Application of WTN1 protein on wheat 1D chromosome in regulation and control of wheat powdery mildew resistance

By regulating the WTN1 protein on wheat chromosome 1D and using the CRISPR-Cas9 system for gene editing, the coding gene for the WTN1 protein was mutated or knocked out, thus solving the problem of loss of wheat powdery mildew resistance genes and achieving effective regulation and enhancement of wheat powdery mildew resistance.

CN122071718APending Publication Date: 2026-05-22INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411681128.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-22
Publication Date
2026-05-22

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively address the rapid mutation of wheat powdery mildew, leading to the loss of resistance genes. New methods are needed to regulate wheat powdery mildew resistance.

Method used

By regulating the WTN1 protein on wheat chromosome 1D, gene editing using the CRISPR-Cas9 system can be performed to mutate or knock out the gene encoding the WTN1 protein, resulting in loss of function and thus regulating wheat powdery mildew resistance.

Benefits of technology

This study achieved effective regulation of wheat powdery mildew resistance, obtained wheat germplasm without powdery mildew resistance, and maintained or enhanced wheat disease resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention discloses application of a WTN1 protein on a wheat 1D chromosome in regulation and control of wheat powdery mildew resistance. Wheat without powdery mildew resistance can be obtained by mutating a WTN1 gene shown in SEQ ID No: 1 on a 1D chromosome of a wheat variety with powdery mildew resistance; the WTN1 gene is mutated into WTN1 / -77bp, WTN1 / -4 / + 1bp or WTN1 / + 1bp, the WTN1 / -77bp is obtained by deleting the 122nd site to the 198 site from the 5'tail end of SEQ ID No: 1, the WTN1 / -4 / + 1bp is obtained by deleting the 119th site to the 122nd site from the 5 'tail end of SEQ ID No: 1 and inserting the 199th site into nucleotide A, and the WTN1 / + 1bp is obtained by inserting the 122nd site into nucleotide C from the 5' tail end of SEQ ID No: 1. The invention has important application value in the breeding of wheat germplasm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the WTN1 protein on wheat chromosome 1D in regulating wheat powdery mildew resistance. Background Technology

[0002] wheat( Triticum aestivum Wheat powdery mildew (L., 2n=6x=42; AABBDD) is a hexaploid plant belonging to the genus *Triticum* of the family Poaceae. It is the most widely cultivated and traded cereal crop, possessing the highest monetary value and ranking as the second largest grain after corn. Sustainable wheat production is crucial for social progress and stability worldwide. Wheat powdery mildew (*Blumeriagraminis* f. sp. Tritici) is a disease caused by wheat powdery mildew. Bgt Powdery mildew is one of the most damaging diseases to wheat leaves. In epidemic years, severe infection can cause yield losses of 5-30% and a decline in grain quality. Currently, developing and breeding powdery mildew-resistant varieties is the most economical, safe, and environmentally friendly measure to control wheat powdery mildew. However, powdery mildew strains are numerous and mutate rapidly, with new pathogenic physiological races of powdery mildew constantly emerging, leading to the loss or reduction of resistance in many powdery mildew resistance genes. Therefore, it is urgent to continuously discover and identify powdery mildew resistance genes, analyze the powdery mildew resistance mechanisms of these genes, and breed powdery mildew-resistant wheat varieties to prevent the occurrence and spread of powdery mildew. Summary of the Invention

[0003] The purpose of this invention is to determine how to regulate wheat powdery mildew resistance.

[0004] This invention first protects the application of the WTN1 protein on wheat chromosome 1D in regulating wheat powdery mildew resistance; The WTN1 protein is a1), a2), or a3). a1) The amino acid sequence is that of the protein shown in SEQ ID No: 3; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2); a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No: 3.

[0005] The proteins in a2) above are labeled as shown in Table 1.

[0006]

[0007] The protein in a3) above, wherein the substitution and / or deletion and / or addition of one or more amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0008] The proteins mentioned in a3) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0009] The gene encoding the protein in a3) above can be obtained by deleting one or more amino acid residues from the codons of the DNA sequence shown in SEQ ID No: 1 or SEQ ID No: 2, and / or by performing a missense mutation of one or more base pairs, and / or by attaching the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0010] In the above applications, the regulation of wheat powdery mildew resistance can be used to maintain wheat powdery mildew resistance (i.e., positive regulation). The powdery mildew resistance can be achieved by... Pm24 Gene transfer resulted in wheat lacking powdery mildew resistance. Pm24 The nucleotide sequence of the gene is shown in SEQ ID No: 4, which encodes the WTK3 protein shown in SEQ ID No: 5. The powdery mildew-resistant wheat may be the wheat variety Fielder. In one embodiment of this application, by... Pm24 Wheat obtained by introducing genes into wheat that does not have powdery mildew resistance (i.e., the wheat variety Fielder) can be the transgenic family WTK3-C0M4. The WTN1 protein or its encoding gene on wheat chromosome 1D (i.e., WTN1 Genes are Pm24 An essential component of gene resistance to powdery mildew.

[0011] This invention also protects a method for breeding wheat that does not have powdery mildew resistance, by mutating the gene encoding any of the aforementioned WTN1 proteins on chromosome 1D of powdery mildew-resistant wheat varieties (i.e., WTN1 This is achieved through genes.

[0012] In the above method, the mutation can be mutation 1, mutation 2 or mutation 3.

[0013] The mutation 1 may be a mutation shown in SEQ ID No: 1 on chromosome 1D. WTN1 Gene mutation WTN1 / -77bp The WTN1 / -77bp It is a DNA molecule obtained by deleting positions 122-198 from the 5' end of SEQ ID No: 1, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged.

[0014] The mutation 2 may be a mutation shown in SEQ ID No: 1 on chromosome 1D. WTN1 Gene mutation WTN1 / -4 / +1bp The WTN1 / -4 / +1bpIt is a DNA molecule obtained by deleting positions 119-122 from the 5' end of SEQ ID No: 1 and inserting nucleotide A at position 199, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged.

[0015] The mutation 3 may be a mutation shown in SEQ ID No: 1 on chromosome 1D. WTN1 Gene mutation WTN1 / +1bp The WTN1 / +1bp It is a DNA molecule obtained by inserting nucleotide C at position 122 from the 5' end of SEQ ID No: 1, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged.

[0016] In the above method, the mutation of the gene encoding the WTN1 protein on chromosome 1D of powdery mildew-resistant wheat varieties is achieved by... WTN1 This was achieved by introducing a gene knockout vector into a wheat variety resistant to powdery mildew. WTN1 The gene knockout vector can express sgRNA that targets the encoding gene of any of the WTN1 proteins described above.

[0017] In the above method, the sgRNA may be sgRNA1 and / or sgRNA2. The nucleotide sequence of sgRNA1 may be as shown in SEQ ID No: 6. The nucleotide sequence of sgRNA2 may be as shown in SEQ ID No: 7.

[0018] In the above method, the WTN1 Gene knockout vectors can be obtained by constructing sgRNA1 and sgRNA2 into pYLCRISPR / Cas9Pubi-B; the specific construction method is as follows: S Zhang, R Zhang, G Song, J Gao, Li, Wei, Han, Xiaodong, Chen, Mingli, Li, Yulian, G Li. Targeted mutagenesis using the Agrobacterium tumefaciens-mediated CRISPR-Cas9 system in common wheat. BMCPlant Biol. 2018 Nov 26; 8(1):302.

[0019] This invention also protects the gene encoding any of the aforementioned WTN1 proteins on chromosome 1D of wheat varieties mutated to be resistant to powdery mildew (i.e., WTN1 The application of genetic material in the breeding of wheat that is not resistant to powdery mildew.

[0020] Any of the above WTN1Genes can be DNA molecules in the following forms: (b1) or (b2) or (b3) or (b4) or (b5): (b1) A DNA molecule with a coding region as shown in SEQ ID NO:1; (b2) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO:1; (b3) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO:2; (b4) A DNA molecule that hybridizes under stringent conditions with a DNA molecule defined by (b1) or (b2) or (b3) and encodes any of the WTN1 proteins described above; (b5) A DNA molecule derived from wheat that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the DNA molecule defined in (b1), (b2), or (b3) and encodes any of the WTN1 proteins described above.

[0021] The stringent conditions were: hybridization in a 2×SSC, 0.1% SDS solution at 68°C with two washes of 5 min each, followed by hybridization in a 0.5×SSC, 0.1% SDS solution at 68°C with two washes of 15 min each.

[0022] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0023] SEQ ID NO:1 consists of 4164 nucleotides, SEQ ID NO:2 consists of 3117 nucleotides, and the nucleotides shown in SEQ ID NO:1 or SEQ ID NO:2 encode the amino acid sequence shown in SEQ ID NO:3.

[0024] Those skilled in the art can readily mutate the nucleotide sequence encoding any of the aforementioned WTN1 proteins using known methods, such as directed evolution and point mutation. Any artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of any of the aforementioned WTN1 proteins isolated by this invention, as long as they encode any of the aforementioned WTN1 proteins, are derived from and equivalent to the nucleotide sequence of this invention.

[0025] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the amino acid sequence of the WTN1 protein as shown in SEQ ID NO:3 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0026] In the above applications, the mutation can be mutation 1, mutation 2, or mutation 3.

[0027] The mutation 1 may be a mutation shown in SEQ ID No: 1 on chromosome 1D. WTN1 Gene mutation WTN1 / -77bp The WTN1 / -77bp It is a DNA molecule obtained by deleting positions 122-198 from the 5' end of SEQ ID No: 1, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged.

[0028] The mutation 2 may be a mutation shown in SEQ ID No: 1 on chromosome 1D. WTN1 Gene mutation WTN1 / -4 / +1bp The WTN1 / -4 / +1bp It is a DNA molecule obtained by deleting positions 119-122 from the 5' end of SEQ ID No: 1 and inserting nucleotide A at position 199, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged.

[0029] The mutation 3 may be a mutation shown in SEQ ID No: 1 on chromosome 1D. WTN1 Gene mutation WTN1 / +1bp The WTN1 / +1bp It is a DNA molecule obtained by inserting nucleotide C at position 122 from the 5' end of SEQ ID No: 1, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged.

[0030] In the above applications, the substance that mutates the gene encoding the WTN1 protein on chromosome 1D of powdery mildew-resistant wheat varieties can be either B1) or B2). B1) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the WTN1 protein on chromosome 1D; B2) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in B1).

[0031] In the above applications, the nucleic acid molecule described in B1) may be an sgRNA that expresses a gene encoding the WTN1 protein.

[0032] In the above applications, the sgRNA may be sgRNA1 and / or sgRNA2. The nucleotide sequence of sgRNA1 is shown in SEQ ID No: 6. The nucleotide sequence of sgRNA2 is shown in SEQ ID No: 7.

[0033] The powdery mildew-resistant wheat varieties mentioned above can be specifically derived from... Pm24 Gene transfer resulted in wheat lacking powdery mildew resistance. Pm24 The nucleotide sequence of the gene is shown in SEQ ID No: 4, which encodes the WTK3 protein shown in SEQ ID No: 5. The powdery mildew-resistant wheat variety may be the Fielder wheat variety. In one embodiment of this application, any of the powdery mildew-resistant wheat varieties described above may specifically be the transgenic family WTK3-C0M4.

[0034] The wheat that does not have powdery mildew resistance as described above can specifically be KO#1, KO#2, KO#3, KO#4, KO#5 or KO#6 obtained in the examples.

[0035] On chromosome 1B of any of the above-mentioned mutations 1 WTN1 Genes can mutate or they can remain unchanged.

[0036] On chromosome 1B of any of the above-mentioned mutations 2 WTN1 Genes can mutate or they can remain unchanged.

[0037] On chromosome 1B of any of the above-mentioned mutations 3 WTN1 Genes can mutate or they can remain unchanged.

[0038] In KO#1, on chromosome 1D WTN1 All genes experienced a 77-nucleotide deletion (i.e., deletion of positions 122-198 from the 5' end of SEQ ID No: 1), resulting in a frameshift and premature termination of the encoded protein, leading to loss of function of the WTN1 protein; on chromosome 1B... WTN1 Both genes experienced deletions of one nucleotide (i.e., deletion at position 121 from the 5' end of SEQ ID No: 1) and three nucleotides (i.e., deletion at positions 196-198 from the 5' end of SEQ ID No: 1), which caused a frameshift, premature termination of the encoded protein, and loss of function of the WTN1 protein.

[0039] In KO#2, chromosome 1D WTN1All genes experienced a 77-nucleotide deletion (i.e., deletion of positions 122-198 from the 5' end of SEQ ID No: 1), resulting in a frameshift and premature termination of the encoded protein, leading to loss of function of the WTN1 protein; on chromosome 1B... WTN1 Both genes underwent a 1-nucleotide insertion (i.e., a "T" was inserted at position 122 from the 5' end of SEQ ID No: 1) and a 3-nucleotide deletion (i.e., deletion at positions 196-198 from the 5' end of SEQ ID No: 1), which caused a frameshift, premature termination of the encoded protein, and loss of function of the WTN1 protein.

[0040] In KO#3, chromosome 1D WTN1 All genes underwent a 4-nucleotide deletion and a 1-nucleotide insertion (i.e., SEQ ID No: 1 had a deletion at positions 119-122 from the 5' end; and an "A" inserted at position 199 from the 5' end), resulting in a frameshift and premature termination of the encoded protein, leading to the loss of function of the WTN1 protein; on chromosome 1B... WTN1 The genes all experienced a deletion of 3 nucleotides and an insertion of 1 nucleotide (i.e., SEQ ID No: 1 has a deletion at positions 119-121 from the 5' end; and an "A" is inserted at position 199 from the 5' end), which caused a frameshift, premature termination of the encoded protein, and loss of function of the WTN1 protein.

[0041] In KO#4, chromosome 1D WTN1 All genes experienced a 77-nucleotide deletion (i.e., deletion of positions 122-198 from the 5' end of SEQ ID No: 1), resulting in a frameshift and premature termination of the encoded protein, leading to loss of function of the WTN1 protein; on chromosome 1B... WTN1 All genes underwent a 77-nucleotide insertion (i.e., deletion of positions 122-198 from the 5' end of SEQ ID No: 1), which caused a frameshift, premature termination of the encoded protein, and loss of function of the WTN1 protein.

[0042] In KO#5, chromosome 1D WTN1 All genes underwent a single nucleotide insertion (i.e., a "C" was inserted at position 122 from the 5' end of SEQ ID No: 1), resulting in a frameshift and premature termination of the encoded protein, leading to loss of function of the WTN1 protein; on chromosome 1B... WTN1 No gene mutations have occurred.

[0043] In KO#6, chromosome 1D WTN1All genes experienced a 77-nucleotide deletion (i.e., deletion of positions 122-198 from the 5' end of SEQ ID No: 1), resulting in a frameshift and premature termination of the encoded protein, leading to the loss of function of the WTN1 protein; on chromosome 1B... WTN1 No gene mutations have occurred.

[0044] Experiments have shown that expressing sgRNA from the gene encoding the WTN1 protein... WTN1 Gene knockout vectors are introduced into wheat varieties resistant to powdery mildew (derived from wheat powdery mildew resistance gene— Pm24 Gene transfer (without obtaining powdery mildew-resistant wheat) can help... WTN1 Gene editing causes WTN1 Gene mutation; when a wheat variety resistant to powdery mildew has a mutation on chromosome 1D. WTN1 Insertion and / or deletion mutations in a gene can lead to the loss of WTN1 protein activity; the loss of WTN1 protein activity on chromosome 1D of wheat varieties results in wheat germplasm that is not resistant to powdery mildew. The method of this invention enables the control of WTN1 protein activity on chromosome 1D of wheat. WTN1 Gene editing was used to obtain wheat germplasm that was not resistant to powdery mildew. This demonstrates that the WTN1 protein on wheat chromosome 1D is... Pm24 An essential component of the gene's resistance to powdery mildew. The WTN1 protein on wheat chromosome 1D can regulate wheat powdery mildew resistance. This invention has significant application value. Attached Figure Description

[0045] Figure 1 The results are from step two of Example 1.

[0046] Figure 2 In Example 2, KO#1-KO#8 WTN1 Results of powdery mildew resistance identification and mutation type detection for genes. Detailed Implementation

[0047] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0048] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0049] In the following examples, "resistance" refers to resistance to powdery mildew, and "susceptibility" refers to susceptibility to powdery mildew. Powdery mildew is caused by infection with wheat powdery mildew fungus, specifically the wheat-specific type of *Brucea javanica*. Unless otherwise specified, the wheat powdery mildew fungus referred to below is specifically the physiological race E09 of *Brucea javanica* prevalent in northern China. Bgt E09). The physiological race E09 of wheat powdery mildew is described in the following literature: Ping Lu, Li Guo, Zhenzhong Wang, Beibei Li, Jing Li, Yahui Li, Dan Qiu, Wenqi Shi, Lijun Yang, Ning Wang, Guanghao Guo, Jingzhong Xie, Qiuhong Wu, Yongxing Chen, Miaomiao Li, Huaizhi Zhang, Lingli Dong, Panpan Zhang, Keyu Zhu, Dazhao Yu, Yan Zhang, Karin R Deal, Naxin Huo, Cuimin Liu, Ming-Cheng Luo, Jan Dvorak, Yong QiangGu, Hongjie Li, Zhiyong Liu. A rare gain of function mutation in a wheat tandemkinase confers resistance to powdery mildew. Nat Commun. 2020 Feb 3; 11(1): 680. doi: 10.1038 / s41467-020-14294-0. The wheat variety Fielder is described in the following literature: He H, Zhu S, Zhao R, et al. Pm21 Encoding a typical CC-NBS-LRR protein, confers broad-spectrum resistance to wheat powdery mildew disease. Mol Plant. 2018, 11, 879-882. The wheat variety Fielder is susceptible to powdery mildew.

[0050] The local wheat variety Hulutou is documented in the following literature: Guo Li, Wang Zhenzhong, Xie Jingzhong, Zhang Deyun, Liu Zhiyong. Map-position cloning of the powdery mildew resistance gene MlHLT in the local wheat variety Hulutou. Proceedings of the 6th National Wheat Genomics and Molecular Breeding Conference, 2015. The local wheat variety Hulutou is resistant to powdery mildew.

[0051] The following examples illustrate the method for identifying powdery mildew resistance in wheat varieties: Powdery mildew fungus was inoculated into the wheat variety being tested. After 7 days, the leaves were observed, and powdery mildew resistance was classified into grades 0-4 based on leaf phenotype. The grading criteria are as follows: Grade 0: Immunity (no powdery mildew-related symptoms) or near-immunity (hypersensitivity necrosis and chlorosis occur); Grade 1: Highly resistant to powdery mildew (thin mycelial layer and few lesions, showing green hue); Grade 2: Moderately resistant (thick mycelial layer, not showing green hue, producing a certain amount of spores); Grade 3: Moderately susceptible to powdery mildew (relatively thick mycelial layer and many lesions, high spore production, but mycelia do not coalesce); Grade 4: Highly susceptible to powdery mildew (thick mycelial layer, dense mycelia, many lesions, high spore production, mycelia coalesce). In general, grades 0-2 are identified as resistant to powdery mildew, and grades 3-4 are identified as susceptible to powdery mildew.

[0052] Example 1: Discovery of wheat powdery mildew resistance-related genes I. Wheat powdery mildew resistance genes— Pm24 The discovery of genes 1. The inventors of this application have long been committed to the resource mining of wheat powdery mildew resistance genes, and have cloned a dominant powdery mildew resistance gene from the local wheat variety Hulutou. Pm24 Genes (also known as) [[ID=(62)]]WTK3 Gene), Pm24 The nucleotide sequence of the gene is shown in SEQ ID No: 4, which encodes the WTK3 protein shown in SEQ ID No: 5. The inventors of this application analyzed 1069 representative germplasm resources of common wheat and Aegilops scabra from around the world. Pm24 Genetic analysis revealed that only four local Chinese wheat varieties, "Hulutou," "Baihulu," "Chiyachao," and "Hongmangmai," carried the gene. Pm24 Gene.

[0053] 2. To further clarify Pm24 Regarding gene function, the inventors of this application introduced an expression cassette for the WTK3 protein into the wheat variety Fielder, and after genetic transformation, obtained... Pm24 The transgenic family WTK3-C0M4 exhibited significantly increased gene expression. Subsequently, the powdery mildew resistance of the transgenic family WTK3-C0M4 and the wheat variety Fielder was tested. The results showed that the wheat variety Fielder is susceptible to powdery mildew, while the transgenic family WTK3-C0M4 showed significantly increased gene expression. Pm24 The transgenic family WTK3-C0M4 is resistant to powdery mildew. This demonstrates that... Pm24 The gene is a wheat powdery mildew resistance gene.

[0054] The experimental procedures and results described above are documented in the following literature: P Lu, L Guo, Z Wang, B Li, Z Liu. Arare gain of function mutation in a wheat tandem kinase confers resistance topowdery mildew. 2020. Nature Communications. II. Genes related to wheat powdery mildew resistance— WTN1 The discovery of genes 1. Creation WTN1 EMS-susceptible mutant of the gene (1) Select about 10,000 plump seeds of the local wheat variety Hulutou (seeds without EMS treatment are M0 generation seeds), treat them with 0.5% ethyl methanesulfonate (EMS) mutagen and sow them in the experimental field to obtain M1 generation plants; self-pollinate the M1 generation plants and obtain seeds after maturity as M2 generation materials.

[0055] (2) The powdery mildew resistance of M2 generation materials was identified separately, and finally 5 resistances were obtained only in M2 generation materials. WTN1 A susceptible mutant with a single-base mutation in the coding region of the gene, i.e., 5 bases. WTN1 The EMS-susceptible mutants of the gene were named M189, M1037, M1048, M1136 and M1116, respectively.

[0056] 5 WTN1 Mutation patterns of EMS-susceptible mutants of genes and their role in WTN1 See the location on the gene Figure 1 A.

[0057] 5 [[ID=(77)]]WTN1 The results of powdery mildew resistance identification of the EMS susceptible mutant of the gene are shown in the figure. Figure 1 HLT (HLT is a local wheat variety called Hulutou) WTN1 Genes and WTK3 None of the genes have undergone any mutations; WTN1 mutant 5 WTN1 EMS susceptible mutant of the gene; (R) indicates resistance to powdery mildew, (S) indicates susceptibility to powdery mildew.

[0058] WTN1 The nucleotide sequence of the gene is shown in SEQ ID No: 1, and the nucleotide sequence of its coding region is shown in SEQ ID No: 2, encoding the WTN1 protein shown in SEQ ID No: 3.

[0059] 2. Create the 5 items in step 1 WTN1 EMS-susceptible mutants of the gene are respectively with Pm24The susceptible mutants M410 or M1091 ​​were hybridized, and the powdery mildew resistance of the F1 generation of all combinations was tested.

[0060] Pm24 The disease-susceptible mutants M410 and M1091 ​​are both described in the following literature: P Lu, L Guo, Z Wang, B Li, Z Liu. A rare gain of function mutation in a wheat tandem kinase confers resistance to powdery mildew. 2020. Nature Communications. The mutation status of M410 and M1091 ​​and their role in... WTK3 See the location on the gene Figure 1 The results of powdery mildew resistance identification for A. M410 and M1091 ​​are shown in [reference needed]. Figure 1 B ( WTK3 mutant for Pm24 (M410 and M1091, genetically susceptible mutants).

[0061] The results of powdery mildew resistance identification for the F1 generation of all combinations are shown in [link to relevant documentation]. Figure 1 The right image of B in the middle (F1of) WTK3 mutant×WTN1 mutant (This refers to the F1 generation of all combinations). The results showed that the F1 generation of all combinations was resistant to powdery mildew, and highly resistant to it. Therefore, WTN1 Genes are Pm24 An essential component of gene resistance to powdery mildew.

[0062] Example 2 WTN1 Functional verification of genes one, WTN1 Construction of gene knockout vector Target gene is WTN1 Two sgRNAs of the gene (sgRNA1: GAGCGACCTGGTGTTCATCACGG (SEQ ID No: 6) and sgRNA2: GAACAACGCCGTCAAGACGTGGG (SEQ ID No: 7)) were constructed into pYLCRISPR / Cas9Pubi-B to obtain... WTN1Gene knockout vector; the specific construction method is as follows: S Zhang, R Zhang, G Song, J Gao, Li, Wei, Han, Xiaodong, Chen, Mingli, Li, Yulian, G Li. Targeted mutagenesis using the Agrobacterium tumefaciens-mediated CRISPR-Cas9 system in common wheat. BMC Plant Biol. 2018 Nov 26; 8(1):302.

[0063] II. Obtaining Recombinant Agrobacterium Using thermal shock conversion method, WTN1 Gene knockout vector was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium, named EHA105 / KO- WTN1 .

[0064] three, WTN1 Obtaining homozygous mutants Wheat is a hexaploid plant, containing one chromosome on both chromosome 1B and chromosome 1D. WTN1 Genes. When Cas9 begins to cut specific genes, on chromosomes 1B and 1D... WTN1 Genes can be edited, resulting in mutations.

[0065] 1. Following the Agrobacterium tumefaciens-mediated CRISPR-Cas9 system method (described in the following literature: hujuan Zhang, Rongzhi Zhang, Guoqi Song, Jie Gao, Wei Li, Xiaodong Han, Mingli Chen, Yulian Li, Genying Li. Targeted mutagenesis using the Agrobacterium tumefaciens-mediated CRISPR-Cas9 system in common wheat. BMC Plant Biol. 2018 Nov 26;18(1):302. doi: 10.1186 / s12870-018-1496-x), EHA105 / KO- WTN1 Transgenic wheat of generation T0 was obtained by transferring it into the transgenic family WTK3-C0M4.

[0066] 2. Using genomic DNA from T0 generation transgenic wheat leaves as templates, PCR amplification was performed using primer pair 1 (composed of WTN1_D-KO-F: 5'-TGGAGCTAGCTGAAAACATTTGA-3' and WTN1_D-KO-R: 5'-CGCATGTTCCTCTGGCTCA-3') or primer pair 2 (composed of WTN1_B-KO-F: 5'-CAATTCACCTGGTTGCCTGC-3' and WTN1_B-KO-R: 5'-ACCAAGCTGCGACCTTTCTT-3') to obtain the corresponding PCR amplification products. The PCR amplification products were then sequenced. The sequencing results were compared with those in the transgenic family WTK3-C0M4. WTN1 The Cas9 target sequence was compared to select mutant strains.

[0067] 3. Self-pollinate the mutants obtained in step 2. The resulting seeds are T1 generation seeds, and the plants grown from the T1 generation seeds are T1 generation plants.

[0068] 4. Using genomic DNA from leaves of the T1 generation plants as templates, PCR amplification was performed using primer pair 1 (composed of WTN1_D-KO-F: 5'-TGGAGCTAGCTGAAAACATTTGA-3' and WTN1_D-KO-R: 5'-CGCATGTTCCTCTGGCTCA-3') or primer pair 2 (composed of WTN1_B-KO-F: 5'-CAATTCACCTGGTTGCCTGC-3' and WTN1_B-KO-R: 5'-ACCAAGCTGCGACCTTTCTT-3') to obtain the corresponding PCR amplification products. Sequencing results were compared with those in the transgenic family WTK3-C0M4. WTN1 The Cas9 target sequence of the gene was compared, and the mutation types were counted.

[0069] The results showed that eight homozygous mutant strains were obtained, which were named KO#1 to KO#8 in sequence.

[0070] KO#1-KO#8 WTN1 See gene mutation types Figure 2 B. Details are as follows: In KO#1, on chromosome 1D WTN1 All genes experienced a 77-nucleotide deletion (i.e., deletion of positions 122-198 from the 5' end of SEQ ID No: 1), resulting in a frameshift and premature termination of the encoded protein, leading to loss of function of the WTN1 protein; on chromosome 1B... WTN1Both genes experienced deletions of one nucleotide (i.e., deletion at position 121 from the 5' end of SEQ ID No: 1) and three nucleotides (i.e., deletion at positions 196-198 from the 5' end of SEQ ID No: 1), which caused a frameshift, premature termination of the encoded protein, and loss of function of the WTN1 protein.

[0071] In KO#2, on chromosome 1D WTN1 All genes experienced a 77-nucleotide deletion (i.e., deletion of positions 122-198 from the 5' end of SEQ ID No: 1), resulting in a frameshift and premature termination of the encoded protein, leading to loss of function of the WTN1 protein; on chromosome 1B... WTN1 Both genes underwent a 1-nucleotide insertion (i.e., a "T" was inserted at position 122 from the 5' end of SEQ ID No: 1) and a 3-nucleotide deletion (i.e., deletion at positions 196-198 from the 5' end of SEQ ID No: 1), which caused a frameshift, premature termination of the encoded protein, and loss of function of the WTN1 protein.

[0072] In KO#3, on chromosome 1D WTN1 All genes underwent a 4-nucleotide deletion and a 1-nucleotide insertion (i.e., SEQ ID No: 1 had a deletion at positions 119-122 from the 5' end; and an "A" inserted at position 199 from the 5' end), resulting in a frameshift and premature termination of the encoded protein, leading to the loss of function of the WTN1 protein; on chromosome 1B... WTN1 The genes all experienced a deletion of 3 nucleotides and an insertion of 1 nucleotide (i.e., SEQ ID No: 1 has a deletion at positions 119-121 from the 5' end; and an "A" is inserted at position 199 from the 5' end), which caused a frameshift, premature termination of the encoded protein, and loss of function of the WTN1 protein.

[0073] In KO#4, on chromosome 1D WTN1 All genes experienced a 77-nucleotide deletion (i.e., deletion of positions 122-198 from the 5' end of SEQ ID No: 1), resulting in a frameshift and premature termination of the encoded protein, leading to loss of function of the WTN1 protein; on chromosome 1B... WTN1 All genes underwent a 77-nucleotide insertion (i.e., deletion of positions 122-198 from the 5' end of SEQ ID No: 1), which caused a frameshift, premature termination of the encoded protein, and loss of function of the WTN1 protein.

[0074] In KO#5, on chromosome 1D ​All genes underwent a single nucleotide insertion (i.e., a "C" was inserted at position 122 from the 5' end of SEQ ID No: 1), resulting in a frameshift and premature termination of the encoded protein, leading to loss of function of the WTN1 protein; on chromosome 1B... ​ No gene mutations have occurred.

[0075] In KO#6, on chromosome 1D ​ All genes experienced a 77-nucleotide deletion (i.e., deletion of positions 122-198 from the 5' end of SEQ ID No: 1), resulting in a frameshift and premature termination of the encoded protein, leading to the loss of function of the WTN1 protein; on chromosome 1B... ​ No gene mutations have occurred.

[0076] In KO#7, on chromosome 1B ​ All genes experienced a 3-nucleotide deletion (i.e., deletion of positions 123-125 from the 5' end of SEQ ID No: 1), resulting in a frameshift and premature termination of the encoded protein, leading to loss of function of the WTN1 protein. (This occurred on chromosome 1D.) ​ No gene mutations have occurred.

[0077] In KO#8, on chromosome 1B ​ All genes experienced a 3-nucleotide deletion (i.e., deletion of positions 123-125 from the 5' end of SEQ ID No: 1), resulting in a frameshift and premature termination of the encoded protein, leading to loss of function of the WTN1 protein. (This occurred on chromosome 1D.) ​ No gene mutations have occurred.

[0078] III. Testing of powdery mildew resistance in wheat varieties Fielder, transgenic families WTK3-C0M4, and KO#1-KO#8. Each wheat variety was tested in triplicate.

[0079] Some test results can be found ​ The results showed that wheat varieties Fielder and KO#1-KO#6 were susceptible to powdery mildew, while transgenic families WTK3-C0M4, KO#7, and KO#8 were resistant to powdery mildew.

[0080] The above results indicate that on wheat chromosome 1D... ​ Genes are ​The WTN1 gene is an essential component of powdery mildew resistance. Insertion and / or deletion mutations in the gene encoding the WTN1 protein on wheat chromosome 1D can yield powdery mildew-susceptible wheat varieties. Therefore, the WTN1 gene on wheat chromosome 1D can regulate powdery mildew resistance in wheat.

[0081] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of WTN1 protein on wheat chromosome 1D in regulating wheat powdery mildew resistance; The WTN1 protein is a1), a2), or a3). a1) The amino acid sequence is that of the protein shown in SEQ ID No: 3; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2); a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No:

3.

2. A method for breeding wheat that is not resistant to powdery mildew, achieved by mutating the gene encoding the WTN1 protein on chromosome 1D of powdery mildew-resistant wheat varieties; The WTN1 protein is a1), a2), or a3). a1) The amino acid sequence is that of the protein shown in SEQ ID No: 3; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2); a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No:

3.

3. The method according to claim 2, characterized in that: The mutation is mutation 1, mutation 2, or mutation 3; Mutation 1 is a mutation that alters the chromosome 1D as shown in SEQ ID No:

1. WTN1 Gene mutation WTN1 / -77bp The WTN1 / -77bp It is a DNA molecule obtained by deleting positions 122-198 from the 5' end of SEQ ID No: 1, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged; Mutation 2 is a mutation that alters the chromosome 1D as shown in SEQ ID No:

1. WTN1 Gene mutation WTN1 / -4 / +1bp The WTN1 / -4 / +1bp It is a DNA molecule obtained by deleting positions 119-122 from the 5' end of SEQ ID No: 1 and inserting nucleotide A at position 199, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged; Mutation 3 is a mutation that alters the chromosome 1D as shown in SEQ ID No:

1. WTN1 Gene mutation WTN1 / +1bp The WTN1 / +1bp It is a DNA molecule obtained by inserting nucleotide C at position 122 from the 5' end of SEQ ID No: 1, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged.

4. The method according to claim 2 or 3, characterized in that: The mutation, which involves the gene encoding the WTN1 protein on chromosome 1D of powdery mildew-resistant wheat varieties, is achieved by... WTN1 This was achieved by introducing a gene knockout vector into a wheat variety resistant to powdery mildew; The WTN1 The gene knockout vector expresses sgRNA targeting the gene encoding the WTN1 protein.

5. The method according to claim 4, characterized in that: The sgRNA is sgRNA1 and / or sgRNA2; The nucleotide sequence of sgRNA1 is shown in SEQ ID No: 6; The nucleotide sequence of sgRNA2 is shown in SEQ ID No:

7.

6. Application of the substance encoding the WTN1 protein gene on chromosome 1D of powdery mildew-resistant wheat varieties in the breeding of powdery mildew-free wheat; The WTN1 protein is a1), a2), or a3). a1) The amino acid sequence is that of the protein shown in SEQ ID No: 3; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2); a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No:

3.

7. The application according to claim 6, characterized in that: The mutation is mutation 1, mutation 2, or mutation 3; Mutation 1 is a mutation that alters the chromosome 1D as shown in SEQ ID No:

1. WTN1 Gene mutation WTN1 / -77bp The WTN1 / -77bp It is a DNA molecule obtained by deleting positions 122-198 from the 5' end of SEQ ID No: 1, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged; Mutation 2 is a mutation that alters the chromosome 1D as shown in SEQ ID No:

1. WTN1 Gene mutation WTN1 / -4 / +1bp The WTN1 / -4 / +1bp It is a DNA molecule obtained by deleting positions 119-122 from the 5' end of SEQ ID No: 1 and inserting nucleotide A at position 199, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged; Mutation 3 is a mutation that alters the chromosome 1D as shown in SEQ ID No:

1. WTN1 Gene mutation WTN1 / +1bp The WTN1 / +1bp It is a DNA molecule obtained by inserting nucleotide C at position 122 from the 5' end of SEQ ID No: 1, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged.

8. The application according to claim 6 or 7, characterized in that: The mutation refers to the substance encoding the WTN1 protein gene on chromosome 1D of powdery mildew-resistant wheat varieties, which is either B1 or B2. B1) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the WTN1 protein on chromosome 1D; B2) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in B1).

9. The application according to claim 8, characterized in that: B1) The nucleic acid molecule is an sgRNA that expresses the gene encoding the WTN1 protein.

10. The application according to claim 9, characterized in that: The sgRNA is sgRNA1 and / or sgRNA2; The nucleotide sequence of sgRNA1 is shown in SEQ ID No: 6; The nucleotide sequence of sgRNA2 is shown in SEQ ID No: 7.