Application of RNA interference vector ARF18-RNAi for improving in vitro shoot regeneration efficiency of strawberry
By constructing a strawberry ARF18-RNAi vector and using Agrobacterium-mediated genetic transformation, the expression of the ARF18 gene was reduced, solving the problem of low in vitro regeneration efficiency of strawberries and achieving high-efficiency strawberry breeding results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NANJING AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-03-04
- Publication Date
- 2026-05-29
AI Technical Summary
The low efficiency of strawberry in vitro regeneration limits the progress of genetic transformation and molecular breeding, and existing technologies are insufficient to effectively improve the efficiency of strawberry in vitro bud regeneration.
We constructed an RNA interference vector, ARF18-RNAi, for strawberry ARF18 and used Agrobacterium-mediated genetic transformation to reduce the expression of the ARF18 gene and improve the regeneration efficiency of strawberry detached buds.
Downregulating the expression of the ARF18 gene using an RNA interference vector significantly improved the regeneration efficiency of strawberry buds in vitro, shortened the regeneration cycle, and promoted technological progress in strawberry breeding.
Smart Images

Figure CN122103294A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology and relates to the strawberry ARF18 gene and its application in improving the regeneration efficiency of strawberry detached buds. Specifically, it relates to a method and application for obtaining new strawberry germplasm with high detached bud regeneration efficiency using the RNA interference vector ARF18-RNAi of the strawberry ARF18 gene. Background Technology
[0002] Strawberry is a perennial herbaceous plant and an important economic crop of the Rosaceae family. In vitro regeneration technology for strawberries can provide healthy, high-yield virus-free seedlings, enabling rapid and large-scale propagation of strawberry seedlings and ensuring the stability of strawberry quality and yield. Simultaneously, in vitro regeneration technology is fundamental to applications in genetic engineering and molecular breeding. The complex genetic background of strawberries, being highly heterozygous polyploids, leads to long cycles and low efficiency in traditional hybridization breeding. Establishing a stable and efficient in vitro regeneration system is a crucial step in successfully introducing exogenous target genes and regenerating complete plants, providing important technical support and theoretical basis for strawberry genetic transformation and molecular breeding research.
[0003] Strawberry in vitro regeneration typically uses leaves as explants, inoculated onto artificial culture media under sterile conditions. By regulating the ratio of plant hormones (especially auxins and cytokinins), the leaves are induced to dedifferentiate and form callus tissue, which then redifferentiates into adventitious buds, eventually regenerating into complete plants. The efficiency of in vitro bud regeneration is influenced by various factors, including plant species, genotype, leaf physiological state, culture medium composition (especially hormone types and concentrations), and culture conditions (light, temperature, etc.). Currently, the efficiency of strawberry in vitro bud regeneration is generally low, which to some extent limits its genetic transformation and molecular breeding progress. Overcoming the current bottleneck of low regeneration efficiency and cultivating germplasm resources with excellent regeneration characteristics remains a fundamental research challenge and technical difficulty that urgently needs to be addressed in the field of strawberry biotechnology.
[0004] Auxins are important plant hormones involved in plant growth and development. They participate extensively in various physiological activities by regulating cell elongation, division, and differentiation, and also mediate plant responses to environmental signals, influencing organogenesis and morphogenesis. ARFs (Auxin response factors) are plant-specific transcription factors that play a central regulatory role in the auxin signaling pathway. Previous studies have shown that there are 23 ARFs in Arabidopsis thaliana, among which ARF7 and ARF19 promote callus formation and root stem cell factor activation by regulating the expression of downstream transcription factors (such as the LBD gene), thus promoting detached shoot regeneration. Strawberry ARF18 has low homology with Arabidopsis ARF7 and ARF19, and there are no reports on the role of the strawberry ARF18 gene in detached shoot regeneration. This application demonstrates that reducing ARF18 expression promotes detached shoot regeneration, indicating that ARF18 is an inhibitor of detached shoot regeneration, which differs from previous studies. Summary of the Invention
[0005] The problem this invention aims to solve is to overcome the shortcomings of existing technologies and provide a method and application for obtaining new strawberry germplasm with high regeneration efficiency using an RNA interference vector. By constructing the strawberry ARF18-RNAi RNA interference vector, and utilizing Agrobacterium-mediated genetic transformation, ARF18-RNAi plant material with high in vitro shoot regeneration efficiency was obtained, creating new strawberry germplasm and providing an efficient method for obtaining regenerated strawberry seedlings.
[0006] The technical solution of this invention is as follows: The first object of the present invention is to provide an ARF18 protein, the amino acid sequence of which is shown in SEQ ID NO.3.
[0007] A second object of the present invention is to provide an ARF18 gene encoding the aforementioned ARF18 protein, wherein the nucleotide sequence of the ARF18 gene is selected from either 1) or 2). 1) The nucleotide sequence is as shown in SEQ ID NO.1, representing the strawberry ARF18 genome sequence; 2) The nucleotide sequence is the strawberry ARF18CDS sequence shown in SEQ ID NO.2.
[0008] A third objective of this invention is to provide an RNA interference sequence for the ARF18 gene, the nucleotide sequence of which is shown in SEQ ID NO.6.
[0009] The fourth objective of this invention is to provide an interference vector for the ARF18 gene, wherein the interference vector is obtained by inserting the aforementioned RNA interference sequence into the Sal I restriction site of the pCAMBIA-2300GN-35-35 plasmid.
[0010] pCAMBIA-2300GN-35-35 plasmid vector information source [1] Li Rui. Effects of heterologous expression of merA / merB gene on mercury content in tomato and verification in other plants [D]. Nanjing Agricultural University, 2018. DOI:10.27244 / d.cnki.gnjnu.2018.000506. and Datla RS, Hammerlindl JK, Pelcher LE, Crosby WL, Selvaraj G. A bifunctional fusion between beta-glucuronidase and neomycinphosphotransferase: a broad-spectrum marker enzyme for plants. Gene. 1991 May30;101(2):239-46. doi: 10.1016 / 0378-1119(91)90417-a. PMID: 1647361. The present invention also provides a method for preparing the interference carrier, the method comprising the following steps: S1: Based on the CDS sequence of strawberry ARF18, design and synthesize a fragment containing the RNA interference sequence of the ARF18 gene; S2: The basic vector pCAMBIA-2300GN-35-35 was linearly digested with restriction endonuclease Sal I, and the fragment containing the ARF18 gene RNA interference sequence was recombined into the vector; S3: On the basic vector, upstream and downstream primers for verifying the RNA interference fragment were designed and synthesized, PCR reaction was performed, and vectors that integrate the RNA interference sequence of gene ARF18 were screened, namely ARF18-RNAi vectors.
[0011] Furthermore, the upstream primer sequence described in S3 is shown in SEQ ID NO.7, and the downstream primer sequence is shown in SEQ ID NO.8.
[0012] The fifth objective of this invention is to provide transgenic engineered bacteria transfected with the aforementioned interference vector.
[0013] The sixth objective of this invention is to provide the application of the aforementioned ARF18 protein, or the aforementioned ARF18 gene, or the aforementioned RNA interference sequence, or the aforementioned interference vector, or the aforementioned transgenic engineered bacteria in improving the regeneration efficiency of strawberry detached buds or cultivating new strawberry germplasm with high regeneration efficiency.
[0014] Furthermore, the expression level of ARF18 protein in strawberry plants or isolated tissues is reduced, or the ARF18 gene in strawberry plants or isolated tissues is knocked down, or the RNA interference sequence, the interference vector, or the transgenic engineered bacteria are transferred into strawberry plants or isolated tissues to improve the regeneration efficiency of strawberry isolated buds or to cultivate new strawberry germplasm with high regeneration efficiency.
[0015] The beneficial effects of this invention are as follows: (1) This invention improves the regeneration efficiency of strawberry buds by downregulating the expression of the ARF18 gene through RNA interference, and verifies that ARF18 is related to strawberry bud regeneration, providing a new technical solution for strawberry seedling cultivation.
[0016] (2) This invention improves the efficiency of strawberry bud regeneration by RNA interference, overcoming the problems of low strawberry regeneration efficiency and difficulty in transgenic cultivation.
[0017] (3) This invention obtained strawberry plants with high regeneration efficiency of detached buds by downregulating the expression of ARF18 gene through RNA interference vector, which provides a reference for the application of RNA interference in plant molecular breeding. Attached Figure Description
[0018] Figure 1 This refers to the interference efficiency of the T0 generation of strawberry ARF18-RNAi plants in Example 3.
[0019] Figure 2 This is a statistical analysis of the frequency of in vitro shoot regeneration in wild-type and ARF18-RNAi T1 generation plants in Example 4.
[0020] Figure 3 The leaves from wild-type and ARF18-RNAi T1 generation plants, regenerated in vitro for 60 days, are from Example 4. Detailed Implementation
[0021] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.
[0022] Example 1: Construction of RNA interference vector for strawberry ARF18 1. Identification of the ARF18 gene in strawberries The full-length strawberry ARF18 gene is 4158 bp, and its sequence is shown in SEQ ID NO.1; the CDS of the strawberry ARF18 gene is 2136 bp, and its sequence is shown in SEQ ID NO.2; the amino acid sequence encoded by the strawberry ARF18 gene is shown in SEQ ID NO.3.
[0023] 2. RNA interference fragment design Take 300-500 bp from the CDS sequence of the ARF18 gene and perform BLAST using BioEdit software. The selected fragment should not have a consecutive pairing of more than 20 bp with the CDS sequences of other genes. The resulting fragment is the CDS sequence constituting the RNA interference fragment of the ARF18 gene, as shown in SEQ ID NO.4.
[0024] 3. Carrier Construction In the SnapGene software, a FaQR intron sequence is inserted between the p35s and nos sequences of the basic vector pCAMBIA-2300GN-35-35, as shown in SEQ ID NO.5.
[0025] A forward sequence of ARF18 RNA interference CDS is inserted at the 5' end of the selected FaQR sequence, and a reverse sequence of ARF18 RNA interference CDS is inserted at the 3' end of the FaQR sequence, forming a sequence with the structure "ARF18 sense gene fragment-FaQR-ARF18 antisense gene fragment", which is the RNA interference fragment of the gene ARF18, as shown in SEQ ID NO.6.
[0026] The designed RNA interference fragment sequence of the ARF18 gene was synthesized by a company. The base vector pCAMBIA-2300GN-35-35 was linearly digested with restriction endonuclease Sal I, and the RNA interference fragment of the ARF18 gene shown in SEQ ID NO.6 was recombined into the above vector.
[0027] Primers were designed on the basic vector pCAMBIA-2300GN-35-35 for PCR reaction. The PCR reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0028] The size of the PCR product bands was used to determine whether the ARF18 RNA interference fragment was integrated into the basic vector pCAMBIA-2300GN-35-35. The upstream primer sequence is shown in SEQ ID NO.7, and the downstream primer sequence is shown in SEQ ID NO.8.
[0029] SEQ ID NO. 7: CAAATGGACGAACGGATAAACCTTTTTCAC.
[0030] SEQ ID NO. 8: GTTGGAATTGTGAGCGGAT.
[0031] Table 1 PCR reaction system
[0032] Table 2 PCR reaction procedure
[0033] 4. Plasmid transformation of Agrobacterium The correctly verified recombinant plasmid was transformed into Agrobacterium competent cells.
[0034] (1) Take out Agrobacterium competent cells GV3101 from the -80℃ freezer, add 2 µl of the recombinant vector plasmid during the freeze-thaw process, and place on ice for 5 min; (2) Quick-freeze in liquid nitrogen for 5 min; (3) Water bath at 37℃ for 4.5 min; (4) Place on ice for 5 minutes; (5) Add 800 µl of antibiotic-free LB liquid to a clean bench and shake at 200 rpm for 3-4 h in a constant temperature shaker at 28℃; (6) Centrifuge at 3000 rpm for 3 min; (7) Discard the supernatant in the clean bench, leaving about 100 μl of LB liquid to resuspend the bacterial block. Spread the bacterial solution on LB solid medium containing 50 mg / L kanamycin sulfate (Kana) and 50 mg / L rifampin (Rif), and incubate upside down in a dark incubator at 28°C for 2 days. (8) Select single clones for slurry culture, retain the single clones that are positive for PCR, add an equal volume of 50% glycerol to the bacterial culture, freeze quickly with liquid nitrogen and store at -80℃.
[0035] Example 2: Agrobacterium-mediated genetic transformation of strawberries
[0036] 1. Explant preparation Harvest wild-type strawberry fruits, air-dry them, and then use tweezers to remove the seeds from the surface of the fruits. Place them on filter paper, select about 200 plump seeds, and put them into a 2 ml centrifuge tube.
[0037] Perform the following procedures on a clean bench: Add 1 ml of 75% ethanol to a centrifuge tube, invert for 5 minutes, and then aspirate all the ethanol. Next, add 1 ml of 10% sodium hypochlorite, invert for 8 minutes, and then aspirate the sodium hypochlorite. Add sterile water to the centrifuge tube and wash 7-8 times to remove sodium hypochlorite and avoid residue. After washing, pour the seeds onto sterile filter paper, and use sterile, cooled tweezers to spread the seeds evenly on the surface of MS solid medium in a petri dish. Mark the seeds and place them in a dark incubator at 22°C. After germination, transfer the seeds to tissue culture flasks containing MS solid medium and culture under light. Use young leaves approximately 30 days old with uniform growth and flat surfaces as explants.
[0038] 2. Genetic transformation of Agrobacterium infection (1) Activation of bacterial strain: Agrobacterium containing the strawberry ARF18 gene RNA interference vector was taken out of the -80℃ freezer and streaked on LB solid medium plates containing 50 mg / L Kana and 50 mg / L Rif. The plates were then incubated upside down in a 28℃ dark incubator for 2 days. After single colonies grew, single colonies were picked and placed in LB liquid medium containing antibiotics. The plates were shaken at 200 rpm for 14-16 h at 28℃ until the bacterial solution changed from brownish-red to yellow and the OD value increased. 600 1-2. Pipette 100 μl of the bacterial culture with gentle shaking into 100 ml of LB broth containing antibiotics. Incubate at 28°C and 200 rpm for 13-14 h. Measure the OD. 600 The OD value was approximately 0.5. The shaken bacterial culture was centrifuged at 5000 rpm for 5 min at room temperature, the filtrate was discarded, the bacterial cells were collected and resuspended in sterile MS liquid medium. 600 Adjust to approximately 0.5. Add acetylsuccinone (As) to the resuspended bacterial solution to a final concentration of 100 μM, then place the bacterial solution in a 28°C constant temperature shaker and revive at 100 rpm for 1 h.
[0039] (2) Leaf Infection: Cut uniformly grown, approximately 30-day-old, flat leaves from the tissue culture flask using scissors. Make 3-4 incisions on the underside of the strawberry leaves, perpendicular to the veins, using a scalpel. Place the cut leaves in MS suspension to prevent wilting due to water loss. After cutting the leaves, pour out the MS suspension, add the revived bacterial solution, and incubate at 28℃ in a constant temperature shaker at 100 rpm for 20 min. After infection, pour out the bacterial solution, blot the leaves dry with sterile filter paper, and use tweezers to lay the strawberry leaves flat on the co-culture medium with the underside facing up. Co-culture in the dark for 3 days. The temperature is 22±2℃, the light / dark cycle is 16 / 8 h, and the medium is changed every 15 days.
[0040] (3) Tissue Culture: After co-culture, the explants were transferred to sterile culture medium and cultured under low light for 15 days. After sterile culture, the explants that had grown callus were transferred to selection medium and cultured under light. After two selections, they were transferred to budding medium. When adventitious buds were produced in clusters, the callus tissue containing adventitious buds was divided into several small portions and transferred to tissue culture bottles containing budding medium. When the petioles elongated and the adventitious buds grew, the callus tissue at the base of the adventitious buds was removed and transferred to rooting medium. After developing into complete plants, they were hardened off and transplanted into the soil.
[0041] The culture medium formula used in the experiment is as follows: ①MS solid medium: sucrose 20 g / L, MS medium powder 4.43 g / L, agar 7.6 g / L (MS suspension without agar), pH 5.8; ②LB solid medium: Tryptone 10 g / L, Yeast Extract 5 g / L, Sodium Chloride 10 g / L, Agar 10 g / L (LB liquid medium does not contain agar), pH 7.0; ③ Strawberry co-culture medium: MS medium + 0.2 mg / L IBA (indolebutyric acid) + 2 mg / L TDZ (thiazidone) + 20 mg / L As; ④ Strawberry sterilization medium: MS medium + 0.2 mg / L IBA + 2 mg / L TDZ + 300 mg / L Ti (Temetin); ⑤ Strawberry selection medium: MS medium + 0.2 mg / L IBA + 3 mg / L 6-BA (6-benzylaminopurine) + 300 mg / L Ti + 20 mg / L Kana; ⑥ Strawberry budding medium: MS medium + 0.2 mg / L IBA + 2 mg / L 6-BA + 300 mg / L Ti + 20 mg / L Kana; ⑦ Strawberry rooting medium: MS medium + 0.2 mg / L IBA + 300 mg / L Ti.
[0042] The hormone preparation method used in the experiment is as follows: ①IBA (1 mg / ml): Weigh 0.01 g of indolebutyric acid powder, dissolve it with 50 μl of 1M hydrochloric acid, and bring the volume to 10 ml with sterile distilled water. Store at -20℃ for later use. ②TDZ (2 mg / ml): Weigh 0.02 g of thiabendazole powder, dissolve it with 200 μl of 1M sodium hydroxide solution and 1 ml of anhydrous ethanol, and after it is completely dissolved, make up to 10 ml with sterile distilled water and store at -20℃ for later use. ③As (100 mg / ml): Weigh 0.1 g of acetylsuccinone powder, dilute to 1 ml with DMSO, and store at -20℃ for later use; ④Ti (300 mg / ml): Weigh 3 g of termethin powder, dilute to 10 ml with sterile distilled water, and store at -20℃ for later use; ⑤Kana (100 mg / ml): Weigh 0.5 g of kanamycin sulfate powder, dilute to 5 ml with sterile distilled water, and store at -20℃ for later use; ⑥ Rif (100 mg / ml): Weigh 0.1 g of rifampicin powder, dilute to 1 ml with DMSO, and store at -20℃ for later use; ⑦ 1M Sodium Hydroxide Solution: Weigh 4 g of sodium hydroxide solid, dissolve it in distilled water and bring the volume to 100 ml, then store at room temperature.
[0043] Example 3 Identification of transgenic plants
[0044] 1. X-Gluc screening and identification Leaves from the transgenic T0 generation plants were immersed in GUS staining solution and incubated overnight at 37°C. GUS catalyzes the decomposition of the substrate X-Gluc, which is oxidized to form a blue substance. After GUS staining, the leaves were destained with alcohol. The presence of blue spots on the destained leaves indicates a GUS-positive result, and the plant to which the leaf belongs is a transgenic positive plant. Progeny produced by self-pollination of the T0 generation were all identified using GUS staining solution to determine whether they contained RNA interference fragments.
[0045] 2. RNA interference efficiency verification RNA was extracted from leaves of T0 generation transgenic positive plants and synthesized into cDNA via reverse transcription. A pair of primers was designed on the CDS sequence of ARF18 (upstream primer sequence as shown in SEQ ID NO.9, downstream primer sequence as shown in SEQ ID NO.10). Quantitative PCR analysis was performed using cDNA as a template (qPCR reaction system shown in Table 3, qPCR reaction procedure shown in Table 4). Two... -△△ct The relative expression level of ARF18 in the samples was calculated. Quantitative results showed that the expression levels of ARF18 in the ARF18-RNAi-1 and ARF18-RNAi-7 lines were 6.0% and 3.4% of the wild type, respectively, which were significantly lower than those in the wild type. Figure 1 ).
[0046] SEQ ID NO.9: GATAACACTCCTGCAGGCATAC.
[0047] SEQ ID NO. 10: TCGAACCTCTGGAAACTGGA.
[0048] Table 3 qPCR reaction system
[0049] Table 4 qPCR reaction procedure
[0050] Example 4: Observation on in vitro bud regeneration of strawberry ARF18-RNAi plants
[0051] 1. Leaf regeneration Disinfect the seeds of wild-type and ARF18-RNAi lines 1 and 7 (T1 generation). After the seeds show white leaves, transfer them to tissue culture flasks containing MS medium for culture. When true leaves emerge, identify ARF18-RNAi plants by GUS staining, and retain plants that show positive GUS staining.
[0052] Leaves were selected as explants for in vitro regeneration. Young leaves approximately 30 days old, with uniform growth and flat surfaces were chosen. Using a scalpel, approximately three shallow incisions were made on the underside of the leaf, perpendicular to the veins, while maintaining the leaf edges connected. The cut leaves were placed, underside up, into strawberry callus-inducing medium (CIM), with approximately 20 explants per dish. After 7 days of incubation in the dark, the plants were placed under low light. After 30 days of callus induction culture, the explants were transferred to shoot-inducing medium (SIM), with 10 explants per dish, and cultured under light for 30 days. All dishes were replaced every 15 days.
[0053] The culture medium formula used in the experiment is as follows: CIM: MS medium + 0.2 mg / L IBA + 2 mg / L TDZ.
[0054] SIM: MS medium + 0.2 mg / L IBA + 3 mg / L 6-BA.
[0055] 2. Observation and frequency statistics of in vitro bud regeneration The number of explants with regenerated buds was counted starting from the time the explants were placed into the SIM (day 31 of in vitro regeneration). The count was made once a day, and the regeneration frequency was calculated over a total of 30 days.
[0056] The formula for calculating the regeneration frequency is as follows: Regeneration frequency (%) = Number of explants that undergo bud regeneration / Total number of explants × 100%.
[0057] In vitro regeneration observation of leaves from wild type and ARF18-RNAi-1 and ARF18-RNAi-7 ( Figure 2When in vitro bud regeneration statistics were collected starting on day 31, the regeneration frequency of the wild type was 1.25%, that of ARF18-RNAi-7 was 10.0%, and no in vitro bud regeneration had been observed with ARF18-RNAi-1. In vitro bud regeneration of ARF18-RNAi-1 began on day 33, with a regeneration frequency of 3.33%. The wild type showed a rapid increase in regeneration frequency from day 36 to day 49 of in vitro regeneration, with the frequency rising from 12.1% to 70.5% within 14 days, an increase of 58.4%, averaging 4.17% per day. The regeneration frequency showed no significant change from day 49 to day 51, then increased slowly after day 51, reaching a peak of 92.0% on day 59. After in vitro bud regeneration began on day 33 with ARF18-RNAi-1, the regeneration frequency increased rapidly, reaching 78.8% on day 44, averaging 6.57% per day, a higher growth rate than the wild type. The adventitious shoot regeneration frequency of ARF18-RNAi-1 slowed down after 44 days compared to the earlier period, reaching a peak of 96.8% at 53 days. The regeneration frequency of ARF18-RNAi-7 reached 96.7% at 42 days, with an average daily regeneration frequency of 7.23% between 31 and 42 days, showing a rapid increase. At 46 days, all explants of the ARF18-RNAi-7 line showed detached shoot regeneration. Compared to the wild type, the leaf detached regeneration frequency of the ARF18-RNAi line reached its peak earlier and at a higher peak. Furthermore, at 60 days, the number of adventitious shoots regenerated on a single explant of the ARF18-RNAi plant was greater than that of the wild type. Figure 3 The above results indicate that introducing the strawberry ARF18-RNAi vector into wild-type strawberry can obtain plants with downregulated ARF18 expression. Furthermore, the downregulation of ARF18 expression can increase the frequency of in vitro regeneration of strawberries, shorten the regeneration cycle, and promote in vitro regeneration of strawberries.
[0058] This invention constructs an RNA interference vector for the strawberry ARF18 gene and uses Agrobacterium-mediated genetic transformation to reduce the expression of ARF18 in strawberries, obtaining strawberry materials with high regeneration efficiency, and providing a technical reference for strawberry variety improvement.
[0059] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
[0060] SEQ ID NO.1 Strawberry ARF18 gene sequence SEQ ID NO.2 Strawberry ARF18 CDS sequence SEQ ID NO.3 Amino acid sequence of strawberry ARF18 MEKTLDPQLWHACAGGMVQMPPVNSKVFYFPQGHAEHAQTHVDFPASVRIPSLILCRVAGIRYMADPETDEVLARIRLVPSETNELYNDEGPVDSDGSDNQEKSSSFAKTLTQSDANNGGGFSVPRYCAETIFPRLDYSADPPVQTVIAKDVHGEVWKFRHIYRGTPRRHLLTTGWSTFVNQKKLVAGDSIVFLRSENGDLCVGIRRAKRGLLEGSPESVSAASGWNHGRSGGPPYSGFSVFLKEEESKMGRNGFGNSSESGNVRGGRGGVGGGRVRPEAVVEAASLAEKGQPFEVVFYPRASTPEFCVKASAVRAAVRVQWCSGMRFKMAFETEDCSRISWFMGTITSVQVNDKIRWPNSPWRVLQVTWDEPDLLQNVKCVSPWLIELVSNFPIIHMAPFSPPRKKLRILQHPDFTLDRQLTLPSFSGNPLGSSSPMCCLPDNTPAGIQGARHAQLRISLTNLHFNSKLQSGLFSSSFQRFDQNSRIPNGIRNGDTNSNESLSCSLTMGNSIQNLEKSDNVKKHQFLLFGQPILTEQQMSRSCSSDAVSQVLAGKNLKDENQGRKRFLSVGSDSAIEHWGSLEKSALNKELHVLDLDTGHCKVFMESEDVGRTLDLSALGSYDELDRRLTIMFGLEKPEMLSHVLYRDPTGVVKQTGDEPFGIFKKAAKRLTILTCPANETIGRTWIRGMENAGNGLGASNKTGPLSIFA SEQ ID NO.4 CDS sequence of the ARF18 RNA interference fragment CAAACCCACGTAGACTTCCCGGCCTCCGTCAGAATCCCATCTCTCATTCTCTGCCGGGTCGCCGGAATCCGATACATGGCCGACCCTGAAACCGACGAGGTCTTGGCCAGAATCCGGCTGGTCCCTTCTGAGACCAACGAGCTTTATAATGACGAAGGCCCTGTGGACTCTGATGGGTCTGATAATCAAGAAAAGTCTTCATCTTTCGCTAAGACTCTGACTCAGTCCGACGCCAACAACGGCGGCGGGTTCTCGGTTCCGAGGTACTGCGCTGAGACCATTTTCCCGAGGCTGGACTACTCCGCCGACCCGCCGGTGCAGACGG FaQR intron sequence in vector of SEQ ID NO.5 CATATTATTCAGGTACATTCTGATTTCATTATCTTCCTACTTGGTTAAATTTCAACATGTAATACTATTTTTGGCTTCAAACATTTAAATTAAGGATGTGTACTTTAATGTGATGCAGCTTGCAAAGC RNA interference fragment sequence of ARF18 of SEQ ID NO.6 CAAACCCACGTAGACTTCCCGGCCTCCGTCAGAATCCCATCTCTCATTCTCTGCCGGGTCGCCGGAATCCGATACATGGCCGACCCTGAAACCGACGAGGTCTTGGCCAGAATCCGGCTGGTCCCTTCTGAGACCAACGAGCTTTATAATGACGAAGGCCCTGTGGACTCTGATGGGTCTGATAATCAAGAAAAGTCTTCATCTTTCGCTAAGACTCTGACTCAGTCCGACGCCAACAACGGCGGCGGGTTCTCGGTTCCGAGGTACTGCGCTGAGACCATTTTCCCGAGGCTGGACTACTCCGCCGACCCGCCGGTGCAGACGGCATATTATTCAGGTACATTCTGATTTCATTATCTTCCTACTTGGTTAAATTTCAACATGTAATACTATTTTTGGCTTCAAACATTTAAATTAAGGATGTGTACTTTAATGTGATGCAGCTTGCAAAGCCCGTCTGCACCGGCGGGTCGGCGGAGTAGTCCAGCCTCGGGAAAATGGTCTCAGCGCAGTACCTCGGAACCGAGAACCCGCCGCCGTTGTTGGCGTCGGACTGAGTCAGAGTCTTAGCGAAAGATGAAGACTTTTCTTGATTATCAGACCCATCAGAGTCCACAGGGCCTTCGTCATTATAAAGCTCGTTGGTCTCAGAAGGGACCAGCCGGATTCTGGCCAAGACCTCGTCGGTTTCAGGGTCGGCCATGTATCGGATTCCGGCGACCCGGCAGAGAATGAGAGATGGGATTCTGACGGAGGCCGGGAAGTCTACGTGGGTTTG
Claims
1. ARF18 protein, characterized in that, The amino acid sequence of the ARF18 protein is shown in SEQ ID NO.
3.
2. The ARF18 gene encoding the ARF18 protein of claim 1, characterized in that, The nucleotide sequence of the ARF18 gene is selected from either 1) or 2). 1) The nucleotide sequence is as shown in SEQ ID NO.1, representing the strawberry ARF18 genome sequence; 2) The nucleotide sequence is the strawberry ARF18CDS sequence shown in SEQ ID NO.
2.
3. The RNA interference sequence of the ARF18 gene, characterized in that, The nucleotide sequence of the RNA interference sequence is shown in SEQ ID NO.
6.
4. An interference vector for the ARF18 gene, characterized in that, The interference vector is obtained by inserting the RNA interference sequence of claim 3 into the Sal I restriction site of the pCAMBIA-2300GN-35-35 plasmid.
5. Transgenic engineered bacteria transfected with the interference vector described in claim 4.
6. The application of the ARF18 protein of claim 1, or the ARF18 gene of claim 2, or the RNA interference sequence of claim 3, or the interference vector of claim 4, or the transgenic engineered bacteria of claim 5 in improving the regeneration efficiency of strawberry detached buds or cultivating new strawberry germplasm with high regeneration efficiency.
7. The application according to claim 6, characterized in that, Reduce the expression level of ARF18 protein in strawberry plants or isolated tissues, or knock down the ARF18 gene in strawberry plants or isolated tissues, or introduce the RNA interference sequence, the interference vector, or the transgenic engineered bacteria into strawberry plants or isolated tissues to improve the regeneration efficiency of strawberry isolated buds or cultivate new strawberry germplasm with high regeneration efficiency.