transposase to fragment the reverse transcription amplification product.

10. The application of the targeted capture primer set of claim 1, the sequencing reagent of claim 2, the sequencing kit of claim 3, or the method of any one of claims 5-9 in any one of the following (1)-(3), characterized in that, (1) Prepare products for monitoring Salivirus; (2) Prepare products for the prevention and control of Salivirus; (3) Prepare products for Salivirus typing.

Images