A method for constructing a mouse model of spontaneous recurrence of brain tumors
By injecting a specific viral vector and drug combination into the mouse brain, a spontaneous recurrence model of brain tumors in mice was constructed, which solved the problems of model microenvironment distortion and low recurrence rate in existing technologies, and realized an efficient platform for simulating glioblastoma recurrence and screening drugs.
Patent Information
- Application Number
- CN202610192441.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-10
- Publication Date
- 2026-05-26
AI Technical Summary
Existing technologies make it difficult to construct spontaneous mouse brain tumor models that can simulate the recurrence process of glioblastoma. Traditional methods are difficult to operate, have a high complication rate, distort the model microenvironment, and have a low recurrence rate, and cannot effectively simulate the recurrence process after surgical resection.
A mouse model of spontaneous brain tumor recurrence was constructed by injecting a specific viral vector containing a glial cell-specific promoter, a human Pdgfb gene, an iCasp9 suicide gene, and a p53-targeting shRNA into the mouse brain, combined with AP20187 drug to induce recurrence of residual tumor cells.
It achieved a 100% recurrence rate, demonstrated high model stability, and accurately simulated the tumor recurrence process after surgical resection. It overcame the selection pressure of suicide genes, increased the specific proportion of residual cells, and provided a reliable platform for screening anti-recurrence drugs.
Smart Images
Figure CN122081408A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of animal model technology, and in particular to a method for constructing a spontaneous recurrence model of brain tumors in mice. Background Technology
[0002] Glioblastoma is the most common primary malignant intracranial tumor in adults, characterized by high rates of disability, recurrence, and mortality. Experimental animal models are crucial tools for studying the mechanisms of brain tumor development and progression, and also important platforms for preclinical testing of new drugs and treatments. Mouse brain tumor models include subcutaneous transplanted tumor models, orthotopic transplanted brain tumor models, and spontaneously generated mouse brain tumor models. Spontaneous mouse brain tumor models better simulate the process of tumor development and progression, and better mimic the tumor immune microenvironment, making them an important research platform for laboratory research and preclinical trials of brain tumors. Methods for constructing spontaneously generated mouse brain tumor models using genetic engineering fall into two categories: one uses transgenic mice, such as Nestin-cre;NF1. flox / flox TP53 flox / flox PTEN flox / flox Another method involves spontaneous tumor formation in mice, or tumor formation by injecting a viral vector carrying an oncogene sequence into the mouse brain. While spontaneous mouse brain tumor models effectively mimic primary glioblastoma, there are no reports of spontaneous mouse brain tumor recurrence models for recurrent glioblastoma.
[0003] Postoperative recurrence of glioblastoma (GBM) is the main cause of clinical treatment failure. A good recurrent glioblastoma model is an important foundation for exploring the recurrence mechanism of glioblastoma and developing drugs to inhibit tumor recurrence. The traditional method of constructing an animal model of recurrent glioblastoma first requires the construction of a mouse orthotopic transplantation model, and then the mice undergo craniotomy to remove part of the brain tumor or control tumor growth through radiotherapy. The continued growth of the residual tumor is considered tumor recurrence. There are two major defects in the existing technology: (1) The orthotopic transplantation brain tumor model cannot simulate the natural occurrence process of brain tumors. Its tumor microenvironment is different from that of patients in clinical practice. In contrast, the spontaneous glioblastoma model can better simulate the natural occurrence process of brain tumors. Its tumor microenvironment is less different from that of patients in clinical practice. In the process of drug development, the use of spontaneous glioblastoma models can better predict the clinical effectiveness of innovative drugs or treatment plans. (2) The traditional method of surgically removing mouse brain tumors is difficult to operate, with a high incidence of mouse complications and a high mortality rate. Moreover, it is impossible to control the degree of surgical resection, making it difficult to guarantee the reliability and reproducibility of experimental results. The method of constructing a recurrent brain tumor model by irradiating mouse brain tumors with radiotherapy is limited by the side effects of radiotherapy—radiation damage to the brain. Irradiation doses exceeding 12 Gy generally lead to cognitive dysfunction in mice, but 12 Gy irradiation doses generally cannot shrink mouse brain tumors. (1) Transgenic spontaneous model: The tumor formation cycle is long (6-12 months) and cannot simulate recurrence (Hambardzumyan et al., NatProtoc 2015).
[0004] (2) Orthotopic transplantation model: The tumor microenvironment is distorted and the recurrence rate is <5% (Marumoto et al., Sci Rep2016).
[0005] (3) Suicide gene therapy: The design goal is to completely eliminate the tumor (Spencer et al., Neuro-Oncology 2015).
[0006] The limitations of existing animal models for recurrent glioblastoma severely restrict preclinical research and trials. To address these shortcomings, it is necessary to develop a method for constructing a spontaneous mouse model of brain tumor recurrence. Summary of the Invention
[0007] The purpose of this invention is to provide a method for constructing a spontaneous recurrence model of brain tumors in mice, which has the advantages of simple operation, short modeling time, high model stability, and low cost.
[0008] To achieve the aforementioned objective, the present invention adopts the following technical solution: In a first aspect of the present invention, a method for constructing a mouse model of spontaneous recurrence of brain tumors is provided, the method comprising: Inject a viral vector with a nucleotide sequence as shown in SEQ ID NO:1 into the brain of mice; After the tumor formed, AP20187 was injected, and the in situ recurrence of residual cells was monitored for 14-21 days to obtain a mouse model of spontaneous brain tumor recurrence.
[0009] Furthermore, the mice include either male C57BL / 6 or male BALB / c mice. Generally, any genotype of male / female mouse can be used; other types such as rats, pigs, or monkeys may also develop tumors. Only C57BL / 6 is used for verification here.
[0010] Furthermore, the carrier comprises: Glial cell-specific promoter GfaABC1D; A fusion gene formed by linking the human Pdgfb gene and the iCasp9 suicide gene via a P2A peptide; And shRNAs that target p53.
[0011] Furthermore, the nucleotide sequence of the glial cell-specific promoter GfaABC1D is shown in SEQ ID NO.2.
[0012] Furthermore, the nucleotide sequence of the fusion gene formed by linking the human Pdgfb gene and the iCasp9 suicide gene through the P2A peptide is shown in SEQ ID NO.3.
[0013] Furthermore, the shRNA targeting P53 is expressed via the miR30 backbone, and its target sequence is shown in SEQ ID NO.4.
[0014] Furthermore, the injection concentration of AP20187 is 1-2 mg / kg mouse body weight.
[0015] In a second aspect of the invention, a mouse model of spontaneous recurrence of brain tumors is provided, which is constructed by the method described above.
[0016] In a third aspect of the invention, the application of a spontaneous mouse model of brain tumor recurrence in screening drugs for glioblastoma recurrence is provided.
[0017] Furthermore, in the screening process, a drug screening group and a model control group are set up using the mouse spontaneous brain tumor recurrence model. The therapeutic effect of the candidate drugs is evaluated by comparing the two groups.
[0018] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages: 1. The present invention provides a method for constructing a spontaneous recurrence model of brain tumor in mice. When the clearance rate is strictly controlled at 92-97%, the recurrence rate is 100% (if it exceeds this range, the recurrence rate drops sharply to <10%). shRNA (P53) increases the proportion of residual cells with OCT4+ by 3.5 times (p<0.001), overcoming the selection pressure of suicide genes. It solves the long-standing technical problem of "how to simulate surgical resection and recurrence". Prior to this invention, there was a lack of animal models in the field capable of simulating the recurrence process after surgical resection. Transplantation models could not simulate surgical residue, and transgenic models could not control the timing and extent of resection.
[0019] This invention creatively utilizes the combination of the "iCasp9 suicide gene system + low-dose inducer" to reverse the traditional approach of using a treatment technique originally intended for the complete eradication of tumors, applying it to the controlled and partial removal of tumors, thus mimicking surgical resection. This represents a fundamental shift in the application of the technology.
[0020] 2. Unexpected technical effects were produced: While those skilled in the art could anticipate that suicide genes could kill tumors, they could never have foreseen that by precisely controlling the degree of killing and combining it with specific gene modification (shP53), an animal model that was 100% and stably induced to closely resemble clinical recurrence in terms of time, location, and pathological characteristics could be generated. This effect of "100% recurrence rate" and "perfect simulation of clinical characteristics" significantly exceeded expectations. Attached Figure Description
[0021] Figure 1 A map of the construction of viral vectors provided in embodiments of the present invention: pcSLenti-pA-iCasp9-F2A-Luc2-CMV-EF1-EGFP-P2A-Puro-WPRE.
[0022] Figure 2 This is a schematic diagram of a mouse model of spontaneous recurrence of brain tumors.
[0023] Figure 3 This is a plasmid map of lentivirus 1 in Comparative Example 1.
[0024] Figure 4 The plasmid map of Lentiviral 2 in Comparative Example 1 is shown.
[0025] Figure 5 The image shows the pcSLenti-CMV-Efgr-P2A-Cre-miR30shRNA(Cdkn2a)-WPRE plasmid in Comparative Example 3. Detailed Implementation
[0026] The following detailed description of the embodiments and examples will illustrate the present invention in more detail, thereby making the advantages and various effects of the embodiments more clearly apparent. Those skilled in the art should understand that these detailed embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present invention.
[0027] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the embodiments of this invention pertain. In the event of any conflict, this specification shall prevail.
[0028] Unless otherwise specified, all raw materials, reagents, instruments, and equipment used in the embodiments of this invention can be obtained through commercial purchase or by existing methods. The CAS number of AP20187 in this embodiment is 195514-63-7, and its full name is (E)-1-(4-(4-chlorophenoxy)phenyl)-3-(4-(1,1-dimethylethyl)phenyl)-1,1,1-trifluoropropane-2-one-2-ol, with the molecular formula C2. 28 H 32 ClF3N2O3 has a molecular weight of 537.02 g / mol.
[0029] The following will provide a detailed description of a spontaneous recurrence model of mouse brain tumors and its construction method, in conjunction with embodiments and experimental data.
[0030] Example 1: Method for constructing a mouse model of spontaneous recurrence of brain tumors I. Construction Method 1. Construct a tool virus to induce spontaneous recurrence of brain tumors in mice.
[0031] Constructing the plasmid structure of virus 1: The sequencing sequence of pAAV-GfaABC1D-Pdgfb-P2A-iCasp9-T2A-EGFP-miR30shRNA(P53)-tWPA is shown in SEQ ID NO.1.
[0032] The plasmid information is as follows: Table 1 - Sample Information for H32007 Plasmid Instructions
[0033] 2. Stereotactic injection of 1 μL of virus (titer 10¹³ v.g. / ml) into the caudate nucleus of mice; experimental group (virus 1): 20 mice; control group (PBS injection): 10 mice.
[0034] 3. On day 30, the first batch of mice were sacrificed, and brain tissue was taken for HE staining. Tumor formation was observed in the mouse brain. 4. Starting on day 42, mice were injected intraperitoneally with AP20187 at a dose of 1 mg / kg for 5 consecutive days to induce the activation of iCasp9 and induce tumor cell apoptosis. 5. On day 50, the second batch of mice were sacrificed, and brain tissue was taken for HE staining. Necrosis and tumor clearance of the mouse brain tumors were observed. 6. On day 57, the third batch of mice were sacrificed, and brain tissue was taken for HE staining. Recurrence of brain tumors was observed in the mice.
[0035] Experimental group (virus 1): 20 animals Table 2
[0036] II. Results Stereotactic injection of 1 μL virus (titer 10) 13 AP20187 (vg / ml) was injected into the caudate nucleus of mice. On day 30, the first batch of mice was sacrificed, and brain tissue was collected for HE staining. Tumor formation was observed in the mouse brain, and green fluorescent markers carried by the virus were observed in the tumors under a fluorescence microscope. Starting from day 42, mice were injected intraperitoneally with AP20187 at a dose of 1 mg / kg for 5 consecutive days to induce the activation of iCasp9 and induce tumor cell apoptosis. On day 50, the second batch of mice was sacrificed, and brain tissue was collected for HE staining. Necrosis and tumor clearance of mouse brain tumors were observed. On day 57, the third batch of mice was sacrificed, and brain tissue was collected for HE staining. Recurrence of mouse brain tumors was observed.
[0037] Comparative Example 1: Failure of Lentiviral Combination Injection Regimen 1. Lentiviral 1: pLenti-GfaABC1D-Cre-3xFLAG-miR30R30shRNA(NF1)-miR30shRNA(P53)-WPRE (See diagram) Figure 3 (The sequence is shown in SEQ ID NO.5), and the plasmid information is as follows: Table 3 - Sample Information for H29679 Plasmid Specification
[0038] 2. Lentiviral 2: pLenti-CMV-DIO-iCasp9-P2A-EGFP-WPRE (see diagram) Figure 4 (The sequence is shown in SEQ ID NO.6), and the plasmid information is as follows: Table 4 - Sample Information for Plasmid H30416
[0039] 3. The combined injection of lentivirus 1 and lentivirus 2 failed to induce tumor formation. Comparative Example 2: One-step lentivirus construction failed Attempts to construct the plasmid pcSLenti-CMV-Efgr-P2A-Cre-miR30shRNA(Cdkn2a)-WPRE failed during the construction process.
[0041] Efgr-P2A-Cre-miR30shRNA (Cdkn2a), 5057bp Vector: GL194 pcSLenti-CMV-EGFP-3xFLAG-WPRE Cdkn2a target: CGCTCTGGCTTTCGTGAACAT After construction, the sequence of pcSLenti-CMV-Efgr-P2A-Cre-miR30shRNA(Cdkn2a)-WPRE is shown in SEQ ID NO.7. Comparative Example 3: Kras as an alternative to Pdgfb adenovirus regimen failed. Constructing pAAV-GfaABC1D-Kras-P2A-iCasp9-T2A-EGFP-miR30shRNA(P53)-tWPA adenovirus (see diagram) Figure 5 The plasmid information is shown in the table below (the sequence is shown in SEQ ID NO.8). No tumor formation was observed within 60 days after injection.
[0043] Table 5 - Sample Information for H32006 Plasmid Instructions
[0044] Comparison of results from Experimental Example 1, the Example, and the Comparative Example Key data comparisons are listed below.
[0045] Table 6
[0046] From the above, we can see that: This application achieved a 100% tumor formation rate (20 / 20 mice); while the control protocols all failed.
[0047] This application is the first to simulate the entire process of postoperative recurrence of glioblastoma, providing a 100% reproducible preclinical model for the development of anti-recurrence drugs.
[0048] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.
[0049] Although preferred embodiments of the present invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the present invention.
[0050] Obviously, those skilled in the art can make various modifications and variations to the embodiments of the present invention without departing from the spirit and scope of the embodiments of the present invention. Thus, if these modifications and variations to the embodiments of the present invention fall within the scope of the claims of the embodiments of the present invention and their equivalents, the embodiments of the present invention are also intended to include these modifications and variations.
Claims
1. A method for constructing a mouse model of spontaneous recurrence of brain tumors, characterized in that, The method includes: Inject a viral vector with a nucleotide sequence as shown in SEQ ID NO:1 into the brain of mice; After the tumor formed, AP20187 was injected, and the in situ recurrence of residual cells was monitored for 14-21 days to obtain a mouse model of spontaneous brain tumor recurrence.
2. The method for constructing a spontaneous recurrence model of brain tumor in mice according to claim 1, characterized in that, The carrier comprises: Glial cell-specific promoter GfaABC1D; A fusion gene formed by linking the human Pdgfb gene and the iCasp9 suicide gene via a P2A peptide; And shRNA that targets p53.
3. The method for constructing a spontaneous recurrence model of brain tumor in mice according to claim 2, characterized in that, The nucleotide sequence of the glial cell-specific promoter GfaABC1D is shown in SEQ ID NO.
2.
4. A method for constructing a spontaneous recurrence model of brain tumor in mice according to claim 2, characterized in that, The nucleotide sequence of the fusion gene formed by linking the human Pdgfb gene and the iCasp9 suicide gene via the P2A peptide is shown in SEQ ID NO.
3.
5. A method for constructing a spontaneous recurrence model of brain tumor in mice according to claim 2, characterized in that, The shRNA targeting P53 is expressed via the miR30 backbone, and its target sequence is shown in SEQ ID NO.
4.
6. The method for constructing a spontaneous recurrence model of brain tumor in mice according to claim 1, characterized in that, The male mice were selected from either male C57BL / 6 or male BALB / c mice.
7. The method for constructing a spontaneous recurrence model of brain tumor in mice according to claim 1, characterized in that, The injection concentration of AP20187 is 1-2 mg / kg mouse body weight.
8. A mouse model of spontaneous recurrence of brain tumors constructed by any one of the methods described in claims 1-7.
9. The application of a spontaneous recurrence model of mouse brain tumors as described in claim 8 in screening drugs for glioblastoma recurrence.
10. The application according to claim 9, characterized in that, In the screening process, a drug screening group and a model control group were set up using the spontaneous recurrence mouse brain tumor model as described in claim 8. The therapeutic effect of the candidate drug was evaluated by comparing the two groups.