Application of bovine milk exosomes in the preparation of foods or feeds that promote animal feed intake and fat deposition

Abstract

This invention belongs to the field of food and feed technology, specifically relating to the application of bovine milk exosomes in the preparation of foods or feeds that promote animal feed intake and fat deposition. The feeding dosage of the bovine milk exosomes in the preparation of foods or feeds that promote animal feed intake and fat deposition is 1-10 mg. This invention effectively overcomes the defects and shortcomings of additives and appetite stimulants in the prior art, providing a new use for bovine milk exosomes. By regulating intestinal hormones and the activity of central feeding-related neurons, it effectively promotes animal feed intake and fat deposition.

Description

Technical Field

[0001] This invention belongs to the field of food and feed technology, specifically relating to the application of bovine milk exosomes in the preparation of foods or feeds that promote animal feed intake and fat deposition. Background Technology

[0002] Feed intake is the fundamental process by which animals obtain the nutrients and energy needed for life activities, growth, development, and reproduction by consuming feed. Feed intake directly affects an animal's growth rate, feed conversion ratio, and reproductive performance, and also determines the body's energy intake level, thus influencing fat deposition and carcass composition. Adequate fat deposition enhances an animal's adaptability to environmental and nutritional fluctuations and improves carcass quality, including intramuscular fat content, meat tenderness, juiciness, and flavor, which is crucial for livestock product grading and economic value. In livestock production, factors such as feed palatability, anti-nutritional factors in feed components, and nutritional balance can all inhibit animal feed intake. Environmental factors such as high temperature, high humidity, and harmful gases, as well as husbandry practices, diseases, and digestive health, also significantly affect animal feed intake. Existing research indicates that increasing animal feed intake helps improve growth performance, increase milk production, and reduce the risk of reproductive failure and offspring mortality. Therefore, effectively increasing animal feed intake is of great significance for improving production performance. Currently, animal feed intake is often promoted by adding flavoring agents or palatability enhancers to the diet. However, these measures suffer from unstable effectiveness, high costs, and uncertain long-term safety, making them insufficient to fully meet actual production needs. Therefore, it remains necessary to provide a safe and stable technical solution that can regulate animal feed intake and fat deposition.

[0003] Besides being the primary organ for the digestion and absorption of nutrients, the intestine is also an important endocrine organ, secreting a variety of hormones closely related to appetite and energy metabolism. These intestinal hormones, as key signaling molecules, are widely involved in digestive function and the processes of substance and energy metabolism, and act on the central nervous system through the gut-brain axis, thereby regulating eating behavior and energy homeostasis. Intestinal hormones are mainly secreted by enteroendocrine cells, which are widely distributed in the small intestine (mainly) and various segments of the large intestine, accounting for approximately 1% of the total number of epithelial cells. Based on the different hormone profiles they secrete, they can be divided into different types such as K cells, L cells, and I cells. Enteroendocrine cells can sense signals such as changes in nutrients, osmotic pressure, pH, and mechanical stretching within the intestinal lumen, and correspondingly release various hormones such as cholecystokinin (CCK) and glucagon-like peptide-1 (GLP-1) to regulate gastrointestinal motility, systemic metabolism, and food intake, thereby maintaining homeostasis.

[0004] Exosomes are small extracellular vesicles (sEVs) with a diameter of 30-150 nm, secreted by cells. They have a bilayer phospholipid membrane structure and contain abundant lipids, proteins, nucleic acids, and other biomolecules. They are widely present in biological fluids such as blood, lymph, saliva, urine, uterine cavity fluid, and milk. As a novel cell communication medium, exosomes can transmit biological information between cells and play an important role in physiological and pathological processes. In recent years, milk-derived exosomes, especially bovine milk exosomes, have received widespread attention. Due to their potential biological effects in immune regulation, intestinal homeostasis maintenance, and metabolic regulation, and their high content and ease of collection in milk, bovine milk exosomes have gradually become a hot topic in biomedical research. Bovine milk exosomes are highly stable and biocompatible, able to resist gastric acid and digestive enzymes in the gastrointestinal environment, maintaining high biological activity, and possessing unique advantages in transmembrane signal transduction and regulation of target cell function. Studies have shown that bovine milk exosomes can maintain structural stability under simulated digestion conditions in vitro and can be taken up by intestinal cells.

[0005] Currently, research on bovine milk exosomes mainly focuses on the prevention and treatment of diseases such as diabetes and cancer, with relatively little research on their role in feed intake regulation. Studies have shown that milk consumption in children, adolescents, and adults may be associated with increased body mass index (BMI) and insulin resistance in children, but whether these phenomena are related to the presence of exosomes in bovine milk and their role in regulating energy metabolism remains unclear. To date, there are no reports in the existing literature on the application of bovine milk exosomes in regulating animal feeding behavior and fat deposition, or in regulating intestinal hormones (such as GLP-1 and CCK). Summary of the Invention

[0006] The purpose of this invention is to overcome the defects and shortcomings of existing additives and appetite stimulants, and to provide a new use for bovine milk exosomes, which can effectively promote animal feeding and fat deposition by regulating intestinal hormones and the activity of central feeding-related neurons.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: the application of bovine milk exosomes in the preparation of food or feed that promotes animal feed intake and fat deposition, wherein the feeding amount of bovine milk exosomes is 1~10mg.

[0008] As one embodiment of the application described in this invention, the feeding amount of the bovine milk exosomes is 1~5mg.

[0009] As one embodiment of the application described in this invention, the bovine milk exosomes promote animal feed intake and fat deposition by regulating the animal intestinal hormones glucagon-like peptide-1 (GLP-1) and cholecystokinin (CCK).

[0010] As one embodiment of the application described in this invention, the bovine milk exosomes regulate animal feeding behavior and improve animal carcass composition by downregulating the mRNA expression of the feeding neuron-related gene POMC in the hypothalamus and upregulating the expression of the feeding neuron-related gene NPY.

[0011] As one embodiment of the application described in this invention, the improvement of animal ketone body composition is achieved by increasing fat deposition in the animal body.

[0012] The present invention also claims protection for a method for promoting feed intake and fat accumulation in animals, comprising the steps of: preparing a solution of bovine milk exosomes and administering it by gavage.

[0013] As one embodiment of the method for promoting animal feed intake and fat accumulation according to the present invention, the concentration of the solution is 20-30 mg / mL.

[0014] As one embodiment of the method for promoting animal feed intake and fat accumulation according to the present invention, the concentration of the solution is 25 mg / mL.

[0015] As one embodiment of the method for promoting animal feed intake and fat accumulation described in this invention, the solvent used to prepare the bovine milk exosomes into a solution is PBS solution.

[0016] As one embodiment of the method for promoting animal feed intake and fat accumulation described in this invention, the amount administered by gavage is 100~300μL.

[0017] As one embodiment of the method for promoting animal feed intake and fat accumulation described in this invention, the amount administered by gavage is 200 μL.

[0018] As one embodiment of the method for promoting animal feed intake and fat accumulation described in this invention, the bovine milk exosomes are derived from bovine milk and obtained by separation and purification via ultracentrifugation.

[0019] Compared with the prior art, the present invention has the following beneficial effects: (1) Experimental studies of this invention have shown that administration of bovine milk exosomes via gavage significantly increased food intake in mice; simultaneously, the levels of cholecystokinin (CCK) and glucagon-like peptide-1 (GLP-1), which have inhibitory effects on food intake, were significantly decreased in mouse serum. Further studies revealed that bovine milk exosomes significantly downregulated the mRNA expression of the feeding neuron-related gene POMC in the hypothalamus and significantly upregulated the expression of the feeding neuron-related gene NPY, thereby regulating the body's feeding behavior. In addition, the experimental results also showed that bovine milk exosomes could alter the body composition of mice and promote an increase in fat content. This invention provides a new means and application for promoting food intake and fat deposition.

[0020] (2) Bovine milk exosomes are natural and safe, and can be prepared on a large scale using raw materials from the dairy industry. By synergistically regulating the expression of intestinal hormones GLP-1, CCK and hypothalamic feeding-related neurons, they can achieve the dual effect of increasing feed intake and promoting fat deposition. The feed-inducing effect is significant and relatively stable, making them suitable for promotion and application in aquaculture production. Attached Figure Description

[0021] Figure 1 Figure 1 shows the results of bovine milk exosome isolation and identification in an embodiment of the present invention. Figure A: Electron microscopy results of bovine milk exosomes; Figure B: Exosome particle size distribution; Figure C: Western blot bands of marker proteins Alix, TSG101, and CD9 in bovine milk exosomes (CM-mEVs).

[0022] Figure 2 Figure 1 shows the detection results of STC-1 cells treated with different concentrations of bovine milk exosomes for 24 hours and 48 hours, respectively, in this embodiment of the invention. Figure A shows the CCK and GCG gene expression results of STC-1 cells after treatment with 50 μg / mL, 100 μg / mL, and 200 μg / mL bovine milk exosomes for 24 hours; Figure B shows the CCK and GCG gene expression results of STC-1 cells after treatment with 50 μg / mL, 100 μg / mL, and 200 μg / mL bovine milk exosomes for 48 hours. In the figures, * indicates significant difference (P < 0.05); ** indicates extremely significant difference (P < 0.01); and *** indicates extremely significant difference (P < 0.001).

[0023] Figure 3 This figure shows the protein detection results of STC-1 cells treated with 100 μg / mL bovine milk exosomes for 24 hours in this embodiment of the invention. Figure A shows the protein levels of hormone precursor proteins PG and CCK detected by Western blot; Figure B shows the secretion levels of GLP-1 and CCK in the cell supernatant detected by ELISA. In the figures, ** indicates a highly significant difference (P < 0.01); *** indicates a highly significant difference (P < 0.001).

[0024] Figure 4 Figures show the body weight and food intake of mice after gavage administration of different concentrations of bovine exosomes in this invention. Figure A shows the body weight changes of mice gavaged with 5 mg / mL, 15 mg / mL, and 25 mg / mL bovine exosomes over 42 days; Figure B shows the food intake of mice gavaged with 5 mg / mL, 15 mg / mL, and 25 mg / mL bovine exosomes over 42 days. In the figures, * indicates a significant difference (P < 0.05); ** indicates an extremely significant difference (P < 0.01).

[0025] Figure 5 These are images showing the body composition and imaging results of mice after gavage administration of different concentrations of bovine milk exosomes in this embodiment of the invention. Figure A shows the body composition of mice administered 5 mg / mL, 15 mg / mL, and 25 mg / mL bovine milk exosomes after 42 days; Figure B shows the body imaging results of mice administered 25 mg / mL bovine milk exosomes after 42 days. In the figures, * indicates a significant difference (P < 0.05); ** indicates an extremely significant difference (P < 0.01); and *** indicates an extremely significant difference (P < 0.001).

[0026] Figure 6 This figure shows the comparison results of the subcutaneous white adipose tissue (iWAT) and epididymal white adipose tissue (eWAT) weights in mice after gavage with different concentrations of bovine milk exosomes in this embodiment of the invention. Figure A compares the weight of iWAT in mice after gavage with 5 mg / mL, 15 mg / mL, and 25 mg / mL bovine milk exosomes for 42 days; Figure B compares the weight of eWAT in mice after gavage with 5 mg / mL, 15 mg / mL, and 25 mg / mL bovine milk exosomes for 42 days. The symbol (*) in the figures indicates a significant difference (P < 0.05).

[0027] Figure 7 This invention illustrates the effect of 25 mg / mL milk exosomes administered to mice via gavage for 42 days on the expression of NPY mRNA and POMC mRNA in the mouse hypothalamus. In the figure, * indicates a significant difference (P < 0.05); *** indicates an extremely significant difference (P < 0.001).

[0028] Figure 8 This figure shows the effect of 25 mg / mL milk exosomes administered to mice by gavage for 42 days on the expression of GCG and CCK mRNA in the ileum of mice in this embodiment of the invention. In the figure, the symbol (*) indicates a significant difference (P < 0.05); the symbol (**) indicates an extremely significant difference (P < 0.01).

[0029] Figure 9 This figure shows the protein detection results of mice given 25 mg / mL bovine milk exosomes by gavage for 42 days, as described in this embodiment of the invention. Figure A shows the protein levels of hormone precursor proteins PG and CCK in the mouse ileum detected by Western blot; Figure B shows the secretion levels of GLP-1 and CCK in serum detected by ELISA. In the figures, ** indicates a highly significant difference (P < 0.01); *** indicates a highly significant difference (P < 0.001). Detailed Implementation

[0030] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0031] Unless otherwise specified, the experimental methods used in the examples and comparative examples are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.

[0032] The manufacturer information of the reagent kits used in this embodiment of the invention, and the primer sequence information used in qPCR detection are as follows: Protein antibodies: Alix (Shanghai Sangon Biotech, D262028), TSG101 (Zheng Neng Biotech, 381538), CD9 (Abcepta, AP68-965-100), PG (Wuhan Sanying, 15954-1-AP), CCK (ABclonal, A1759).

[0033] ELISA kit: GLP-1 (Shanghai ELISA, ml201801), CCK (Shanghai ELISA, ml058435).

[0034] qPCR primer sequences: GCG (forward sequence F: TCTACACCTGTTCGCAGCTC, reverse sequence R: GTCCTCATGCGCTTCTGTCT). CCK (forward sequence F: GGATGGTGACCTCTGGTTGG, reverse sequence R: CAGACAGGTCGACAAGCCAT); NPY (forward sequence F: CGCTCTGCGACACTACATCA, reverse sequence R: AGGGTCTTCAAGCCTTGTTCT). POMC (forward sequence F: GAGCGTGGTGCCTGGAGAG, reverse sequence R: TTTTCAGTCAGGGGCTGTTC).

[0035] PBS solution (Biosharp, BL302A).

[0036] Example 1: Preparation and Identification of Bovine Milk Exosomes The preparation and identification method of bovine milk exosomes includes the following steps: Milk exosome extraction: Fresh milk was centrifuged at 5000g for 30 min at 4°C to remove milk fat and impurities. After adjusting the pH to approximately 6, rennet was added to the sample, and the mixture was incubated at 37°C for 30 min. Then, it was centrifuged at 12000g for 30 min at 4°C and filtered through a 0.45μm filter to remove casein. Finally, it was ultracentrifuged at 135000g for 90 min at 4°C and resuspended in PBS. The collected resuspension is the milk exosome (CM-mEVs) solution.

[0037] The extraction method for bovine milk exosomes in this embodiment is a conventional extraction method in the art.

[0038] Identification of bovine milk exosomes: Transmission electron microscopy (TEM) imaging analysis was performed on bovine milk exosomes. Diluted CM-mEVs were incubated on a copper grid for 2 min. Then, they were negatively stained with 3% gadolinium triacetate for 5 min. Subsequently, the copper grid was placed in the TEM sample chamber to observe the morphology of CM-mEVs and photographed to scale.

[0039] The particle size distribution of CM-mEVs was determined using a nanoparticle tracking analyzer. The diluted CM-mEVs solution was injected into designated injection wells, and the particle size and distribution of the CM-mEVs were measured using the nanoparticle tracking analyzer.

[0040] The expression of the marker proteins Alix, TSG101, and CD9 of CM-mEVs was verified by Western blot, specifically including the following steps: According to the instructions of the BCA kit, the BCA method was used to determine the concentration of exosomal protein and calculate the required protein volume. 20% of the protein volume was added to 5× SDS-PAGE, and the remaining volume was made up with PBS. After mixing well, the mixture was placed in a metal bath at 99°C for 10 min for denaturation and stored at -20°C.

[0041] Gel preparation: Refer to the instructions for the YARKE PAGE Gel Rapid Preparation Kit.

[0042] Electrophoresis: After securing the gel plate with clamps, slowly add SDS-PAGE electrophoresis buffer until it covers the comb wells. After checking for leakage, gently remove the comb and place the gel plate into the electrophoresis tank. Continue adding SDS-PAGE electrophoresis buffer until it overflows. Then add the denatured protein sample mentioned above, and perform electrophoresis at a constant voltage of 90 V for 90 min. Stop electrophoresis when the staining band reaches the bottom of the gel.

[0043] Transfer: Immerse an 8×4.5 cm PVDF membrane in pre-cooled methanol for 5 min. Gently remove the gel and immerse it in transfer buffer, trimming off any excess gel edges. Thoroughly wet the sponge and filter paper sequentially in transfer buffer. Place the sponge-filter paper-PVDF membrane-filter paper-sponge combination on the electrotransfer clamp from negative to positive, taking care to prevent air bubbles and clamping the clamp securely. Place the clamp in the transfer tank and add electrotransfer buffer. Transfer at a constant current of 180 mA for 75 min.

[0044] Washing the membrane: After the transfer is complete, remove the PVDF membrane, add an appropriate amount of TBST buffer, and wash it on a shaker for 30 minutes. Change the buffer every 5 minutes.

[0045] Blocking: Add rapid blocking solution and block at room temperature for 20-30 minutes.

[0046] Washing the membrane: Add an appropriate amount of TBST buffer and wash on a shaker for 30 minutes, changing the buffer every 5 minutes.

[0047] Primary antibody incubation: Based on the size of the target protein band, cut the PVDF membrane and add it to a 15mL centrifuge tube containing the primary antibody diluted with antibody dilution buffer. Incubate overnight at 4°C on a rotor.

[0048] Washing the membrane: Add an appropriate amount of TBST buffer and wash on a shaker for 30 minutes, changing the buffer every 5 minutes.

[0049] Secondary antibody incubation: Place the PVDF band in the corresponding secondary antibody dilution solution and incubate on a shaker at room temperature for 1 h.

[0050] Washing the membrane: Add an appropriate amount of TBST buffer and wash on a shaker for 30 minutes, changing the buffer every 5 minutes.

[0051] Exposure: Mix BeyoECL Plus solution A and solution B in a 1:1 ratio, immerse the PVDF membrane in the luminescent solution for 30 seconds, and then place it in a darkroom chemiluminescence analyzer for imaging and preservation.

[0052] ImageJ software was used to calculate and analyze the imaging strips.

[0053] Through electron microscopy ( Figure 1 A) and nanoparticle size ( Figure 1 B) The morphology of exosomes was observed, and their diameter was mainly distributed between 30-200 nm. Furthermore, Western blot analysis revealed the exosome marker proteins Alix, TSG101, and CD9 in the bovine milk exosome samples. These results demonstrate that bovine milk exosomes can be successfully extracted using this method.

[0054] Example 2 To further illustrate the regulatory function of bovine milk exosomes on intestinal endocrine cells, Example 2 was conducted based on Example 1. The research object of this example was the regulatory function of bovine milk exosomes on STC-1 intestinal endocrine cells.

[0055] (1) Add 500 μL of Trizol to each cell well. After the cells are completely lysed, take the supernatant into a 1.5 mL enzyme-free centrifuge tube, let it stand for 10 min, and then centrifuge at 12000 rpm for 15 min at 4 °C. Take the supernatant. Add 0.2 mL of pre-chilled chloroform, shake vigorously for 20 s, let it stand for 5 min, and then centrifuge at 12000 rpm for 15 min at 4 °C. Transfer the supernatant to a new centrifuge tube, add an equal volume of pre-chilled isopropanol, mix well for 15 s, and let it stand at room temperature for 30 min or precipitate overnight at -20 °C. After precipitation, centrifuge at 12000 rpm and 4 °C for 15 min, discard the supernatant, and add 1 mL of pre-chilled 75% ethanol to wash the precipitate. Centrifuge at 8000 rpm and 4 °C for 5 min, discard the supernatant, repeat the washing once, and then air-dry the precipitate. When the precipitate at the bottom of the centrifuge tube becomes transparent, add an appropriate amount of DEPC water to dissolve the RNA. Total RNA concentration was measured using a nucleic acid concentration analyzer (1 μL each time), and RNA sample integrity was checked by agarose gel electrophoresis. Reverse transcription was performed using a cDNA kit. The reaction mixture was prepared using a qPCR premix kit, with ACTB as an internal control to quantify mRNA levels.

[0056] Experimental results are as follows Figure 2 As shown, qPCR was used to detect the expression levels of GCG and CCK mRNA in STC-1 cells after treatment with different concentrations of bovine milk exosomes for 24 hours and 48 hours. The results showed that, compared with the control group, treatment of STC-1 cells with 100 μg / mL bovine milk exosomes for 24 hours significantly inhibited the expression of GCG and CCK mRNA.

[0057] (2) The protein levels of hormone precursor proteins PG and CCK were detected by Western blot after STC-1 cells were treated with 100 μg / mL bovine milk exosomes for 24 hours.

[0058] When STC-1 cells reach 80% confluence, administer 1×10⁻⁶ cells. 5 cells / cm 2Cells were seeded at a density of [specific density not specified] into 12-well plates and treated when they reached 50% confluence. The experimental group received a complete culture medium containing a certain concentration of bovine milk exosomes, while the control group received a complete culture medium supplemented with an equal volume of PBS. Cells and supernatants were collected after 24 or 48 hours of treatment for subsequent experiments. The treated 12-well plates were washed twice with PBS, and 100 μL of RIPA cell lysis buffer (containing protease inhibitors) was added to each well. The plates were incubated on ice for 30 min, then scraped off the cells and transferred to 1.5 mL centrifuge tubes. Tissue samples were homogenized with lysis buffer before being transferred to 1.5 mL centrifuge tubes and centrifuged at 12000 rpm for 20 min at 4°C. The supernatant was collected. Following the BCA kit instructions, protein concentration was determined using the BCA method, and the required protein volume was calculated. 20% of the protein volume was added to 5× SDS-PAGE, and the remaining volume was made up with RIPA lysis buffer. The mixture was thoroughly mixed and then denatured at 99°C for 10 min in a metal water bath, and stored at -20°C. The subsequent steps are the same as the Western blot method in Example 1 above.

[0059] After cell treatment, the supernatant from the wells was aspirated into 1.5 mL centrifuge tubes and centrifuged at 4000 rpm for 20 min at 4°C. The supernatant was then stored at -80°C. The levels of GLP-1 and CCK in the cell supernatant after treating STC-1 cells with 100 μg / mL bovine milk exosomes for 24 hours were detected using ELISA. The assay was performed according to the ELISA kit instructions.

[0060] Experimental results are as follows Figure 3 As shown. From Figure 3 A indicates that, compared to the control group, bovine milk exosomes significantly inhibited the protein abundance of PG and CCK in STC-1 cells. Figure 3 B shows that, compared with the control group, bovine milk exosomes significantly inhibited the secretion of GLP-1 and CCK by STC-1 cells.

[0061] Example 3 To further illustrate the effects of bovine milk exosomes on feed intake regulation, lipogenesis, and intestinal hormone regulation in mice, Example 3 was conducted based on Example 2.

[0062] (1) Twenty-four 3-week-old male C57BL / 6J mice were housed under specific conditions (ambient temperature 22±2℃, relative humidity 40-70%, 12h-12h light-dark cycle). At the beginning of the experiment, the mice were randomly divided into a control group, a 5 mg / mL milk exosome group, a 15 mg / mL milk exosome group, and a 25 mg / mL milk exosome group, with 6 mice in each group. The control group mice were administered 200 μL of PBS by gavage daily, while the milk exosome treatment group mice were administered 200 μL of the corresponding concentration of milk exosome solution by gavage daily. The experimental period was 42 days, during which all mice had free access to food and water. At the end of the experiment, after fasting for 12 h, blood was collected from the orbital cavity of the mice and they were euthanized. Samples of hypothalamus, adipose tissue, and intestinal tissue were collected for subsequent experiments.

[0063] During the 42-day rearing period, the mouse weight and food intake were recorded, and the results were as follows: Figure 4 A and Figure 4 As shown in B. Compared with the control group, gavage administration of 25 mg / mL bovine milk exosomes significantly increased body weight and feed intake in mice.

[0064] (2) After the experiment, the fat content and lean tissue content of each mouse were measured using a MesoQMR23-060H MRI scanner (Numai, Suzhou). Before body imaging, the mice were placed in an isoflurane inhalation anesthesia device and anesthetized with about 3% isoflurane. After the mice lost their righting reflex, they were transferred to the MRI scanner for imaging.

[0065] The results are as follows Figure 5 A and Figure 5 As shown in Figure B, compared with the control group, gavage administration of 25 mg / mL milk exosomes significantly increased the fat content and decreased the lean tissue content in mice.

[0066] (3) After feeding for 42 days, the mice were euthanized by dislocation of the neck, and the subcutaneous white fat (iWAT) and epididymal white fat (eWAT) of the mice were collected and weighed.

[0067] The results are as follows Figure 6 As shown in the figure. The experimental results show that, compared with the control group, gavage administration of 25 mg / mL bovine milk exosomes can significantly increase the content of subcutaneous white adipose tissue (iWAT) and epididymal white adipose tissue (eWAT) in mice.

[0068] (4) Total RNA was extracted from the collected mouse hypothalamic tissue using the Trizol method, and the expression levels of NPY and POMC mRNA were detected by real-time PCR.

[0069] Remove the tissue culture from liquid nitrogen, take a small sample and place it in a homogenization tube pre-filled with homogenizing beads. Add 1 mL of Trizol and homogenize three times using a homogenizer. Subsequent steps, including total RNA extraction and RT-qPCR, follow the same procedure.

[0070] Experimental results are as follows Figure 7 As shown in the figure. The experimental results indicate that, compared with the control group, gavage administration of 25 mg / mL milk exosomes significantly upregulated the expression of NPY mRNA, a marker gene of feeding-promoting neurons in the hypothalamus of mice, and inhibited the expression of POMC mRNA, a marker gene of feeding-inhibiting neurons, thereby promoting feeding behavior at the central level.

[0071] (5) Regulation of mouse intestinal hormone secretion mediated by bovine exosomes: Total RNA was extracted from collected mouse ileal tissue using the Trizol method. The expression levels of GCG and CCK mRNA in the ileum of mice administered 25 mg / mL of bovine exosomes by gavage were detected by qPCR. (The extraction of total RNA and the RT-qPCR method were the same as those described above.) Experimental results are as follows Figure 8 As shown, compared with the control group, gavage administration of 25 mg / mL bovine milk exosomes significantly inhibited the expression of GCG and CCK mRNA in the ileum of mice.

[0072] (6) The protein levels of hormone precursor proteins PG and CCK in the ileum of mice administered 25 mg / mL of bovine milk exosomes by gavage were detected by Western blot. Total protein was extracted from intestinal tissue using RIPA lysis buffer containing protease inhibitors. Tissue samples were homogenized in a homogenizer before being transferred to 1.5 mL centrifuge tubes. Subsequent steps were the same as those described in the Western blot method. The levels of GLP-1 and CCK in the serum of mice administered 25 mg / mL of bovine milk exosomes by gavage were detected by ELISA. Serum collection: Blood was collected from the orbital sinus of mice and added to 1.5 mL centrifuge tubes containing sitagliptin. After standing at room temperature for 1 h, the cells were centrifuged at 3000 rpm for 20 min at 4 °C. The supernatant was collected and stored at -80 °C. The detection was performed according to the ELISA kit instructions.

[0073] Experimental results are as follows Figure 9 As shown in the figure. The experimental results show that, compared with the control group, bovine milk exosomes significantly inhibited the protein abundance of PG and CCK in the ileum of mice and the serum GLP-1 and CCK levels.

[0074] In summary, the results show that gavage administration of 25 mg / mL bovine milk exosomes significantly increased body weight and feed intake in mice, promoted body fat deposition, increased the weight of subcutaneous and visceral white adipose tissue, and significantly reduced the levels of intestinal hormones GLP-1 and CCK, which have an anti-feeding effect, while also regulating the expression of hypothalamic NPY and POMC. Therefore, gavage administration of 25 mg / mL bovine milk exosomes can improve animal appetite and carcass quality.

[0075] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in the present invention should still be covered by the claims of the present invention.

Claims

1. The application of bovine milk exosomes in the preparation of foods or feeds that promote animal feed intake and fat deposition, characterized in that, The feeding amount of the bovine milk exosomes is 1~10mg.

2. The application as described in claim 1, characterized in that, The feeding amount of the bovine milk exosomes is 1-5 mg.

3. The application as described in claim 1, characterized in that, The bovine milk exosomes promote animal feed intake and fat deposition by regulating the animal intestinal hormones glucagon-like peptide-1 and cholecystokinin.

4. The application as described in claim 1, characterized in that, The bovine milk exosomes regulate animal feeding behavior and improve carcass composition by downregulating the mRNA expression of the feeding neuron-related gene POMC in the hypothalamus and upregulating the expression of the feeding neuron-related gene NPY.

5. The application as described in claim 4, characterized in that, The improvement of animal ketone body composition is achieved by increasing fat deposition in the animal's body.

6. A method for promoting feed intake and fat accumulation in animals, characterized in that, Includes the following steps: The bovine milk exosomes were prepared into a solution and administered by gavage.

7. The method for promoting animal feed intake and fat accumulation as described in claim 6, characterized in that, The concentration of the solution is 20-30 mg / mL.

8. The method for promoting animal feed intake and fat accumulation as described in claim 6, characterized in that, The solvent used to prepare the bovine milk exosomes into a solution is PBS solution.

9. The method for promoting animal feed intake and fat accumulation as described in claim 6, characterized in that, The amount administered via gavage is 100-300 μL.

10. The method for promoting animal feed intake and fat accumulation as described in claim 6, characterized in that, The bovine milk exosomes were derived from bovine milk and obtained by separation and purification using ultracentrifugation.

Images