Application of kynu gene or kynureninease kynu as anxiolytic therapy target

By targeting the Kynu gene or its encoded protein KYNU, inhibitors have been developed to treat anxiety disorders, addressing the shortcomings of existing treatments, achieving effective prevention and relief of anxiety disorders, and providing a new direction for treatment.

CN122097594APending Publication Date: 2026-05-29HUBEI UNIV OF TECH
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-27
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing medications for anxiety disorders have problems such as slow onset of action, easy development of drug tolerance, addiction, rebound after discontinuation, and various side effects. In addition, many patients do not respond to existing drug treatments.

Method used

Utilizing the Kynu gene or kynurinase KYNU as a target, drugs for the prevention, relief, and/or treatment of anxiety disorders can be developed by blocking or affecting the expression and activity of KYNU through inhibitors such as gene-editing therapeutics, antisense nucleotides, siRNA, shRNA, miRNA, compounds, proteins, antibodies, and enzymes.

Benefits of technology

It provides new treatment ideas for the effective prevention, relief and/or treatment of anxiety disorders, clarifies the link between KYNU and anxiety disorders, and reduces the risk of side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122097594A_ABST
    Figure CN122097594A_ABST
Patent Text Reader

Abstract

The application belongs to the field of anxiety prevention and treatment, and particularly relates to application of Kynu gene or kynureninease KYNU as an anxiety treatment target. The Kynu gene or its encoded protein kynureninease can be used as a target to prevent, alleviate and / or treat anxiety, and an inhibitor of the Kynu gene or its encoded protein kynureninease KYNU can be used to prepare or screen a drug for preventing, alleviating and / or treating anxiety. The application explains the interaction between the kynureninease protein KYNU and anxiety, and through inhibition of Kynu gene expression, the correlation between KYNU and anxiety is determined, that is, inhibition of KYNU expression can effectively prevent, alleviate and / or treat anxiety, thereby providing a new research idea and direction for clinical treatment of anxiety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of anxiety disorder prevention and treatment, and specifically relates to the application of the Kynu gene or kynurinase KYNU as a therapeutic target for anxiety disorder. Background Technology

[0002] Anxiety disorder is one of the most common mental disorders worldwide, with main clinical symptoms including anxiety, worry, fear, dread, tension, and autonomic nervous system dysfunction. Anxiety disorder not only severely impairs an individual's psychological, occupational, and social functioning but also imposes a long-term economic burden on families and society. Currently, clinical treatment for anxiety disorder mainly relies on psychotherapy and medication. However, the effectiveness of psychotherapy is often limited, while existing drug treatments suffer from slow onset of action, easy development of drug tolerance, addictive potential, rebound effects after discontinuation, and various side effects. Furthermore, many patients do not respond to existing drug treatments; therefore, the development of new drugs for treating anxiety disorder is urgently needed.

[0003] Kynureninase (KYNU) is a hydrolase encoded by the Kynu gene. As a key rate-limiting enzyme in the kynurenine metabolic pathway, it is expressed in almost all organs of the body, with particularly high expression levels in the liver, bladder, and appendix. Existing research indicates that KYNU activity is closely related to the occurrence and development of various diseases. KYNU participates in various inflammatory and cardiovascular diseases, as well as several types of cancer, through different pathways. Therefore, drug development targeting the kynurenase protein holds potential application prospects in the fields of inflammation, immunity, and oncology.

[0004] However, there are currently no research reports on using KYNU as an intervention target for the treatment of anxiety disorders, and its specific role in the pathogenesis of anxiety disorders and its potential as a therapeutic target remain unclear. Therefore, in-depth research on its structure and function will help to more clearly reveal the regulatory mechanism of the kynurinase pathway and provide new ideas and methods for drug development and clinical diagnosis of anxiety disorders. Summary of the Invention

[0005] The purpose of this invention is to address the problems of existing anxiety disorder treatments, such as ineffectiveness, slow onset of action, easy development of drug resistance, addictiveness, easy rebound after drug withdrawal, and various side effects, and to provide an application of the Kynu gene or kynurinase KYNU as a therapeutic target for anxiety disorders.

[0006] In a first aspect, the present invention provides the use of the Kynu gene or its encoded protein kynurinase KYNU as a target in screening or preparing drugs for the prevention, relief and / or treatment of anxiety disorders.

[0007] Preferably, the drug comprises an inhibitor of the Kynu gene or kynurinase KYNU.

[0008] In a second aspect, the present invention provides the use of an inhibitor of the Kynu gene or its encoded protein kynurinase KYNU in the preparation of drugs for the prevention, relief and / or treatment of anxiety disorders.

[0009] Preferably, the inhibitor comprises at least one of the following: gene-editing therapeutic agents that block the normal transcription or post-transcriptional translation of the Kynu gene; antisense nucleotides; siRNA; shRNA; and miRNA; or at least one of the following: compounds, proteins, antibodies, and enzymes that affect the stability, expression level, activity, or function of kynurinase protein.

[0010] Preferably, the inhibitor comprises a recombinant vector targeting the Kynu gene, and the expression vector comprises a plasmid vector, a granular vector, a phage vector, or a viral vector.

[0011] Preferably, the inhibitor is adenovirus pAAV-U6-shKynu-CMV-mCherry-WPRE.

[0012] Preferably, the adenovirus is an shRNA vector system that continuously expresses shRNA targeting the Kynu gene to achieve specific knockdown of the gene.

[0013] Preferably, the nucleotide sequence of the Kynu gene is as shown in SEQ ID NO:1 or is a nucleic acid that encodes a protein with KYNU enzyme activity by substitution, deletion or addition of one or more nucleotides in the sequence shown in SEQ ID NO:1; the Kynu gene is a predictive mRNA transcript and has not yet been fully verified by cloning experiments.

[0014] The amino acid sequence of the kynurinase KYNU is shown in SEQ ID NO:2, or is a protein that still has kynurinase activity after one or more amino acids have been substituted, deleted, or added to the amino acid sequence shown in SEQ ID NO:2.

[0015] Preferably, the anxiety disorder is caused by a deletion of the EXOSC9 gene.

[0016] Thirdly, the present invention provides a kit for screening drugs for the prevention, relief and / or treatment of anxiety disorders, characterized in that it contains reagents for detecting the expression level or activity of the Kynu gene or its encoded protein kynurinase KYNU.

[0017] Fourthly, the present invention provides a medicament for the prevention, relief and / or treatment of anxiety disorders, characterized in that it comprises an inhibitor of the Kynu gene or its encoded protein, kynurinase KYNU.

[0018] Preferably, the drug further includes a pharmaceutically acceptable carrier.

[0019] Compared with the prior art, the present invention has the following advantages: This invention elucidates the interaction between the kynurinase protein KYNU and anxiety disorder. By inhibiting the expression of the Kynu gene, the association between KYNU and anxiety disorder is clarified, namely, inhibiting KYNU expression can effectively prevent, alleviate and / or treat anxiety disorder.

[0020] This invention demonstrates that inhibitors of the Kynu gene or its encoded protein, kynurinase KYNU, can help prevent, improve, or salvage anxiety disorders. It proposes new uses for screening or preparing drugs to alleviate and / or treat anxiety disorders by targeting the Kynu gene or KYNU inhibition, which has significant scientific and clinical value and provides a new research idea and direction for the clinical treatment of anxiety disorders. Attached Figure Description

[0021] Figure 1 This is a Western blot result showing the expression level of kynurinase (KYNU) in Example 1. Figure 2 This is a statistical graph showing the expression results of kynurinase (KYNU) in Example 1. Figure 3 This is a graph showing the results of the Kynu gene mRNA level detection in Example 1; Figure 4 This is a schematic diagram of virus injection into the DG region of the mouse hippocampus in Example 2; Figure 5 This is a Western blot image showing the expression level of kynurinase KYNU after viral injection in Example 2. Figure 6 This is a statistical graph showing the expression results of kynurinase KYNU after virus injection in Example 2; Figure 7 This is a statistical graph showing the center dwell time in the mouse open field test in Example 3; Figure 8 This is a statistical graph showing the dwell time in the illuminated area during the mouse black-and-white box test in Example 3; Figure 9 This is a statistical chart showing the number of times mice entered the elevated cross maze, their dwell time, and the percentage of entries during the test in Example 3. Detailed Implementation

[0022] To better understand the present invention, the following embodiments are further illustrations of the present invention, but the content of the present invention is not limited to the following embodiments.

[0023] Unless otherwise specified, the experimental methods used in the embodiments of this invention are all conventional methods. The reagents and materials used in the embodiments are all commercially available, and the quantitative experiments involved in the embodiments are all performed in at least three replicates.

[0024] All mice used were purchased from Shulaibao (Wuhan) Biotechnology Co., Ltd., and were C57BL / 6 strain, 7-week-old males weighing 20-22 g. The anxiety-prone mice were constructed by the company using CRISPR / Cas9 gene editing technology to knock out the EXOSC9 gene; the nucleotide sequence of the EXOSC9 gene is shown in SEQ ID NO:3. After purchase, the mice were housed at the School of Life Sciences and Health Engineering, Hubei University of Technology. The lighting time in the mouse housing was 7:00 am to 7:00 pm, the ambient temperature was 24℃, and the humidity was 50±10%. The animals were provided with free access to food and water during the rearing process.

[0025] Example 1: Increased expression of kynurinase (KYNU) in anxious mice. Normal control mice (hereinafter referred to as the WT group) and anxiety-prone mice constructed by knocking out the EXOSC9 gene (hereinafter referred to as the Het group) were subjected to the detection of kynurinase KYNU and Kynu mRNA expression levels, with at least 3 biological replicates for each group. The nucleotide sequence of the Kynu gene is shown in SEQ ID NO:1; the amino acid sequence of kynurinase KYNU is shown in SEQ ID NO:2.

[0026] 1. Perfusion and brain tissue separation and dissection Connect the perfusion kit to the perfusion needle and empty the tubing; pre-cool the saline and paraformaldehyde; prepare all surgical instruments. Take mice from the WT and Het groups respectively, and inject 1% sodium pentobarbital into the peritoneum. Anesthesia is confirmed to be successful when the mice stop struggling and show no pain reflex when pinching their toes. Fix the anesthetized mice on the perfusion platform, and use scissors to cut along the abdomen to expose the ribs; cut the diaphragm, and cut the thoracic cavity from the left rib until the heart is exposed, then turn the ribs back.

[0027] Gently grasp the heart with forceps and insert a needle into the left ventricle; locate the right atrial appendage and cut it open. After blood flows out, start the peristaltic pump for perfusion. First, perfuse with about 100 mL of physiological saline. Observe the liver change from dark red to white, indicating successful perfusion. If it is to be used for subsequent tissue immunofluorescence staining, perfuse with paraformaldehyde to fix the tissue.

[0028] After perfusion, the mouse skull was cut open and removed, and the intact brain tissue was extracted and soaked in ice-cold physiological saline for about 2 minutes. Referring to the mouse brain atlas, the target brain regions (hippocampus and striatum) were isolated, placed in RNase-free EP tubes, frozen in liquid nitrogen, and then transferred to a -80°C freezer for storage.

[0029] 2. Protein extraction 2.1 Protein extraction and sample preparation Based on the total number of samples to be tested, a protein extraction solution was prepared at a volume ratio of RIPA lysis buffer, 1×PMSF, 100×protease inhibitor, and 50×phosphatase inhibitor of 96:1:1:2. The mixture was thoroughly mixed and placed on ice for later use. The hippocampal tissue obtained in step 1 was weighed, and the protein extraction solution was added at a ratio of tissue mass (mg) to protein extraction solution volume (μL) of 1:10. The mixture was then sonicated under ice bath conditions. The sonication parameters were: 2 seconds on, 3 seconds off, total duration 2 minutes, and power 16%. The lysed tissue protein extract was allowed to stand on ice for 10 minutes, followed by centrifugation at 12000 g for 15 minutes at 4°C. The supernatant was transferred to a 1.5 mL centrifuge tube to obtain the hippocampal tissue protein sample.

[0030] 2.2 BCA method for detecting protein concentration Dissolve 30 mg bovine serum albumin (BSA) in 1.2 mL of protein standard preparation solution and mix thoroughly to obtain a protein standard solution with a concentration of 25 mg / mL; further dilute to 2 mg / mL before use. Prepare BCA working solution by mixing BCA reagent A and reagent B at a volume ratio of 50:1. Add 0, 2, 4, 6, 8, 10, 16, and 20 μL of the above protein standard solution sequentially to a 96-well plate, and bring the volume up to 20 μL per well with phosphate-buffered saline (PBS). Add the hippocampal tissue protein sample obtained in step 2.1 to a volume of 20 μL per well using the same method. Add 200 μL of BCA working solution to each well and incubate at 37°C for 30 min. Measure the absorbance of each well at 545 nm using a microplate reader. Calculate the protein concentration of each sample based on the standard curve.

[0031] 3. RNA extraction The entire procedure was performed on ice. Approximately 30 mg of hippocampal tissue sample obtained in step 1 was weighed and placed in a sterile centrifuge tube. 1 mL of TRIzol lysis reagent was added, and the sample was sonicated using an ultrasonic cell homogenizer until the tissue was completely homogenized and free of visible lumps. After sonication, the sample was incubated on ice for 5 min.

[0032] Centrifuge the above tissue homogenate at 4°C and 12000 g for 5 min, and collect the supernatant. Transfer 800 μL of the supernatant to a new centrifuge tube, add 200 μL of chloroform, and slowly invert the tube for about 15 s until the solution turns milky white. Incubate the mixture on ice for 5 min, and then centrifuge at 4°C and 12000 g for 15 min to allow the solution to separate into two layers.

[0033] Transfer 400 μL of the colorless aqueous phase from the top to a new centrifuge tube, add an equal volume of pre-chilled isopropanol, mix by inverting, and incubate on ice for 10 min. Then centrifuge at 4°C and 12000 g for 15 min. Discard the supernatant, retaining the RNA precipitate at the bottom of the tube. Add 1 mL of 75% ethanol solution prepared with DEPC-treated water, and vortex to wash the precipitate. Centrifuge at 4°C and 12000 g for 5 min.

[0034] Remove the liquid from the tube and place the centrifuge tube on ice to dry. Add 30 µL of RNase-free water to dissolve the precipitate, obtaining an aqueous RNA solution. Determine the RNA concentration and purity using a micro spectrophotometer, and dilute the final concentration to 500 ng / µL based on the results.

[0035] 4. Western blot experiment Preparation of protein samples for Western blot (WB) experiments: Take an appropriate amount of hippocampal tissue protein sample extracted in step 2.1, add 5×SDS loading buffer at a ratio of 4:1, mix thoroughly, heat in a 95℃ metal bath for 10 min, and then cool on ice to room temperature to obtain the protein samples for WB experiments. Store in a -20℃ freezer.

[0036] SDS-PAGE gel preparation: Take a clean, dry gel glass plate assembly (including large and small glass plates) with a thickness of 1 mm, embed it into the gel casting clamp, and secure it to prevent leakage, ensuring the bottom is flat. Prepare the separating gel and stacking gel using a one-step polyacrylamide (PAGE) gel rapid preparation kit (10% and 12.5%). Pipette 2.7 mL of the lower gel buffer and lower gel solution, mix, add 60 µL of modified coagulant, mix well, and immediately pour into the glass plate interlayer, controlling the liquid level so that it is at least 0.5 cm below the upper edge of the short glass plate. Pipette 0.75 mL of the upper gel buffer and upper gel solution, mix, add 15 µL of modified coagulant, mix well, and immediately pour onto the separating gel surface until it completely covers the upper edge of the short glass plate. Insert the sample comb vertically, ensuring a smooth and slow insertion process to avoid air bubbles. After the gel has completely solidified, carefully remove the sample comb, add the sample, and perform electrophoresis.

[0037] Sample loading and electrophoresis: Heat the preserved Western blot protein samples in a 100°C constant-temperature metal bath for 5 min, vortex for 30 s, and then centrifuge for 10 s to ensure thorough mixing. Based on the protein concentration detected in step 2.2, adjust the protein concentration of each sample to be consistent using 1×SDS loading buffer. Add an appropriate amount of sample to the gel wells for electrophoresis. First, electrophoresis is performed at a constant voltage of 80 V until the pre-stained protein markers clearly separate into layers. Then, the voltage is adjusted to 120 V and electrophoresis continues until the bromophenol blue indicator migrates to the bottom edge of the gel and is about to detach. Electrophoresis is then terminated.

[0038] Transfer: Activate the PVDF membrane with methanol. Thoroughly wet the transfer aids, such as the sponge pad and filter paper, in the tray using transfer buffer. Assemble the transfer sandwich structure from bottom to top in the following order: black clamp - sponge pad - filter paper - polyacrylamide gel - PVDF membrane - filter paper - sponge pad - transparent clamp, ensuring tight adhesion between the gel and membrane. Use a rolling or gentle pressing method to thoroughly remove air bubbles between the two layers. After fixing the assembled transfer clamp, place it in the transfer tank and perform transfer under a constant current of 275 mA. The transfer time should be adjusted adaptively according to the molecular weight of the target protein.

[0039] Blocking: Prepare the blocking solution by mixing skim milk powder and TBST buffer at a mass-to-volume ratio of 1 g: 20 mL, and vortex thoroughly until completely dissolved. Pour the blocking solution into the incubation chamber beforehand. After transfer, remove the PVDF membrane, cut and label the gel according to the target protein molecular weight range, and immediately immerse the PVDF membrane in the blocking solution to prevent the membrane surface from drying out. Place the incubation chamber on a shaker at room temperature and gently shake for 30 min. After blocking, rinse three times with TBST buffer for 5 s each time to remove any residual blocking agent on the surface.

[0040] Primary antibody incubation: After blocking and washing the PVDF membrane, add the appropriate primary antibody dilution buffer and incubate overnight at 4°C with gentle shaking on a shaker. The next day, recover the primary antibody dilution buffer and wash the PVDF membrane three times rapidly with TBST buffer on a shaker at room temperature for 10 min each time.

[0041] Secondary antibody incubation: Add the PVDF membrane to the secondary antibody dilution buffer and incubate for 1 h at room temperature with gentle shaking on a shaker. After incubation, recover the secondary antibody dilution buffer and wash the PVDF membrane three times for 10 min each time using TBST buffer on a shaker at room temperature.

[0042] Development and grayscale analysis: After washing, the PVDF film was immersed in ECL chemiluminescent solution for a few seconds, then removed and placed in the developing instrument for imaging and photographing. The resulting bands were then analyzed for grayscale values ​​using ImageJ.

[0043] Test results as follows Figure 1 As shown, the kynurin content in the Het group was significantly higher than that in the WT group; the Tubulin content was similar, indicating that the loading amount was uniform, the protein extraction and transfer efficiency were the same, the internal control was effective, and the results were reliable; the kynurin expression level in the Het group was significantly higher than that in the WT group.

[0044] 5. Quantitative PCR Reverse transcription: Add the following components sequentially to a PCR tube: 5 µL of 4×All-in-one-qRT SuperMix (purchased from Wuhan Aiboteke Biotechnology Co., Ltd.), 1 µL of Enzyme Mix, 12 µL of ribonuclease-free ddH2O, and 2 µL of the RNA to be tested obtained in step 2. After mixing, place the tube in a PCR instrument for reverse transcription. The reaction program is set as follows: incubation at 37°C for 2 min, followed by incubation at 55°C for 15 min, and finally incubation at 85°C for 5 min to obtain cDNA.

[0045] PCR amplification: Following the formula, add 10 µL of 2×Taq Pro Universal SYBR qPCR Master Mix (purchased from Wuhan Aiboteke Biotechnology Co., Ltd.), 0.4 µL each of the forward primer qPCR-KYNU-F (10 µM) and the reverse primer qPCR-KYNU-R (10 µM), 5.2 µL of ddH2O, and 4 µL of the reverse transcribed cDNA. After mixing, place in a PCR instrument for amplification. The amplification conditions were set as follows: 95℃ pre-denaturation for 30 s; followed by 40 cycles of amplification reaction, each cycle including 95℃ denaturation for 10 s and 60℃ extension for 30 s. The sequence of the forward primer qPCR-KYNU-F is shown in SEQ ID NO:4, and the sequence of the reverse primer qPCR-KYNU-R is shown in SEQ ID NO:5.

[0046] mRNA expression results calculation: After amplification, fluorescence signals from each reaction well were acquired using the instrument's software, and the cycle threshold (Ct value) was automatically read. The mRNA expression level of the target gene was calculated using a relative quantitative analysis method, specifically the 2-ΔΔCT method: the Ct value of the target gene in the test sample and the control group was subtracted from the Ct value of the internal reference gene in the same sample to obtain the ΔCt value; the difference between the ΔCt values ​​of the experimental group and the control group (ΔΔCt) was further calculated. The final results were expressed as 2... (-ΔΔCt) This indicates the relative fold change in the expression of the target gene compared to the control group.

[0047] 6.t detection The protein grayscale values ​​and mRNA2 obtained in steps 4 and 5 are compared. (-ΔΔCt) The values ​​were entered into GraphPad Prism 10.1.2 (GraphPad Software, USA) for data analysis. The Shapiro-Wilk test was used to verify the normality of the data. For two independent sample groups, an unpaired Student's t-test was used to analyze the significance of differences between groups. All experimental results are expressed as mean ± standard deviation (Mean ± SD), and the statistical significance level was set at α = 0.05, i.e., p < 0.05 was considered statistically significant. Protein and RNA results are as follows: Figure 2 , Figure 3 As shown, where This means p < 0.05. This means p < 0.01. ns represents p < 0.001, and ns represents p > 0.05.

[0048] The results of canine urinary kinase protein t detection are as follows: Figure 2 As shown, p<0.05, combined with the results of step 4, indicates that the expression level of kynurinase KYNU in the Het group (anxiety-type) was significantly higher than that in the WT control group.

[0049] Kynu gene mRNA level t-test results are as follows: Figure 3 As shown, p<0.01 indicates that the relative level of the Kynu gene in the Het group was significantly higher than that in the WT group.

[0050] By combining the detection of kynu urinase protein and the detection of Kynu gene mRNA levels, it can be seen that the upregulation of Kynu gene expression in anxious mice leads to an increase in kynu urinase (KYNU) levels, thereby causing anxiety-like behavior.

[0051] Example 2: Silencing the Kynu gene caused a decrease in KYNU expression levels, which then returned to normal. In this embodiment, the WT group and the Het group (anxiety-type) mice were treated as follows: WT control group: Mice in the WT group underwent sham surgery but were not injected with the virus and were fed normally as controls; Het+shKynu group: Het group (anxiety type) mice (6 weeks old) were injected with adenovirus (pAAV-U6-shKynu-CMV-mCherry-WPRE, purchased from Heyuan Biotechnology, catalog number: HYKY-251013059) in the brain stereotactic system and recovered for two weeks. The specific injection steps are as follows: (1) Anesthesia: Mice were anesthetized by intraperitoneal injection of 1% sodium pentobarbital solution (injection dose was 0.008 mL / g body weight). After the toe clamping reflex was absent, the mouse head was fixed on the adapter of the single-arm single-display brain stereotactic instrument, and the eyes were covered with tin foil to prevent the eyes from being stimulated by the light source. (2) Leveling: The instruments were disinfected with 75% alcohol in advance. The scalp of the mice was first disinfected with iodine solution, the scalp of the experimental mice was cut open to expose the skull, and the surface of the skull was wiped with 75% alcohol to remove the fascia tissue. Then hydrogen peroxide was used to oxidize and expose the bone sutures. The anterior and posterior fontanelles were found and marked with a marker pen. Adjust the anterior and posterior horizontal level of the mouse skull so that the difference in vertical coordinates (Z-axis) between the anterior and posterior fontanelles is ≤0.03 mm, i.e., anterior and posterior leveling. Adjust the lateral horizontal level of the mouse so that the difference in vertical coordinates (Z-axis) between the symmetrical left and right positions is ≤0.03 mm, i.e., lateral leveling. (3) Drilling: Set the anterior fontanelle as the zero point and set all coordinate axes to zero. For the hippocampal DG region, adjust the X-axis AP: ±1.20, Y-axis ML: -2.05, and Z-axis DV: -2.05. Mark the intersection of the X and Y axes on the surface of the skull with a marker. When drilling, be careful not to rotate the drill bit too fast to avoid damaging the mouse brain due to friction and heat. At the same time, keep the hand holding the skull drill with an upward pulling force to avoid damaging the brain the moment the skull is drilled through. If bleeding occurs during drilling, medical cotton balls should be used to stop the bleeding immediately. (4) 310 nL of virus was aspirated by the glass electrode for injection (pAAV-U6-shKynu-CMV-EGFP-WPRE was injected into the experimental group, and empty virus was injected into the control group). The glass electrode was moved to the marked brain region and then slowly inserted to the target brain region depth. 300 nL of virus was injected into each of the two brain regions at an injection rate of 60 nL / min. After the injection, the glass electrode needle should be left in place for 5 min to prevent the virus from being aspirated back, and then the glass electrode was slowly moved up and pulled out. (5) Suturing the skin: The skin of the mouse head was sutured with a needle with suture thread and tied. The wound was disinfected with povidone-iodine to prevent infection of the mouse wound. The mouse was placed on a warm blanket to maintain its body temperature, and it was put back into its original cage after it woke up. (6) Postoperative observation: The mouse's recovery status was carefully observed, and sufficient food and water were provided during the period (except for normal water changes and feeding, no other disturbances were allowed). The injection diagram is shown below. Figure 4 As shown.

[0052] The expression level of KYNU in the brain tissue of mice from the different treatment groups was detected to evaluate the silencing effect of adenovirus on this gene. Specifically, using the same method as in Example 1, brain tissue proteins were extracted from the WT group, Het group, and Het+shKynu group, and Western blot experiments were performed to detect the KYNU expression level. The results are as follows: Figure 5 , Figure 6 As shown.

[0053] Western blot assay results are as follows Figure 5 As shown, the t-detection results are as follows: Figure 6 As shown, after adenovirus injection to silence the Kynu gene, the expression level of kynunu enzyme in the Het+shKynu group was significantly reduced compared to the Het group, indicating that the adenovirus injection was successful and the injection site was accurate.

[0054] Example 3: Viral silencing of the Kynu gene reduces KYNU expression levels to rescue anxiety-like behavior. In this embodiment, the mice were grouped and injected with the virus in the same way as in Example 2 above, and behavioral tests were conducted two weeks after recovery.

[0055] 3.1 Open Field Experiment Test A white, opaque cube with sides of 45 cm was used as the open field device. The bottom plane of the open field was equally divided into 16 squares of 4×4 grids. The four squares in the center were defined as the central area, the four squares at the four corners were defined as the corner areas, and the remaining eight squares were defined as the other areas. This area division was used for automatic recognition and data extraction in the behavioral video tracking system.

[0056] Ensure a suitable environment for the open field behavioral experiment, and guarantee that it is conducted in a relatively quiet setting. Before the test, transfer the mice to be tested to the open field behavioral experiment environment for 30 minutes to acclimatize. Before placing the mice in the open field, wipe the inner walls and bottom of the open field with 75% ethanol to remove odors and other interfering substances. Allow the ethanol to completely evaporate before proceeding with the subsequent tests.

[0057] The behavioral video tracking and analysis system was activated, and the mice to be tested were gently placed in the center of the open field. The behavior of the mice within 6 minutes after entering the open field was detected and recorded.

[0058] After each test, gently remove the mouse and return it to its original cage. Promptly remove any foreign objects from the enclosure and clean it with 75% ethanol and water to eliminate odor interference. Allow the enclosure surface to dry completely before testing the next mouse.

[0059] The following behavioral parameters were extracted and quantified using a behavioral analysis system: the number of times the mouse entered the central and corner areas, the duration of its stay, and the distance it traveled, as well as the total distance traveled during the 6-minute test period. These parameters were used to comprehensively assess the level of anxiety-like behavior in the mice.

[0060] The open field test results are as follows Figure 7 As shown, compared with the Het group, the Het+shKynu group mice spent a significantly longer time in the central region. This suggests that the Het+shKynu mice may exhibit lower anxiety-like behavior or higher exploratory desire, and there was no significant difference from the WT group results. This indicates that viral silencing of the Kynu gene can reduce KYNU expression levels and rescue anxiety-like behavior.

[0061] 3.2 Light and Dark Box Experiment Test The light-dark chamber is a rectangular box, internally divided into two interconnected chambers by a vertical partition. The inner walls of the first chamber are coated white (or kept bright), and the lighting is strong; this is called the "light chamber." The inner walls of the second chamber are coated black (or kept dim), and the lighting is weak or off; this is called the "dark chamber." A small door is provided in the partition between the two chambers for the mice to move freely.

[0062] Mice were gently placed in a dark chamber, allowing them to freely explore between the two chambers. Their behavior was monitored and recorded within 6 minutes of entering the chamber.

[0063] After each test, gently remove the mouse and return it to its original cage. Promptly remove any foreign objects from the cage and clean it with 75% ethanol and water to eliminate odor interference. Allow the cage surface to dry completely before testing the next mouse.

[0064] The following behavioral parameters were extracted and quantified using a behavioral analysis system: cumulative time spent in the lit chamber, number of times the mouse entered the lit chamber, and latency period for entering the lit chamber from the dark chamber. These parameters were used to comprehensively assess the level of anxiety-like behavior in mice. Due to mice's natural tendency to seek darkness and avoid light, the level of anxiety-like behavior was negatively correlated with activity indicators in the lit chamber. Specifically, the shorter the time a mouse spent in the lit chamber, the fewer times it entered the lit chamber, and the longer the latency period for entering the lit chamber, the higher its level of anxiety-like behavior; conversely, the lower the level of anxiety-like behavior.

[0065] The results of the light and dark box experiment are as follows Figure 8 As shown, the Het+shKynu group mice spent significantly longer in the bright box than the Het group, indicating that the Het+shKynu mice exhibited lower anxiety-like behaviors. The results for the WT group were not significantly different from those for the Het+shKynu group, suggesting that viral silencing of the Kynu gene can rescue anxiety-like behaviors.

[0066] 3.3 Elevated Cross Maze Experiment Test The elevated cross-maze device consists of four white polypropylene arms, forming a cross-shaped structure divided into five independent areas: two opposing open arms, two opposing closed arms, and a central area located at the cross intersection. Each arm is 5 cm wide and 35 cm long, and the enclosure is approximately 55 cm high.

[0067] The tests were conducted in a quiet, dimly lit environment. At the start of each test, the mouse was gently placed in the center of the maze, facing any one of the outstretched arms. The mouse was then allowed to explore the device for 6 minutes. Throughout the test, the mouse's movement and behavior were continuously recorded via video using a camera mounted directly above the maze.

[0068] After each test, gently remove the mouse and return it to its original cage. Promptly remove any foreign objects from the cage and clean it with 75% ethanol and water to eliminate odor interference. Allow the cage surface to dry completely before testing the next mouse.

[0069] The following behavioral parameters were extracted and quantified using a behavioral analysis system: cumulative dwell time in open and closed arms, number of entries, and total distance traveled during the test. These parameters were used to comprehensively assess the level of anxiety-like behavior in the mice.

[0070] The test results of the elevated cross maze experiment are as follows: Figure 9 As shown, the Het+shKynu group was significantly higher than the Het group in all three indicators, meaning they entered the open arm more frequently and spent a longer and greater proportion of time in the open arm. This indicates that the Het+shKynu mice exhibited lower anxiety-like behavior, with no significant difference compared to the WT group. This suggests that viral silencing of the Kynu gene can reduce KYNU expression levels and rescue anxiety-like behavior.

[0071] The nucleotide sequence of the Kynu gene (SEQ ID NO:1): Amino acid sequence of kynureninase KYNU (SEQ ID NO:2): MMEPSPLELPVDAVRRIAAELNCDPTDERVALRLDEEDKLSHFRNCFYIPKMRDLPSIDLSLVSEDDDAIYFLGNSLGLQPKMVRTYLEEELDKWAKMGAYGHDVGKRPWIVGDESIVSLMKDIVGAHEKEIALMNALTINLHLLLLSFFKPTPKRHKILLEAKAFPSDHYAIESQIQLHGLDVEKSMRMVKPREGEETLRMEDILEVIEEEGDSIAVILFSGLHFYTGQLFNIPAITKAGHAKYLNSGAGGLAGAFVHEKHAHTVKPALVGWFGHDLSTRFNMDNKLQLIPGANGFRISNPPILLVCSLHASLEVFQQATMTALRRKSILLTGYLEYMLKHYHSKDNTENKGPIVNIITPSRAEERGCQLTLTFSIPKKSVFKELEKRGVVCDKREPDGIRVAPVPLYNSFHDVYKFIRLLTSILDSSERS Nucleotide sequence of EXOSC9 gene (SEQ ID NO:3): qPCR forward primer qPCR-KYNU-F sequence (SEQ ID NO:4): AGTGGGCTGCACTTTTATACTG qPCR reverse primer qPCR-KYNU-R sequence (SEQ ID NO:5): TGCAAACAGGTTGCCTTTCAG The above description is merely a preferred embodiment of the present invention, and should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications are also considered to be within the scope of protection of the present invention.

Claims

1. The application of the Kynu gene or its encoded protein kynurinase KYNU as a target in the screening or preparation of drugs for the prevention, relief and / or treatment of anxiety disorders.

2. The application according to claim 1, characterized in that, The drug includes inhibitors of the Kynu gene or kynurinase KYNU.

3. The use of inhibitors of the Kynu gene or its encoded protein, kynurinase KYNU, in the preparation of drugs for the prevention, relief, and / or treatment of anxiety disorders.

4. The application according to claim 2 or 3, characterized in that, The inhibitors include at least one of gene-editing therapeutics that block the normal transcription or post-transcriptional translation of the Kynu gene, antisense nucleotides, siRNA, shRNA, and miRNA; or at least one of compounds, proteins, antibodies, and enzymes that affect the stability, expression level, activity, or function of kynurinase protein.

5. The application according to claim 2 or 3, characterized in that, The inhibitor is adenovirus pAAV-U6-shKynu-CMV-mCherry-WPRE.

6. The application according to any one of claims 1-3, wherein the nucleotide sequence of the Kynu gene is as shown in SEQ ID NO:1 or a nucleic acid that has been substituted, deleted or added one or more nucleotides in the sequence shown in SEQ ID NO:1 and encodes a protein having KYNU enzyme activity; The amino acid sequence of the kynurinase KYNU is shown in SEQ ID NO:2, or is a protein that still has kynurinase activity after one or more amino acids have been substituted, deleted, or added to the amino acid sequence shown in SEQ ID NO:

2.

7. The application according to any one of claims 1-3, characterized in that: The anxiety disorder is caused by a deletion of the EXOSC9 gene.

8. A kit for screening drugs for the prevention, relief, and / or treatment of anxiety disorders, characterized in that: It contains reagents for detecting the expression level or activity of the Kynu gene or its encoded protein, kynurinase KYNU.

9. A medicine for the prevention, relief, and / or treatment of anxiety disorders, characterized in that: Inhibitors containing the Kynu gene or its encoded protein, kynurinase KYNU.

10. The medicament according to claim 9, characterized in that: It also includes pharmaceutically acceptable carriers.

Citation Information

Patent Citations

  • 3-(5-chloro-2-oxobenzo[d]oxazol-3(2H)-yl)propanoic acid derivatives as KMO inhibitors

    CN105829290A

  • Application of kynurenase protein inhibitor in preparation of medicine for treating radioactive intestinal injury

    CN119896659A

  • Immune checkpoint inhibitors and screening methods

    JP2025031671A

  • Yeast platform construction and screening methods

    US20100081699A1

  • Kynurenine-aminotransferase inhibitors

    US20100273787A1