Plant powdery mildew resistance protein rxl, encoding gene and application thereof
By providing the RXL protein and its encoding gene in wheat and using the Cas9 system for gene editing to regulate the abundance or expression of the RXL protein, the problem of limited resistance genes in wheat powdery mildew resistance breeding has been solved, enabling the broad-spectrum and durable breeding of resistant varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2024-11-29
- Publication Date
- 2026-05-29
AI Technical Summary
Breeding wheat to resist powdery mildew faces challenges such as the rapid mutation rate of powdery mildew fungi and the limited number of resistance genes. It is necessary to discover new resistance genes and make rational use of existing resistance genes to cultivate varieties with broad-spectrum and long-lasting resistance.
The study provides the RXL protein and its encoding gene in wheat. By regulating the abundance of the RXL protein or inhibiting its expression, plant powdery mildew resistance can be controlled. Gene editing using the Cas9 system can be used to cultivate plants with increased or decreased resistance to powdery mildew.
This study demonstrated how regulating the abundance or expression of the RXL protein can improve or reduce plant resistance to powdery mildew, providing new germplasm for cultivating plants with improved or reduced disease resistance, and has significant breeding application value.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering breeding and relates to the plant powdery mildew resistance protein RXL, its encoding gene, and its applications. Background Technology
[0002] Wheat is one of the world's major food crops, providing approximately 20% of global energy needs. Wheat powdery mildew is caused by *Brucea javanica*, a wheat-specific strain. Blumeria graminis f. sp. tritici , Bgt Powdery mildew is a major fungal disease that significantly reduces wheat yield and quality, affecting tiller number, grain number per ear, and thousand-grain weight. Therefore, controlling wheat powdery mildew is crucial for increasing wheat yield, reducing pesticide use, and protecting the environment.
[0003] However, breeding wheat varieties resistant to powdery mildew in my country faces challenges. The rapid mutation rate of powdery mildew fungi, the ever-expanding range of new highly virulent varieties, and the limited availability of resistance genes are problems that urgently need to be addressed. Therefore, it is necessary to continuously explore new resistance genes, expand the sources of resistance genes, and rationally utilize existing resistance genes. In this way, varieties with broad-spectrum and durable resistance can be bred, thereby effectively controlling the damage caused by wheat powdery mildew and achieving the goal of reducing inputs and increasing output. my country has a wide variety of local wheat varieties, accumulating rich genetic resources. These local varieties carry superior genes lacking in developed varieties, which are of great significance for wheat disease resistance breeding. Summary of the Invention
[0004] The purpose of this invention is to provide the plant powdery mildew resistance protein RXL, its encoding gene, and its applications.
[0005] This invention provides a protein obtained from wheat, named RXL protein, which is as follows (a1) or (a2) or (a3) or (a4): (a1) The protein shown in SEQ ID NO: 1; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1) and which is associated with plant powdery mildew resistance; (a4) is a protein derived from wheat that shares more than 98% identity with (a1) and is associated with plant resistance to powdery mildew.
[0006] The specific labels are shown in Table 1.
[0007] Table 1. Sequence of Labels
[0008] Nucleic acid molecules encoding the RXL protein are also within the scope of protection of this invention.
[0009] Specifically, the nucleic acid molecule is an RNA molecule or a DNA molecule.
[0010] Specifically, the nucleic acid molecule encoding the RXL protein can be... RXL Gene.
[0011] Specifically, the aforementioned RXL The gene can be one of the following: (b1) or (b2) or (b3): (b1) A DNA molecule with a coding region as shown in SEQ ID NO: 2; (b2) A DNA molecule derived from wheat that has more than 95% identity with (b1) and encodes the protein thereon; (b3) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) under strict conditions and encodes the protein.
[0012] The above stringent conditions can be achieved by hybridization at 65°C and washing the membrane in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS during DNA or RNA hybridization experiments.
[0013] Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cells containing the aforementioned nucleic acid molecules are all within the scope of protection of this invention.
[0014] This invention also protects the application of the RXL protein or nucleic acid molecules encoding the RXL protein in regulating powdery mildew resistance in plants. The regulation is positive regulation. Increased RXL protein abundance leads to increased powdery mildew resistance; decreased RXL protein abundance leads to decreased powdery mildew resistance. Increased abundance of nucleic acid molecules encoding the RXL protein leads to increased powdery mildew resistance; decreased abundance of nucleic acid molecules encoding the RXL protein leads to decreased powdery mildew resistance.
[0015] This invention also protects the use of the RXL protein or the nucleic acid molecule encoding the RXL protein as an inhibitory target in the preparation of plants with reduced resistance to powdery mildew.
[0016] This invention also protects the use of substances for inhibiting the RXL protein or substances for inhibiting nucleic acid molecules encoding the RXL protein in the preparation of plants with reduced resistance to powdery mildew. Specifically, the substance for inhibiting nucleic acid molecules encoding the RXL protein is an inhibitor... RXL Substances that inhibit gene expression. Specifically, substances that suppress gene expression. RXL The substance that inhibits gene expression is through the Cas9 system. RXL Substances that inhibit gene expression. Specifically, substances that suppress gene expression. RXL The substance expressed by the gene is expressed through the Cas9 system. RXLA substance used for gene editing. The target sequence of the Cas9 system is located at... RXL Genes. Specifically, the target sequences of the Cas9 system are TGCTGTAGCGGCATTTAGCA and GATCAACTGCAACGACTGAA. Inhibition RXL The specific substance for gene expression can be the following recombinant plasmid: The DNA molecule shown in SEQ ID NO: 3 is inserted into plasmid pHEE401E. Bsa I. Recombinant plasmid obtained from enzyme digestion sites.
[0017] This invention also protects a method for cultivating plants with reduced resistance to powdery mildew, comprising the following steps: inhibiting the expression of nucleic acid molecules encoding RXL protein in plants to obtain plants with reduced resistance to powdery mildew. Specifically, inhibiting the expression of nucleic acid molecules encoding RXL protein in plants can be achieved by inhibiting the expression of nucleic acid molecules encoding RXL protein in plants. RXL Gene expression. Specifically, inhibiting gene expression in plants. RXL Gene expression is achieved by introducing the Cas9 system into the plant. The target sequence of the Cas9 system is located at... RXL Gene. Specifically, the target sequences of the Cas9 system are TGCTGTAGCGGCATTTAGCA and GATCAACTGCAACGACTGAA. Specifically, the Cas9 system is the following recombinant plasmid: the DNA molecule shown in SEQ ID NO: 3 is inserted into plasmid pHEE401E. Bsa I. Recombinant plasmid obtained from enzyme digestion sites.
[0018] This invention also protects a method for cultivating plants with enhanced resistance to powdery mildew, comprising the following steps: introducing a nucleic acid molecule encoding an RXL protein into a recipient plant to obtain a transgenic plant with enhanced resistance to powdery mildew. This invention also protects the application of any of the methods described above in plant breeding. Specifically, the purpose of the plant breeding is to cultivate plants with improved resistance to powdery mildew. More specifically, the purpose of the plant breeding is to cultivate plants with reduced resistance to powdery mildew.
[0019] All of the powdery mildew mentioned above is a disease caused by powdery mildew fungi. Specifically, all of the powdery mildew fungi mentioned above are physiological races of powdery mildew, E20.
[0020] Any of the above-mentioned plants may be monocotyledonous or dicotyledonous. Any of the above-mentioned plants may be plants of the Poaceae family. Any of the above-mentioned plants may be plants of the Triticum genus. Specifically, any of the above-mentioned plants may be common wheat. Specifically, any of the above-mentioned plants may be wheat (e.g., Wheat Rejuvenation 30 or Wheat Tangmai 4).
[0021] This invention has significant application and promotion value for cultivating new disease-resistant plant germplasm or disease-susceptible plant models. Attached Figure Description
[0022] Figure 1 This is the result of the map-based cloning process and sequence alignment in Example 1.
[0023] Figure 2 The images show the sequencing results and powdery mildew resistance test from Example 2.
[0024] Figure 3 This is a spectrum of plasmid pHEE401E.
[0025] Figure 4 The sequencing results are for the gene-edited plant in Example 3.
[0026] Figure 5 This is the result of the powdery mildew resistance test in Example 3. Detailed Implementation
[0027] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0028] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. Unless otherwise specified, the quantitative experiments in the following embodiments are all performed in triplicate, and the results are averaged.
[0029] Fielder of common wheat is described in the following literature: A rare single nucleotide variant in Pm5e confers powdery mildew resistance in common wheat. New Phytologist, Volume 228, Issue 3, November 2020, Pages 1011-1026.
[0030] Xuezao, a rare single nucleotide variant of common wheat, is described in the following literature: A rare single nucleotide variantin Pm5e confers powdery mildew resistance in common wheat. New Phytologist, Volume 228, Issue 3, November 2020, Pages 1011-1026.
[0031] The wheat variety Tangmai 4 is described in the following literature: A rare single nucleotide variant in Pm5econfers powdery mildew resistance in common wheat. New Phytologist, Volume 228, Issue 3, November 2020, Pages 1011-1026. Sequencing revealed that the cDNA of Tangmai 4 contains the open reading frame shown in SEQ ID NO: 2, and the genomic DNA of Tangmai 4 contains the segment shown in SEQ ID NO: 2.
[0032] Example 1: Map-based cloning of the wheat powdery mildew resistance gene RXL A mapping population was constructed by hybridizing wheat Fuzhuang 30 and wheat Nongda 015 as parents, and fine mapping was performed to ultimately determine the mapping results. RXL Gene location on chromosome 7BL molecular marker WGGB2 and WGGB3 The physical interval between markers is approximately 13.5 kb. Using Novizan high-fidelity DNA polymerase, the physical sequences of the localization intervals of wheat rejuvenation 30 and wheat Nongda 015 were amplified by PCR. The map-based cloning process and sequence alignment results are shown below. Figure 1 .
[0033] A novel protein was eventually discovered in wheat rejuvenation 30, as shown in SEQ ID NO: 1, and named the RXL protein. The open reading frame encoding the RXL protein in the cDNA of wheat rejuvenation 30 is shown in SEQ ID NO: 2. The gene encoding the RXL protein in the genomic DNA of wheat rejuvenation 30 is shown in SEQ ID NO: 2.
[0034] Example 2: Verification of the anti-powdery mildew function of RXL protein using EMS mutants Thirty wheat seeds were taken for rejuvenation and treated with 0.4% EMS reagent, then cultivated into plants. Seeds from 1500 M2 families were obtained through self-pollination of individual plants. Powdery mildew resistance was assessed in each family, resulting in five independent powdery mildew-susceptible mutant families (M3274, M3289, M1650, M2347, and M3056). The powdery mildew resistance test method for the five families was the same as step three of Example 3.
[0035] Sequencing results showed that the M3274, M3289, M1650, M2347, and M3056 families... RXL Point mutations occurred in all genes, resulting in changes in amino acids or premature termination of protein translation.
[0036] The relevant sequencing results of the five families are shown below. Figure 2 See photos of powdery mildew resistance tests from five families in line A. Figure 2 The results indicate that the RXL protein is involved in regulating functions related to powdery mildew resistance.
[0037] Example 3: Gene editing to verify the protein's anti-powdery mildew function I. Construction of recombinant plasmids The DNA molecule shown in SEQ ID NO: 3 was inserted into plasmid pHEE401E (Addgene, catalog number #71287; plasmid map shown). Figure 3 )of Bsa I. Recombinant plasmid was obtained by restriction enzyme digestion. The DNA molecule shown in SEQ ID NO: 3 expresses two sgRNAs, one with the target sequence “TGCTGTAGCGGCATTTAGCA” and the other with the target sequence “GATCAACTGCAACGACTGAA”.
[0038] II. Obtaining Gene-Edited Plants 1. The recombinant plasmid constructed in step one was introduced into Agrobacterium EHA105 (Beijing Huayueyang Biotechnology Co., Ltd.) to obtain recombinant Agrobacterium.
[0039] 2. Using the Agrobacterium tumefaciens infection method, recombinant Agrobacterium tumefaciens was used to genetically transform the embryogenic callus tissue of wheat Tangmai 4. The tissue was then subjected to co-culture, screening culture, differentiation and regeneration culture and rooting culture in sequence to obtain regenerated plants, namely T0 generation plants.
[0040] 3. Take leaves from T0 generation regenerated plants, extract total DNA, and perform PCR amplification using primer pair F (corresponding to the upstream of the start codon) and primer R (corresponding to the target gene). The PCR amplification products are then recovered and sequenced. Using total DNA from wheat variety Tangmai 4 leaves as a template, PCR amplification is performed using primer pair F and primer R. The PCR amplification products are then recovered and sequenced, and the sequencing results are used as the reference sequence. If the sequencing results of a T0 generation regenerated plant are two different sequences, one identical to the reference sequence and the other different, then the T0 generation regenerated plant is a heterozygous gene-edited plant. If the sequencing results of a T0 generation regenerated plant are the same as the reference sequence, then the T0 generation regenerated plant is a non-gene-edited plant.
[0041] Primer F: AGGGAGGAGGAGTGATCTGT; Primer R: GGAGCGACTAAGATGAGGCT.
[0042] Five heterozygous gene-edited plants were screened from the T0 generation regenerated plants and named RXL-ED1, RXL-ED2, RXL-ED3, RXL-ED4 and RXL-ED5, respectively. One non-gene-edited plant was randomly selected from the T0 generation regenerated plants and named RXL-nonED.
[0043] 4. RXL-ED1 plants were self-pollinated individually, and seeds were harvested. These seeds were then cultured into plants, which were designated as the T1 generation. Leaves from the T1 generation plants were taken, and PCR amplification was performed using primers F and R. The PCR amplification products were then recovered and sequenced. If the sequencing result of a T1 generation plant was identical to the reference sequence, then the T1 generation plant was a homozygous gene-edited plant (sequencing results are shown in [link to documentation]). Figure 4 Homozygous gene-edited plants are self-pollinated and seeds are harvested. These seeds are then cultured into plants, which are called T2 generation plants, or T2 generation plants of the RXL-ED1 line.
[0044] 5. RXL-ED2 plants were self-pollinated individually, and seeds were harvested. These seeds were then cultured into plants, which were designated as the T1 generation. Leaves from the T1 generation plants were taken, and PCR amplification was performed using primers F and R. The PCR amplification products were then recovered and sequenced. If the sequencing result of a T1 generation plant was identical to the reference sequence, then that T1 generation plant was a homozygous gene-edited plant (sequencing results are shown in [link to documentation]). Figure 4 Homozygous gene-edited plants are self-pollinated and seeds are harvested. These seeds are then cultured into plants, which are called T2 generation plants, or T2 generation plants of the RXL-ED2 line.
[0045] 6. RXL-ED3 plants were self-pollinated individually, and seeds were harvested. These seeds were then cultured into plants, which were designated as the T1 generation. Leaves from the T1 generation plants were taken, and PCR amplification was performed using primers F and R. The PCR amplification products were then recovered and sequenced. If the sequencing result of a T1 generation plant was identical to the reference sequence, then that T1 generation plant was a homozygous gene-edited plant (sequencing results are shown in [link to documentation]). Figure 4 Homozygous gene-edited plants are self-pollinated and seeds are harvested. These seeds are then cultured into plants, which are called T2 generation plants, or T2 generation plants of the RXL-ED3 line.
[0046] 7. RXL-ED4 plants were self-pollinated individually, and seeds were harvested. These seeds were then cultured into plants, which were designated as the T1 generation. Leaves from the T1 generation plants were taken, and PCR amplification was performed using primers F and R. The PCR amplification products were then recovered and sequenced. If the sequencing result of a T1 generation plant was identical and differed from the reference sequence, then the T1 generation plant was a homozygous gene-edited plant (sequencing results are shown in [link to documentation]). Figure 4 Homozygous gene-edited plants are self-pollinated and seeds are harvested. These seeds are then cultured into plants, which are called T2 generation plants, or T2 generation plants of the RXL-ED4 line.
[0047] 8. RXL-ED5 plants were self-pollinated individually, and seeds were harvested. These seeds were then cultured into plants, which were designated as the T1 generation. Leaves from the T1 generation plants were taken, and PCR amplification was performed using primers F and R. The PCR amplification products were then recovered and sequenced. If the sequencing result of a T1 generation plant was identical to the reference sequence, then the T1 generation plant was a homozygous gene-edited plant (sequencing results are shown in [link to documentation]). Figure 4 Homozygous gene-edited plants are self-pollinated and seeds are harvested. These seeds are then cultured into plants, which are called T2 generation plants, or T2 generation plants of the RXL-ED5 line.
[0048] 9. RXL-nonED plants are self-pollinated and seeds are harvested. The seeds are then cultivated into plants, which are called T1 generation plants. T1 generation plants are self-pollinated and seeds are harvested. The seeds are then cultivated into plants, which are called T2 generation plants, and are called T2 generation plants of the RXL-nonED line.
[0049] III. Identification of resistance to powdery mildew Powdery mildew is an airborne disease, primarily spread by conidia of the powdery mildew fungus (the causative agent) carried by air currents. The powdery mildew used in this example is physiological race E20 (referred to in the literature as "Bgt isolate E20"), described in the following reference: A rare single nucleotide variant in Pm5e confers powdery mildew resistance in common wheat. New Phytologist, Volume 228, Issue 3, November 2020, Pages 1011-1026.
[0050] The tested plants were: 12 T2 generation plants of the RXL-ED1 line, 12 T2 generation plants of the RXL-ED2 line, 12 T2 generation plants of the RXL-ED3 line, 12 T2 generation plants of the RXL-ED4 line, 12 T2 generation plants of the RXL-ED5 line, 12 T2 generation plants of the RXL-nonED line, and 12 Tangmai No. 4 plants (denoted by TM).
[0051] 1. Sow seeds in plastic flower pots (10cm in diameter, 30 seeds per pot) and cultivate common wheat seedlings to the three-leaf stage. Place powdery mildew conidia above the leaves and shake them onto the leaves. Then, cultivate normally for 2 weeks. The flower pot at this time is called a mycelium propagation pot.
[0052] 2. Cultivate the test plants in plastic flower pots (30cm in diameter, 4 plants per pot) until the heading stage, referred to as test pots.
[0053] 3. Transfer the propagation pots and test pots to the same greenhouse room, and place four test pots radially around each propagation pot (the distance between the edges of the propagation pots and the test pots is 20cm). Incubate normally for 2 weeks. During the incubation process, manually brush away the powdery mildew spores on the plants in the propagation pots to promote their spread.
[0054] 4. After completing step 3, take photos and count the disease severity of the tested plants.
[0055] Disease severity assessment criteria: Record the percentage of powdery mildew spore mass area on the flag leaf relative to the total leaf area, using a 0-4 grading system. 0 indicates no spores, 1 indicates a spore mass area greater than 0 and less than or equal to 25% of the leaf area, 2 indicates a spore mass area greater than 25% and less than or equal to 50% of the leaf area, 3 indicates a spore mass area greater than 50% and less than or equal to 75% of the leaf area, and 4 indicates a spore mass area greater than 75% and less than or equal to 100% of the leaf area.
[0056] See example photos Figure 5 The disease severity level of plants in the RXL-ED1 strain was 4, the disease severity level of plants in the RXL-ED2 strain was 4, the disease severity level of plants in the RXL-ED3 strain was 4, the disease severity level of plants in the RXL-ED4 strain was 4, the disease severity level of plants in the RXL-ED5 strain was 4, the disease severity level of plants in the RXL-nonED strain was 0, and the disease severity level of Tangmai No. 4 was 0.
[0057] The results of powdery mildew resistance identification showed that, compared with wild-type plants (Tangmai 4) and non-gene-edited plants (RXL-nonED), all gene-edited lines lost their powdery mildew resistance function, indicating that the RXL protein plays a role in regulating powdery mildew resistance.
[0058] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Proteins, in the following forms: (a1) or (a2) or (a3) or (a4): (a1) The protein shown in SEQ ID NO: 1; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1) and which is associated with plant powdery mildew resistance; (a4) is a protein derived from wheat that shares more than 98% identity with (a1) and is associated with plant resistance to powdery mildew.
2. A nucleic acid molecule encoding the protein of claim 1.
3. The nucleic acid molecule as described in claim 2, characterized in that: The nucleic acid molecule is as follows (b1) or (b2) or (b3): (b1) A DNA molecule with a coding region as shown in SEQ ID NO: 2; (b2) A DNA molecule derived from wheat that has more than 95% identity with (b1) and encodes the protein thereon; (b3) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) under strict conditions and encodes the protein.
4. An expression cassette, recombinant vector, recombinant microorganism, or transgenic plant cell containing the nucleic acid molecule described in claim 2 or 3.
5. The use of the protein of claim 1 or the nucleic acid molecule of claim 2 or 3 in regulating plant powdery mildew resistance.
6. The use of the protein of claim 1 or the nucleic acid molecule of claim 2 or 3 as an inhibitory target in the preparation of plants with reduced resistance to powdery mildew.
7. The use of a substance for inhibiting the protein of claim 1 or a substance for inhibiting the nucleic acid molecule of claim 2 or 3 in the preparation of plants with reduced resistance to powdery mildew.
8. A method for cultivating plants with reduced resistance to powdery mildew, comprising the following steps: inhibiting the expression of the nucleic acid molecule as described in claim 2 or 3 in the plant to obtain plants with reduced resistance to powdery mildew.
9. A method for cultivating plants with enhanced resistance to powdery mildew, comprising the following steps: introducing the nucleic acid molecule of claim 2 or 3 into a recipient plant to obtain a transgenic plant with enhanced resistance to powdery mildew.
10. The application of the method according to any one of claims 8 to 9 in plant breeding.