Application of reagent for inhibiting or detecting Fasn and medicine for preventing and / or treating transplanted vascular remodeling

Abstract

The invention belongs to the technical field of transplanted vascular remodeling diagnosis and treatment, and discloses application of a reagent for inhibiting or detecting Fasn and a medicine for preventing and / or treating transplanted vascular remodeling. Experimental research discovers that a group of novel macrophages capable of self-synthesizing lipid exist in the transplantation blood vessel reconstruction process, and Fasn is remarkably activated, so that intracellular lipid accumulation is caused, and the macrophages are promoted to be converted into foam cells. In-vitro studies show that by inhibiting the activity of the Fasn enzyme or down-regulating the expression of the Fasn enzyme, the transformation of macrophages to foam cells can be obviously inhibited, and the synthesis of lipid in cells can be reduced. Based on the discovery, the nucleic acid medicine constructed by adopting the siRNA is used for treating and / or relieving transplanted vascular remodeling. In-vivo experiments further prove that the nucleic acid medicine can remarkably inhibit intimal hyperplasia of transplanted blood vessels and reduce the neointimal / medial membrane ratio, so that the therapeutic effect is achieved. The method has a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of diagnostic and therapeutic technology for transplanted vascular remodeling, specifically involving the application of reagents for inhibiting or detecting Fasn, and drugs for preventing and / or treating transplanted vascular remodeling. Background Technology

[0002] Transplant vascular remodeling mainly refers to cardiac transplant vascular lesions that occur after organ transplantation and coronary artery bypass grafting. It is a unique accelerated arterial disease dominated by chronic immune rejection and involves complex interactions between immune and non-immune mechanisms, leading to endothelial damage, inflammatory infiltration, abnormal proliferation of smooth muscle cells, fibrosis, and negative remodeling (remodeling from the adventitia to the intima, resulting in luminal narrowing), ultimately causing diffuse vascular stenosis.

[0003] Transplant vascular remodeling is a common complication after heart transplantation, with its incidence increasing cumulatively over time (approximately 10% at 1 year, 30% at 5 years, and 50% at 10 years), affecting about 30-50% of patients and being one of the leading causes of death one year after transplantation. Risk factors include immune factors (such as HLA incompatibility and antibody-mediated rejection) and non-immune factors (such as hypertension and CMV infection). Clinical diagnosis is challenging due to the subtle nature of symptoms; the gold standard is invasive coronary angiography combined with intravascular ultrasound or optical coherence tomography (OCT). Non-invasive imaging and biomarkers have limited auxiliary value. Treatment focuses on prevention and delay, including statins, mTOR inhibitors, and risk factor control. In advanced stages, interventional therapy or re-transplantation may be considered (5-year survival rate approximately 50-60%). Current challenges include low early diagnosis rates, lack of specific treatments, high restenosis rates after interventional procedures, side effects of immunosuppressants, and insufficient individualized management.

[0004] Currently, some drugs and genes have been reported for use in treating vascular remodeling or as targets. For example, patent application CN121102187A discloses the use of β-alanine in the preparation of drugs for treating pulmonary hypertension. This substance can inhibit lactate-mediated histone lactylation modification and hypoxia-induced PASMC phenotypic transformation, thus improving pulmonary artery vascular remodeling. Patent application CN121243391A discloses the application of THBS4 in vascular remodeling, etc. However, these drugs or target genes are not specifically for transplant vascular remodeling. Currently, there are few target molecules specifically for the treatment and diagnosis of transplant vascular remodeling. There are significant differences between conventional vascular remodeling and transplant vascular remodeling in terms of pathological mechanisms, lesion characteristics, progression rate, and efficacy of basic treatments: the former is mainly characterized by mechanical and metabolic stress, with localized lesions and slow progression (from several years to decades), and basic treatments such as antihypertensive and lipid-lowering treatments are effective; the latter is centered on immune microenvironment dysregulation, with diffuse lesions and accelerated progression (e.g., 50% of heart transplant recipients develop the disease within 10 years), and basic treatments have limited effect. Therefore, developing new diagnostic and therapeutic methods specifically targeting transplanted vascular remodeling has become an important topic in basic research and translational invention in this field.

[0005] In preliminary experiments of this invention, a new group of macrophages was discovered after artery transplantation. Unlike conventional foam cell formation, these macrophages can synthesize lipids de novo to form foam cells. Inhibiting their lipid synthesis effectively blocks their transformation into foam cells and reduces the degree of vascular intimal thickening. Therefore, this invention primarily focuses on the discovery of a novel foam cell subtype in vascular transplantation diseases. By anchoring this newly discovered key cell type and signaling pathway, and identifying new targets to alleviate transplant immune rejection, this invention holds promise for improving the diagnosis and treatment of transplanted vascular remodeling.

[0006] Fatty acid synthase (Fasn) is a multi-enzyme complex encoded by the Fasn gene, primarily responsible for catalyzing the de novo synthesis of fatty acids. It converts acetyl-CoA and malonyl-CoA to palmitic acid in the presence of NADPH. This process involves iterative decarboxylation Claisen condensation reactions, leading to a saturated state through the stepwise elongation and reduction of fatty acid chains. Fasn is the core enzyme in de novo fatty acid synthesis, providing building blocks for energy storage and membrane formation. Its dysregulation can affect lipid homeostasis. Targeting Fasn as a diagnostic or therapeutic target molecule for transplanted vascular remodeling has never been reported.

[0007] Furthermore, the role of small interfering RNA (siRNA) technology in the treatment of various diseases has been widely recognized. siRNA can specifically silence target genes, such as the Fasn gene, providing new opportunities for the prevention or treatment of transplant vascular remodeling. Compared to Fasn inhibitors, which act on the surface of target cells or the entire circulatory system, siRNA can target the intracellular mRNA level, downregulating Fasn protein expression, thus offering greater specificity. Summary of the Invention

[0008] The main objectives of this invention include: providing the application of reagents for inhibiting or detecting Fasn, and drugs for preventing and / or treating transplanted vascular remodeling. Nucleic acid drugs designed based on a newly discovered cell population and its key target Fasn in transplanted vascular remodeling are used for the prevention and / or treatment of transplanted vascular remodeling. This invention, through experimental research, discovered a novel group of macrophages capable of synthesizing lipids during transplanted vascular remodeling, in which Fasn is significantly activated, leading to intracellular lipid accumulation. In vitro studies have shown that inhibiting Fasn enzyme activity or downregulating its expression can significantly inhibit the transformation of macrophages into foam cells and reduce intracellular lipid synthesis. Based on the above findings, nucleic acid drugs constructed using siRNA are used to treat and / or alleviate transplanted vascular remodeling. In vivo experiments further confirmed that this nucleic acid drug can significantly inhibit intimal hyperplasia of transplanted blood vessels and reduce the neointima / media ratio, thereby exerting a therapeutic effect. Therefore, nucleic acid drugs designed targeting the highly expressed Fasn in this newly discovered macrophage population can effectively block its differentiation into foam cells and alleviate or inhibit the process of transplanted vascular remodeling.

[0009] To achieve the above objectives, the present invention adopts the following specific solution:

[0010] The application of agents that inhibit Fasn in the preparation of drugs for the prevention and / or treatment of transplant vascular remodeling.

[0011] Furthermore, the reagents for inhibiting Fasn include reagents that inhibit Fasn gene expression or Fasn protein.

[0012] This invention discovers a novel macrophage population identified in an allogeneic transplantation model. Specifically, transplanted blood vessels from mice in an allogeneic transplantation disease model were digested and prepared into a single-cell suspension. Single-cell sequencing analysis revealed a novel group of macrophages that differ from conventional macrophages.

[0013] High expression of Fasn, a key enzyme in de novo lipid synthesis, was detected in the newly discovered macrophages. In vitro experiments showed that inhibiting Fasn expression could suppress the transformation of macrophages into foam cells, and could inhibit and / or improve transplanted vascular remodeling, reduce intimal neoplasia, and decrease the intima / media ratio, thereby alleviating transplanted vascular lesions.

[0014] Furthermore, the reagent for inhibiting Fasn gene expression includes siRNA.

[0015] Preferably, the siRNA sequence is:

[0016] Fwd: 5'-CUUUCUUCUUCGACUUCAAAG-3'; SEQ ID NO.1,

[0017] Rev: 5'-CUUUGAAGUCGAAGAAGAAAG-3', SEQ ID NO.2,

[0018] As a control, the siNC sequence is:

[0019] Fwd: 5'-UUCUCCGAACGUGUCACGU-3'; SEQ ID NO.3,

[0020] Rev: 5'-ACGUGACACGUUCGGAGAA-3'; SEQ ID NO. 4.

[0021] The reagents for inhibiting Fasn gene expression also include drugs obtained by loading siRNA onto lipid nanoparticles (LNPs).

[0022] The aforementioned reagent is specifically an LNP-siFasn nanoparticle formulation, which is constructed by carrying siRNA that targets fatty acid synthase (Fasn).

[0023] Lipid nanoparticles (LNPs), with their composition of cationic lipids, cofactor lipids, cholesterol, and PEG-modified lipids, exhibit high adaptability: they can not only encapsulate and protect siRNA from degradation, but also bind to siRNA through electrostatic interactions, allowing it to enter cells via endocytosis and be released into the cytoplasm to exert its effects. Furthermore, the surface of LNPs is easily modified to enhance targeting and reduce immunogenicity. Based on this, this invention further utilizes LNPs as a carrier for siFasn, aiming to better prevent and / or alleviate transplanted vascular remodeling, reduce intimal neoplasia and lower the intima-to-media ratio, thereby alleviating transplanted vascular lesions.

[0024] Drugs for the prevention and / or treatment of transplant vascular remodeling, including the aforementioned agents that inhibit Fasn.

[0025] The nucleic acid drugs of the present invention are not limited to the nucleic acid drug form of LNP-siFasn.

[0026] The reagents for detecting Fasn are used to prepare kits for diagnosing transplanted vascular remodeling.

[0027] Furthermore, the reagents for detecting Fasn include: PCR detection reagents, in situ hybridization detection reagents, or antibody detection reagents.

[0028] Furthermore, the primer sequences for the PCR detection reagents were all purchased from Sangon Biotech Co., Ltd.

[0029] SEQ ID NO.5:Fasn-Fwd: GAGGGTGTGCCATTCTGTCA,

[0030] SEQ ID NO.6:Fasn-Rev: GCTATTCTCTACCGCTGGGG,

[0031] SEQ ID NO.7: β-actin-Fwd: GTGCTATGTTGTCTAGACTTCG,

[0032] SEQ ID NO. 8: β-actin-Rev: ATGCCACAGGATTCCATACC.

[0033] The transplant vascular remodeling described in this invention includes cardiac transplant vascular lesions that occur after organ transplantation and coronary artery bypass surgery.

[0034] The beneficial effects of this invention are as follows: This invention discovers the role of novel macrophages and their key target Fasn in allogeneic transplantation of transplanted blood vessels, and designs and synthesizes siFasn-based nucleic acid drugs that can prevent and / or alleviate transplanted blood vessel remodeling. Furthermore, at the cellular level, the siFasn-based nucleic acid drug can be targeted and taken up by these novel macrophages, downregulating or silencing Fasn expression, inhibiting de novo fatty acid synthesis, and thus blocking its transformation into foam cells. In a mouse allogeneic transplant vascular disease (AG) model, local administration of the siFasn-based nucleic acid drug allows for long-term retention around the blood vessels, achieving a sustained effect, effectively preventing and / or alleviating transplanted blood vessel remodeling, reducing intimal neoplasia, lowering the intima / media ratio, and slowing vascular lesions. In vitro safety evaluation shows that the siFasn-based nucleic acid drug has good biosafety. The above experiments confirm the positive role of siFasn-based nucleic acid drugs in the treatment of transplanted blood vessel remodeling, and have significant practical implications and broad application prospects in the medical field. Attached Figure Description

[0035] Figure 1 Figure related to the isolation and identification of new macrophage populations;

[0036] Figure 1 A: This shows an experimental diagram of an allogeneic transplant mouse model and tissue sampling 4 weeks after transplantation. Figure 1B: UMAP plots showing the major cell types and cell clusters in the remodeled artery at normal aorta (0W), 2 weeks post-allogeneic transplantation (AG) (2W), and 4 weeks post-allogeneic transplantation (AG) (4W); Figure 1 C: Percentage of nine major cell clusters in the normal aorta (Ctrl), remodeled artery at 2 weeks (AG 2W), and 4 weeks (AG4W) after allogeneic transplantation; Figure 1 D: Comparison of characteristic genes of five macrophage subsets (Il1b, Ccr2, Ly6c2, Spp1, Cd36, Cxcl9, Serpina3g, Folr2, Mrc1, S100a9, S100a8, Hdc) in scRNA-Seq data; Figure 1 E: Comparison of feature scores for three pathways (lipid synthesis, proinflammatory, and phagocytosis) in five macrophage subsets (RPL MF, Foam-like MF, Inf MF, Res-like MF, NeuMo) in scRNA-Seq data; Figure 1 F: Percentages of five macrophage subsets (RPL MF, Foam-like MF, Inf MF, Res-like MF, NeuMo) at 2 and 4 weeks post-allogeneic transplantation in scRNA-Seq data;

[0037] in Figure 1 B shows the major cell types and nine color-coded cell clusters in the normal aorta (0W), the AG at 2 weeks post-allogeneic transplantation (2W), and the AG at 4 weeks post-allogeneic transplantation (4W); the normal aorta contained 3183 cells (including monocytes / macrophages (Mo&MF), fibroblasts, T cells, B cells, neutrophils, smooth muscle cells (SMC), NK cells, endothelial cells (EC), and dendritic cells (DC)), the AG2W group contained 4345 cells, and the AG4W group contained 4567 cells.

[0038] Figure 2 : Correlation diagram of gene expression of novel target (Fasn);

[0039] Figure 2 A: The left side (categorized by cell_type) compares the discovered AG_Foam-like MF (AG_foam macrophage subtype) with other macrophages and foam cells in the AG model and AS model (atherosclerosis model); the right side (categorized by dataset) compares the discovered cell dataset under the AG model with the classic model. Figure 2B: Z-score expression heatmap of functional gene set;

[0040] in Figure 2 A. Different colors on the left represent different cell subtypes. It can be seen that different cell subtypes exhibit relatively clustered regions in the UMAP space. AG_Foam-like MF has non-overlapping parts with others, indicating that this cell subtype has unique expression characteristics and can be effectively distinguished. Different colors on the right represent datasets from different sources (such as AG, AS (classic cell subtypes from Cochain et al. 2018), etc.), showing the distribution patterns of cells from different datasets in the UMAP space. It can be observed that there is little overlap in cell distribution between this invention and other datasets. In summary, this confirms that this is a new cell community. Figure 2 The heatmap of B uses Z-scores (normalized expression values, red = high expression, blue = low expression) to show the expression differences of genes in different functional modules in three cell subtypes (AG_Foam-like MF of this invention and two classic cell subtypes AS_Non_Foamy_MF and AS_Trem2_Foamy_MF in Cochain et al. 2018): In lipid synthesis, AG_Foam-like MF highly expresses the Fasn gene.

[0041] Figure 3 Characterization data of nanomedicines;

[0042] Figure 3 A: LNP particle size distribution based on intensity; Figure 3 B: Zeta potential distribution of LNP;

[0043] in Figure 3 A, the horizontal axis represents particle size (Size), in d.nm (diameter in nanometers), ranging from 0.1 to 10000 d.nm; the vertical axis represents intensity percentage (Intensity), in percentage (Percent). The peaks of the three curves (green, blue, and orange) are concentrated in the particle size region of approximately 100 d.nm, where the intensity percentage exceeds 20%. Particles with a size smaller than 10 d.nm or larger than 1000 d.nm have an intensity percentage of almost 0, indicating that the particle size is mainly concentrated in the range of approximately 100 d.nm. Figure 3B, the horizontal axis is the Zeta potential, in mV, ranging from -200 to 200 mV; the vertical axis is the total count, in kcps (thousands of counts per second), ranging up to 200,000 kcps. The peaks of the three curves (green, blue, and orange) are concentrated in the Zeta potential region close to 0 mV, where the peak total count is close to 200,000 kcps. In the region where the absolute value of the Zeta potential is greater than 50 mV, there are almost no particles, indicating that the Zeta potential of most particles is concentrated near 0 mV.

[0044] Figure 4 Results of in vitro efficacy verification;

[0045] Figure 4 A: Cell immunofluorescence staining and quantitative analysis of positive rate; Figure 4 B: qPCR detection of mRNA expression levels;

[0046] in Figure 4 A. Cell staining results of different treatment groups (Vehicle: blank control; siNC: negative control siRNA wrapped with LNP; siFasn: siRNA targeting Fasn wrapped with LNP); the left image is an immunofluorescence image (DAPI staining cell nuclei, blue; BODIPY staining lipids, green; LNP-siFasn labeled nanomedicine, red); the right image is a quantitative statistical analysis of BODIPY positive cells (blue dots represent Col1a1 (-) subset, pink dots represent Col1a1 (+) subset, BODIPY +MF cells are AG_Foam-like MF); the results show that the collagen Col1a1 (+) treatment group can promote macrophage lipid synthesis, and the comparison between the siNC group and the Vehicle group (P<0.0001) shows that the siNC group does not inhibit lipid synthesis; after siFasn treatment, lipid synthesis can be inhibited ( >0.9999); Figure 4 B represents the qPCR detection of mRNA expression levels. The relative expression levels of Fasn mRNA in different treatment groups (normalized with Actb as an internal reference): the expression levels in the siNC and Vehicle groups were consistent, while the expression levels in the siFasn group were significantly lower than those in the siNC group, indicating that nanomedicines can silence the Fasn gene expression in macrophages.

[0047] Figure 5 Results of in vivo efficacy verification;

[0048] Figure 5 AB, DE: Immunofluorescence staining, lipid synthesis levels, and Foam-like macrophage quantification; Figure 5 C, FG: Flow cytometry sorting of tdT + Macrophages were used to detect Fasn expression levels and analyze macrophage (MF) subset distribution by q-PCR. Figure 5 HI: Histopathology and intima-media ratio (IM ratio) analysis;

[0049] in Figure 5 AB was divided into three groups: ctrl (control), AG2w-LNP-siNC, and AG2w-LNP-siFasn; markers were obtained using F4 / 80 (macrophage markers) and tdT (CD34 markers). + Hematopoietic stem / progenitor cells), LNP co-staining ( Figure 5 A), macrophage infiltration and LNP delivery efficiency, indicating that LNP was successfully delivered to macrophages within the plaque ( Figure 5 B). Figure 5 DE was divided into three groups: ctrl (control), AG2w-LNP-siNC, and AG2w-LNP-siFasn; and was co-stained with F4 / 80 (macrophage marker), tdT, and BODIPY. Figure 5 D) Explains the relationship between foam cell formation and lipid accumulation. Figure 5 E indicates that the foam cell-like MF in the LNP-siFasn group was significantly lower than that in the LNP-siNC group; Figure 5 Four weeks after FG and AG, whole blood vessel cells were sorted by flow cytometry and divided into LNP-siNC and LNP-siFasn treatment groups. tdT was then screened using gating. + CD11b + F4 / 80 + Macrophages (flow cytometry sorting strategy, selecting lineage-derived myeloid macrophages) were used to distinguish NeuMo, Res-Like Fo MF, Foam-like MF, INF MF, and RPL MF subsets using flow cytometry scatter plots. Figure 5 F), Figure 5 G indicates that after LNP-siFasn treatment, the proportions of Foam-like MF and INF MF were significantly lower than those in the LNP-siNC group (both P<0.0001). Figure 5 C. Flow cytometry was used to separate tdT from whole blood vessel cells. + MF was divided into LNP-siNC and LNP-siFasn treatment groups, and the expression level of Fasn was detected by q-PCR, indicating that siFasn effectively knocked down the expression of Fasn in macrophages; Figure 5 H represents the microscopic observation results of HE staining of AG4w transplanted blood vessel pathological sections. Figure 5I. The morphology of the transplanted blood vessels was displayed 4 weeks later, and the intima-media ratio of each group was calculated. Quantitative analysis showed that the intima-media ratio of the LNP-siFasn group was significantly lower than that of the LNP-siNC group (P=0.0001). This indicates that nanomedicines can prevent and / or alleviate transplanted vascular remodeling in vivo, reduce intimal neoplasia, and decrease the intima-media ratio. Detailed Implementation

[0050] The present disclosure will be further described below with reference to specific embodiments. Many specific details are set forth in the following description to provide a thorough understanding of the present disclosure. However, the present disclosure can be implemented in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present disclosure. Therefore, the present disclosure is not limited to the specific embodiments disclosed below.

[0051] Example 1: Discovery, validation, and intervention tool design of new cell subsets and their target gene Fasn in vascular transplantation

[0052] 1. Establishment of an allogeneic vascular transplantation animal model: Male C57BL / 6J (wild-type, WT) mice and female BALB / c mice (wild-type, WT) (purchased from Hunan Slack Jingda Experimental Animal Co., Ltd.) were housed in a specific pathogen-free (SPF) barrier system at the animal facility of Central South University. The temperature and humidity of the housing were maintained within a range suitable for the mice's living conditions. Mice were anesthetized using continuous isoflurane gas inhalation. After anesthetizing 6-8 week old BALB / c donor mice, they were fixed on a surgical board. A cotton ball soaked in 75% alcohol was applied to the mouse's abdomen using forceps. A midline abdominal incision was made in the donor mouse, the internal organs were moved to one side, and the inferior vena cava was exposed and injected with heparin solution. The adipose tissue surrounding the aorta was removed using forceps. A suitable length of vessel was separated from the aortic arch to the aortic bifurcation, irrigated until the lumen was bloodless, electrocoagulated, and cut with microscissors. The irrigated aortic segment was placed in a culture dish containing heparin solution. After anesthetizing and fixing 6-8 week old C57BL / 6J recipient mice, the neck skin tissue was cut open to expose the carotid artery. The tissue surrounding the carotid artery was carefully separated. Both ends of the carotid artery were ligated with silk sutures, and the artery was cut in the middle with scissors. A nylon cannula was inserted onto the blood vessel, and one end of the cannula was clamped and fixed with a hemostatic clip. The blood vessel was cut cleanly with scissors close to the ligated end. The blood vessel was flushed with heparin to remove any residual blood. The two ends of the blood vessel were held with fine microforceps, and the vessel was flipped over and placed onto the nylon cannula, where it was ligated and fixed with silk sutures. An appropriate length of donor aortic segment was taken, and the segment was first placed onto the arterial cannula and ligated with silk sutures. Finally, the hemostatic clips were removed to restore blood supply.

[0053] 2. Vascular digestion and single-cell suspension preparation: Four weeks post-vascular transplantation, C57BL / 6J recipient mice were anesthetized with 1% sodium pentobarbital at 50 mg / kg. The mice were fixed, and the abdomen was cut open to expose the heart. A small incision was made in the right atrium, and physiological saline was perfused into the left ventricle until the liver turned white. The neck skin was cut open to expose the carotid artery. The tissue surrounding the carotid artery was carefully separated, and the aortic graft in the middle segment of the carotid artery was severed and placed in 10 mL of DMEM high-glucose medium containing 10% FBS. The aortic graft was observed under a stereomicroscope. The vessel was fixed with curved forceps, and the media and adventitia were separated using microforceps. The media and adventitia were placed separately in another clean culture dish containing 10% FBS in DMEM high-glucose medium. The vessel was fixed with microforceps, longitudinally cut with microscissors, and then transversely minced. The supernatant from the culture dish was transferred to a 50 mL centrifuge tube using a Pasteur pipette and placed on ice. Add 400 μL of 1 mg / mL papain to a culture dish containing shredded tissue pieces, ensuring the digestive solution covers the tissue. Place the dish in a shaker at 37°C and shake at 135 rpm for 10 min. Observe the digesting tissue under a microscope; grape-like cell clusters can be observed. Gently pipette several times, and transfer the supernatant from the culture dish to a 50 mL centrifuge tube using a Pasteur pipette. Continue adding 300 μL of papain to the culture dish, and repeat the above steps of "adding digestive enzyme, shaking in a constant temperature shaker, microscopic observation, collecting the digestive supernatant, and pipetting" for 5-6 rounds until the tissue is completely loosened and almost all cells are free. Filter the digestive solution through a 40 μm sieve, and rinse the sieve twice with 200 μL PBS. Centrifuge the collected cell suspension at 400 g / min for 5 min, discard the supernatant, and resuspend in an appropriate amount of PBS.

[0054] 3. Single-cell transcriptome sequencing: Cell viability in single-cell suspensions of vascular tissue was detected using trypan blue staining and counting, ensuring a viability range of 60%-90%. The single-cell suspensions were then submitted to Shanghai Ouyi Biomedical Technology Co., Ltd. for single-cell transcriptome library construction and sequencing following the 10x Genomics standardized protocol: single cells were captured using gel beads, and single-cell markers with specific barcodes and molecular identifiers were generated; 8000-10000 cells were captured, lysed, reverse transcribed, amplified, and purified using cDNA; the generated library was sequenced on the Illumina NovaSeq 6000 platform, with a sequencing depth of 30 M data per cell. The raw sequencing data was decomposed using Cell Ranger software to generate FASTQ files, whose contents were read and matched with the mouse reference genome mm10 to generate an expression matrix.

[0055] 4. Single-cell sequencing data quality control, cell clustering analysis, and differentially expressed gene analysis: Based on the expression matrix, the following processing and analysis were performed using the R package Seurat: cells expressing more than 5000 genes were filtered to exclude non-cells or cell aggregates; cells with a mitochondrial gene percentage greater than 5% were filtered; logarithmic normalization and principal component analysis were performed for dimensionality reduction; cell clustering was performed based on cell population function using the FindClusters function; and differentially expressed genes (DEGs) between cell subpopulations were identified using the FindMakers function, with Bonferroni-corrected test p-values ​​less than 0.05 considered statistically significant.

[0056] Analysis of single-cell transcriptome sequencing data from allogeneic transplanted blood vessels, using unsupervised clustering analysis, identified a novel macrophage subset with unique transcriptome characteristics: AG_Foam-like MF (e.g., ...). Figure 1 As shown in the figure. This subpopulation forms independent clusters in a dimensionality-reduced visualization space (such as UMAP or t-SNE) and expresses a set of marker genes that distinguish it from known cell types. Further differential gene expression analysis revealed that this novel cell subpopulation specifically and significantly highly expresses the Fasn gene (e.g., Figure 2 (As shown). Compared with all other control cell clusters, the mean expression level of this gene and the proportion of cells expressing this gene in this population were both statistically significantly increased (adjusted p < 0.001). Its expression level ranked among the top of the marker genes in this population, suggesting that Fasn may play a key role in the identity definition, functional performance, or microenvironment maintenance of this novel cell subpopulation.

[0057] Example 2: Preparation and characterization of siRNA / liposome nanocomposite (LNP-siFasn)

[0058] siRNA selection and synthesis: The siRNA sequence targeting the target gene Fasn (Gene ID: 14104, National Center for Biotechnology Information (NCBI)) is: 5'-CUUUCUUCUUCGACUUCAAAG-3' (sense strand), 5'-CUUUGAAGUCGAAGAAGAAAG-3' (antisense strand). This sequence design aims to ensure high specificity and silencing efficiency against the target mRNA. Based on the determined sequence, Nanjing Genscript Biotech Co., Ltd. was commissioned to chemically synthesize the relevant nanomedicine. The specific construction process is as follows.

[0059] 1. Preparation of LNP-siFasn:

[0060] (1) Preparation of “basic LNP loaded with siRNA”: First, the core lipid components of LNP (including cationic lipids and auxiliary lipids) are dissolved in an organic solvent; the dissolved lipid solution is mixed with the siRNA aqueous solution, allowing the lipids to self-assemble into nanoparticles and encapsulate the siRNA inside the LNP; the loaded LNP is purified and concentrated to obtain “basic LNP containing siRNA inside”, which is the basic LNP-siFasn.

[0061] (2) “Post-insertion method” to modify the basic LNP-siFasn with a linker molecule: Take the “basic LNP-siFasn” obtained in step (1) and mix it with a solution of distearate phosphatidylethanolamine-polyethylene glycol-maleimide (DSPE-PEG-Mal); using the lipid properties of DSPE (phospholipid group), let DSPE-PEG-Mal insert into the lipid membrane structure of LNP; after incubation and purification, LNP-siFasn with DSPE-PEG-Mal linked on the surface is obtained (at this time, the LNP surface has maleimide (Mal) reactive groups).

[0062] (3) Thiolization modification of mannose: Take the target mannose and incubate it with N-succinimide-S-acetylthioacetate (SATA) reagent in buffer; the "succinimide ester group" of SATA will react with the amino group (-NH2) on the mannose molecule to link SATA to mannose; add the deprotecting reagent hydroxylamine to remove the acetyl protection on SATA, so that the thiol group (-SH) is exposed on the surface of mannose; after purification, "thiol-modified mannose" is obtained.

[0063] (4) Coupling of mannose with LNP (forming targeted LNP-siFasn): The “DSPE-PEG-Mal modified LNP-siFasn” obtained in step (2) is mixed with the “thiol-modified mannose” obtained in step (3); using the chemical reaction (Michael addition reaction) between maleimide (Mal) and thiol (-SH), mannose is covalently linked to the LNP surface through the PEG chain; after incubation, the unbound free antibody is removed, and finally “targeted LNP-siFasn with mannose coupled to the surface and siRNA loaded inside” is obtained.

[0064] 2. Research on the physical characterization of nanomedicines

[0065] (1) Particle size determination: LNP-siFasn dispersed in 100 μL of HEPES buffer was analyzed using a Marlven Nano ZS instrument with dynamic light scattering (DLS) method. Each sample was tested in triplicate. The results showed that the nanoparticle size uniformity was PDI < 0.2, with a particle size of approximately 100 nm. Figure 3 (As shown in A)

[0066] (2) Potential Measurement: 100 μl of LNP-siFasn was transferred to a potential cell, and the zeta potential was measured using a Marlven Nano ZS instrument. Each sample was tested in triplicate. The results showed that the zeta potential of LNP-siFasn was approximately 0 mV. (e.g.) Figure 3 (as shown in B)

[0067] Example 3: In vitro functional verification of nanomedicines

[0068] Previous research in this invention found that the interaction between macrophages and type I collagen (Col1a1) can promote macrophages to synthesize lipids themselves and transform into foam-like macrophages (the classic pathway is that macrophages engulf exogenous lipids and transform into foam cells).

[0069] 1. Cell Preparation and Plate Seeding: RAW264.7 macrophage cells (purchased from the China Center for Type Culture Collection) were resuscitated in liquid nitrogen and cultured in DMEM medium containing 10% fetal bovine serum (FBS) + 1% penicillin / streptomycin in a 37°C, 5% CO2 incubator. Once the cells reached the logarithmic growth phase (70-80% confluence), they were trypsinized and passaged to ensure good cell condition for experiments. RAW264.7 cells in the logarithmic growth phase were trypsinized, resuspended in complete medium, and counted. 12-well cell culture plates were selected, and type I collagen (Col1a1) was seeded into two groups: Col1a1(-) and Col1a1(+). 5 × 10⁶ cells were then added to each well. 4 Take approximately 100 cells (final volume 500 μL of complete culture medium); incubate overnight (12-16 h) in an incubator until the cells adhere to the wall and reach a confluence of 50-60% (this state is conducive to LNP uptake).

[0070] 2. LNP-siFasn drug administration intervention: group setup (3 groups, 3 biological replicates)

[0071] Blank control group (Vehicle): Only complete culture medium was added;

[0072] Negative control siRNA group (LNP-siNC): LNP encapsulates non-targeting negative control siRNA, and the siNC sequence is shown in SEQ ID NO.3-4;

[0073] Target gene siRNA group (LNP-siFasn): LNP encapsulates siRNA targeting the target gene, and the siFasn sequence is shown in SEQ ID NO.1-2.

[0074] Dilute LNP-siRNA with serum-free DMEM medium in advance, remove the original complete medium from the 24-well plate, add 500 μL of serum-free medium containing LNP-siRNA to each well; incubate in an incubator for 4 hours, then add 500 μL of complete medium (to restore the system to a serum-containing environment); continue culturing for 48 hours.

[0075] 3. In vitro phenotypic immunofluorescence verification of cells: Cells treated as described above were fixed with paraformaldehyde for 15 min, washed three times with PBS for 5 min each time; permeabilized with 0.2% Triton 100 for 10 min; washed three times with PBS for 5 min each time; blocked with 5% bovine serum albumin (BSA) at room temperature for 60 min, and the blocking solution was discarded (without washing). BODIPY fluorescent antibody (1:200) was added for staining for 30 min, followed by DAPI (1:5000), and residual staining was removed. The slides were mounted with an anti-fluorescence quencher, and the fluorescence intensity was observed and quantified using a laser confocal microscope. (e.g.) Figure 4 (As shown in A)

[0076] 4. Total RNA extraction, reverse transcription, and quantitative real-time polymerase chain reaction (qPCR) detection: Cells were gently washed twice with pre-chilled phosphate-buffered saline (PBS) to remove residual culture medium. After aspirating the PBS, pre-chilled TRIzol lysis buffer (1 mL / well in a 6-well plate) was added to each well, and the cells were lysed on ice for 10-15 minutes until the solution thickened. The lysis buffer was then transferred to enzyme-free EP tubes. Next, chloroform was added at a TRIzol:chloroform ratio of 5:1 (v / v), and the mixture was vigorously vortexed and centrifuged at 12,000 g for 15 minutes at 4°C on ice. After centrifugation, the colorless aqueous supernatant was carefully aspirated to a new tube, and an equal volume of pre-chilled isopropanol was added. The mixture was mixed and precipitated on ice, followed by centrifugation again at 12,000 rpm for 15 minutes at 4°C to obtain RNA precipitate. The RNA precipitate was washed once with pre-chilled 75% ethanol, dried at room temperature, and finally dissolved in an appropriate amount of DEPC water. RNA concentration and purity were measured using a NanoDrop 2000 spectrophotometer and evaluated using the A260 / A280 ratio (absorbance at 260 nm (A260) / absorbance at 260 nm (A280) > 1.8 indicates high purity). All operations were performed using enzyme-free consumables and on ice or at 4°C to minimize RNA degradation. The following reverse transcription reaction system was prepared on ice: 50 ng - 1 μg All-in-One First-Strand Synthesis Master Mix 4 μL; dsDNase 1 μL; nuclease-free water to bring the total volume to 20 μL. The mixture was gently mixed and briefly centrifuged. The reaction system was then placed in a PCR instrument and reverse transcribed according to the following procedure: 37°C for 2 min; 55°C for 15 min; 85°C for 5 min. The obtained cDNA was placed on ice or immediately stored at -20°C for subsequent experiments. Prepare the following qPCR reaction system: 10-200 ng cDNA template; 10 μL F488 SYBR qPCR Mix; 0.4 μL forward primer (Fwd, 10 μM); 0.4 μL reverse primer (Rev, 10 μM); and bring the total volume to 20 μL with nuclease-free water. All primers were purchased from Sangon Biotech Co., Ltd., and their sequences are shown below.

[0077] Fasn-Fwd: GAGGGTGTGCCATTCTGTCA

[0078] Fasn-Rev: GCTATTCTCTACCGCTGGGG

[0079] β-actin-Fwd: GTGCTATGTTGCTCTAGACTTCG

[0080] β-actin-Rev: ATGCCACAGGATTCCATACC.

[0081] Place the prepared reaction system in a fluorescence quantitative detector and proceed with the reaction and detection according to the following procedure:

[0082]

[0083] The threshold cycle number (Cq value) of the target gene (Fasn) obtained after detection is first subtracted from the Cq value of the internal reference gene (β-ACTIN) of the sample to obtain the ΔCq value; then the ΔCq value of the intervention group is subtracted from the ΔCq value of the control group to obtain the ΔCq value; calculate 2. -ΔΔCq The value represents the relative expression level of the target gene in the intervention group compared to the control group.

[0084] The target silencing efficiency was verified using real-time PCR experiments, such as... Figure 4 B shows that comparing the target gene expression levels of the "LNP-siFasn group" and the "LNP-siNC group", the knockdown rate of the LNP-siFasn gene was higher than that of the LNP-siNC group.

[0085] Example 4: In vivo functional verification of nanomedicines

[0086] 1. Preparation of experimental animals: Ten 8-week-old female BALB / c mice (purchased from Hunan Slack Jingda Experimental Animal Co., Ltd.) were used. The mice were anesthetized by continuous inhalation of isoflurane. The donor mice were fixed on a surgical board, and cotton balls soaked in alcohol were applied to the abdomen of the mice with forceps. The abdominal cavity was cut open with ophthalmic scissors, the internal organs were moved to one side, and the inferior vena cava was exposed. Heparin solution was injected into the inferior vena cava. The fatty tissue covering the aorta was removed with forceps. The bifurcation of the middle ventricle was separated, electrocoagulated, and then cut with microscissors. The forceps were used to hold the heart and walk along the aorta. At the bifurcation of the aorta, a small space was separated with forceps. The forceps of the electrocoagulator were passed through the small space to electrocoagulate the intercostal artery until the appropriate length of blood vessel was separated. The vessel was then cut. The aorta was irrigated until there was no blood in the lumen. The irrigated aorta was cut in half with tissue scissors. Five segments were placed in a suspension of physiological saline containing LNP-siFasn, and five segments were placed in a suspension of physiological saline containing LNP-siNC. After soaking for 30-60 minutes, a change in the color of the blood vessel surface was observed. After anesthetizing the recipient mice, the neck skin was cut open to expose the carotid artery. The tissue surrounding the carotid artery was carefully separated. Both ends of the carotid artery were ligated with 8-0 suture, approximately 1 mm apart, and then cut in the middle with scissors. A nylon cannula was inserted onto the blood vessel, and one end was clamped with a hemostatic clamp. The scissors were then pressed against the ligated end of the blood vessel to make a clean cut. Residual blood in the blood vessel was flushed with heparin. Both ends of the blood vessel were held with fine microforceps, and the vessel was turned inside out and placed over the nylon cannula, then secured with 8-0 suture. Take an appropriate length of aorta, first loop the blood vessel onto the upper cannula, and tie it tightly with 8-0 suture. Similarly, loop the other end onto the lower cannula and tie it tightly. First loosen the upper hemostatic clamp, and after blood flow is restored, loosen the lower hemostatic clamp. Suture the skin with 5-0 suture.

[0087] 2. Two and four weeks after surgery (observe fluorescence entry at 2 weeks; observe silencing effect at 4 weeks), mice were anesthetized, and the transplanted blood vessels in the neck were exposed again to observe the morphology of the vessels (whether there is stenosis, thrombosis, or rupture). Both ends of the transplanted blood vessels were blocked with vascular clamps, and the transplanted blood vessel segments (including 1 cm of normal blood vessels at both ends) were completely separated. The surface bloodstains were rinsed with physiological saline. The transplanted blood vessels were fixed in 4% paraformaldehyde for 24 hours for flow cytometry sorting, immunofluorescence, and HE staining.

[0088] 3. Immunofluorescence detection: Frozen sections were thawed at room temperature for 20 min, permeabilized with 0.2% Triton 100 for 10 min, and blocked with 5% bovine serum albumin (BSA) at room temperature for 30 min. The blocking solution was discarded (without washing). The sections were washed three times with PBS. Fasn primary antibody (1:100 dilution), BODIPY (1:200), and F4 / 80 primary antibody (1:100) were added and incubated overnight at 4°C. The next day, the sections were washed three times with PBS for 5 min each time, and fluorescently labeled secondary antibody (1:200 dilution) was added. The sections were incubated at room temperature in the dark for 1 h. The sections were washed three times with PBS for 5 min each time, and DAPI staining solution (1:5000) was added. The sections were stained in the dark for 10 min, and residual staining solution was removed. The sections were mounted with an anti-fluorescence quencher, and the fluorescence intensity was observed and quantified using a laser confocal microscope. Based on the fluorescence results, it can be concluded that nanomedicines can enter macrophages and inhibit lipid synthesis. (e.g.) Figure 5 (As shown in AB and DE)

[0089] 4. Four weeks after vascular transplantation in mice, mice were anesthetized with sodium pentobarbital and disinfected. The intact transplanted vascular segment was isolated under a stereomicroscope. After washing three times with pre-cooled sterile PBS containing 1% penicillin-streptomycin, the entire vascular tissue was cut into pieces smaller than 1 mm³. Tissue digestion buffer containing collagenase I (2 mg / mL), hyaluronidase (1 mg / mL), and DNase I (20 μg / mL) was added. The tissue was incubated at 37°C for 15-20 min on a shaker at 100 rpm. Digestion was terminated with DMEM containing 10% FBS, and the cells were filtered through a 200-mesh cell sieve. Cells were collected by centrifugation at 300×g for 5 min at 4°C. The cells were washed once with flow cytometry staining buffer containing 2% FBS and 0.1% sodium azide, and then incubated on ice for 10 min with anti-mouse CD16 / 32 antibody to block Fc cells. Receptors were added, followed by incubation on ice for 30 min in the dark with a combination of fluorescent antibodies including APC-CD11b, PE-F4 / 80, FITC-CD3, and PerCP-Cy5.5-CD19. After washing twice with flow cytometry staining buffer, 7-aminoactinomycin D (7-AAD) at a final concentration of 1 μg / mL was added and incubated in the dark for 5 min. Cells were then sorted using a flow cytometer. Before sorting, single cell populations were identified by adjusting the FSC / SSC voltage using a blank control, and fluorescence compensation was adjusted using a single-stain control. 7-AAD cells were then identified sequentially. - Live cell population, excluding CD3 + T cells and CD19 + B cell population, ultimately sorted for CD11b + F4 / 80 +Macrophages were then analyzed, and flow cytometry sorting was performed on the macrophage populations. The results showed that LNP-siFasn significantly reduced the formation of Foam-like macrophages (MFs) compared to LNP-siNC. Figure 5 FG); tdT is separated by flow cytometry. + Macrophages, when subjected to q-PCR detection (same as in Example 3), showed that LNP-siFasn significantly reduced Fasn expression compared to LNP-siNC (e.g., Figure 5 C).

[0090] 5. HE staining for intimal thickening of transplanted blood vessels: Remove the blood vessel, wash three times with PBS for 5 minutes each time; immerse in 30% sucrose solution at 4°C overnight until the tissue completely settles (to prevent ice crystal formation during frozen sectioning). Pour an appropriate amount of OCT embedding medium into the embedding mold, place the dehydrated transplanted blood vessel in the center of the mold (cross-section facing upwards), and quickly freeze at -80°C; pre-cool the cryostat to -20°C, fix the embedding block on the cryostat, prepare 10μm thick continuous frozen sections, and attach them to a glass slide; store the sections in a -80°C freezer for later use, or immediately perform subsequent detection. Rinse sections with distilled water for 5 min to remove residual OCT; stain with hematoxylin for 5 min, rinse with tap water for 1 min; differentiate with 1% hydrochloric acid ethanol for 30 s, rinse with tap water for 5 min to return to blue; stain with eosin for 2 min, rinse with tap water for 1 min; gradient dehydration: 95% ethanol I (3 min), 95% ethanol II (3 min), 100% ethanol I (5 min), 100% ethanol II (5 min); xylene I (5 min), xylene II (5 min); mounting: mount with neutral resin, air dry in a fume hood. Observe under an upright microscope, and measure intimal thickness and thickening rate using ImageJ software. Based on the results, it can be concluded that nanomedicines can effectively inhibit intimal hyperplasia of transplanted vessels and reduce the neointima / media ratio (e.g., Figure 5 (As shown in HI).

[0091] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. Use of an agent that inhibits Fasn, characterized in that, Used to prepare drugs for the prevention and / or treatment of transplant vascular remodeling.

2. Use according to claim 1, characterized in that, The reagents for inhibiting Fasn include those that inhibit Fasn gene expression or Fasn protein.

3. Use according to claim 2, characterized in that, The reagents used to inhibit Fasn gene expression include siRNA.

4. Use according to claim 3, characterized in that, The siRNA sequence is as follows: Fwd: 5'-CUUUCUUCUUCGACUUCAAAG-3'; Rev: 5'-CUUUGAAGUCGAAGAAGAAAG-3'.

5. Use according to claim 3, characterized in that, The reagents for inhibiting Fasn gene expression also include drugs obtained by loading siRNA onto lipid nanoparticles (LNPs).

6. A medicament for preventing and / or treating graft remodeling, characterized by, The reagent comprising the Fasn inhibitor according to any one of claims 1-5.

7. Use of a reagent for detecting Fasn, characterized in that, Kits for preparing diagnostic tools for transplant vascular remodeling.

8. Use according to claim 7, characterized in that, The reagents for detecting Fasn include: PCR detection reagents, in situ hybridization detection reagents, or antibody detection reagents.

9. The application according to claim 8, characterized in that, The primer sequences for the PCR detection reagent are as follows: Fasn-Fwd: GAGGGTGTGCCATTCTGTCA; Fasn-Rev: GCTATTCTCTACCGCTGGGG.

Images