Salmonella and anti-inflammatory repair function of lactobacillus salivarius and its application

By screening and identifying Lactobacillus salivarius ZY-01, the problems of poor resistance and limited function of existing strains have been solved. It has achieved targeted inhibition of Salmonella typhimurium and improvement of intestinal health, and is suitable for microecological preparations and veterinary drugs in animal breeding.

CN122104522APending Publication Date: 2026-05-29YANGLING ZHONGYOU LIFE SCIENCES CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
YANGLING ZHONGYOU LIFE SCIENCES CO LTD
Filing Date
2026-03-25
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing strains of Lactobacillus salivarius have poor resistance, weak antibacterial targeting, and limited function, making them unable to effectively prevent Salmonella typhimurium infection and improve animal gut health.

Method used

A strain of Lactobacillus salivarius ZY-01 was screened and identified, which has significant inhibitory activity against Salmonella typhimurium, good intestinal adhesion and anti-inflammatory repair function. It can stably colonize in the animal intestine and regulate the expression of inflammatory factors by inhibiting the JAK-STAT signaling pathway. It can be prepared as bacterial solution, bacterial powder or fermentation product for animal breeding.

Benefits of technology

Lactobacillus salivarius ZY-01 significantly inhibits Salmonella typhimurium, improves intestinal health in animals, enhances immunity, and reduces the risk of antibiotic use. It is suitable for the preparation of probiotics and veterinary drugs and is widely used in cattle, sheep, pigs, and poultry farming.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a lactobacillus salivarius ZY-01 with anti-salmonella and anti-inflammatory repair functions, the strain has been preserved in the China General Microbiological Culture Collection Center on March 9, 2026, and the preservation number is CGMCC No. 37873. The strain can inhibit salmonella, escherichia coli and staphylococcus aureus, can reduce the expression of IL-6, IFN-gamma and TNF-alpha pro-inflammatory factors by inhibiting the JAK-STAT signal pathway, and can promote the expression of IL-10 anti-inflammatory factors and EGF, EGFR and TGF-beta1 mucosal repair factors, so that intestinal anti-inflammation and mucosal repair are realized. The lactobacillus salivarius ZY-01, bacterial liquid, bacterial powder and fermentation product thereof can be used as core raw materials of animal feed additives, micro-ecological preparations and veterinary drugs, are used for preventing and controlling salmonella infection and improving intestinal health of animals in animal breeding, and have a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a strain of Lactobacillus salivarius ZY-01 with anti-Salmonella and anti-inflammatory repair functions, and also to the application of this strain and its bacterial solution, bacterial powder, and fermentation products in animal husbandry. Background Technology

[0002] Salmonella typhimurium is a typical zoonotic pathogen that can infect animals through contaminated feed and water, causing gastrointestinal inflammation with symptoms such as vomiting, diarrhea, and fever. In severe cases, it can lead to septicemia, causing significant economic losses to livestock production and threatening human public health through the food chain. Currently, the main method for controlling Salmonella typhimurium infection in livestock production is the use of antibiotics. However, long-term and excessive use of antibiotics leads to the continuous emergence of drug-resistant Salmonella strains, disrupts the balance of intestinal flora in animals, reduces animal immunity, and results in antibiotic residues in livestock products, contradicting the industry's development needs for green and antibiotic-free farming. Probiotics, as safe and highly effective microecological preparations, can improve animal intestinal health by colonizing the gut, inhibiting the growth of pathogenic bacteria, and regulating the balance of intestinal flora, making them a core alternative to antibiotics. Lactobacillus salivarius is a beneficial probiotic found in the animal gut. It has been proven to have potential functions in regulating immunity, inhibiting pathogenic bacteria, and protecting the intestinal barrier. However, the functions of probiotics are strain-specific. Lactobacillus salivarius from different sources varies significantly in terms of stress resistance, antibacterial activity, intestinal colonization ability, and anti-inflammatory and repair functions. Existing Lactobacillus salivarius strains suffer from poor stress resistance, weak antibacterial targeting, and limited functionality, failing to meet the practical needs of livestock production for preventing Salmonella infection and improving intestinal health. Therefore, screening for a Lactobacillus salivarius strain that targets and inhibits Salmonella typhimurium, exhibits strong stress resistance, good intestinal adhesion and colonization ability, high biosafety, and also possesses anti-inflammatory and repair functions, is of significant practical importance and application value for developing novel animal microecological preparations, promoting antibiotic-free farming, and ensuring livestock production and public health safety. Summary of the Invention

[0003] To address the problems and deficiencies in the existing technologies, the present invention aims to provide a strain of Lactobacillus salivarius ZY-01 with anti-Salmonella and anti-inflammatory repair functions, thereby solving the problems of poor stress resistance, weak antibacterial targeting, and single function of existing probiotic strains; at the same time, it provides the application of this strain, providing new microbial resources and solutions for the prevention and control of Salmonella infection and the improvement of animal intestinal health in animal husbandry.

[0004] The Lactobacillus salivarius ZY-01 of this invention was deposited on March 9, 2026, at the China General Microbiological Culture Collection Center (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 37873.

[0005] This strain was isolated from the feces of healthy calves (1 month old and not given antibiotics). Gram staining, biochemical identification, and 16S rDNA gene sequence analysis confirmed it to be *Lactobacillus salivarius*. This strain is a Gram-positive, non-spore-forming, rod-shaped bacterium that can be arranged singly or in pairs. It exhibits significant inhibitory activity against *Salmonella typhimurium*, excellent stress resistance, good intestinal adhesion, and high biocompatibility. It also possesses intestinal anti-inflammatory and mucosal repair functions.

[0006] This invention protects Lactobacillus salivarius ZY-01 itself, and also protects the application of this strain in the preparation of animal husbandry products related to anti-Salmonella, anti-inflammatory repair, and improvement of intestinal health. The specific technical solution is as follows: 1. Physicochemical and biological characteristics of Lactobacillus salivarius ZY-01: This strain exhibits targeted inhibition of Salmonella typhimurium, while also inhibiting common intestinal pathogens such as Escherichia coli and Staphylococcus aureus; it demonstrates excellent stress resistance, tolerating the acidic and bile salt environments of the animal gastrointestinal tract and the high-temperature environment of feed processing; it has good adhesion, allowing for stable colonization in the animal intestine; it has high biocompatibility and is non-toxic to animals; it also possesses anti-inflammatory and repair functions, regulating the expression of inflammatory factors and promoting the secretion of intestinal mucosal repair factors by inhibiting the JAK-STAT signaling pathway.

[0007] 2. Application of Lactobacillus salivarius ZY-01 This strain has a growth rate of 1×10 9 CFU / kg is used in animal husbandry and can be used alone or in combination with acceptable excipients to prepare animal microecological preparations, feed additives, and veterinary drugs. Its application forms include live bacterial strains, bacterial suspensions, bacterial powders, or fermentation products, among which: - Bacterial suspension: A bacterial suspension of *Lactobacillus salivarius* ZY-01 cultured anaerobically at 37°C for 12-24 hours in MRS liquid medium, with a live bacterial concentration of 1×10⁻⁶. 9 CFU / mL; - Bacterial powder: The dry powder obtained by centrifuging and freeze-drying the above bacterial solution, with a viable count ≥1×10⁻⁶. 11 CFU / g; - Fermentation product: fermentation supernatant of Lactobacillus salivarius ZY-01 after anaerobic culture on MRS medium, or whole-cell fermentation product containing bacterial cells and supernatant.

[0008] 3. Product Application Areas The Lactobacillus salivarius ZY-01 of the present invention, as well as its bacterial solution, powder, and fermentation products, can be used to prepare animal microecological preparations for inhibiting Salmonella typhimurium, animal microecological preparations / feed additives for improving intestinal health, and animal anti-inflammatory and intestinal mucosal repair veterinary drugs / microecological preparations. They are suitable for livestock and poultry farming such as cattle, sheep, pigs, and poultry, and can effectively prevent Salmonella infection, improve animal intestinal health, and enhance animal immunity.

[0009] The Lactobacillus salivarius ZY-01 of the present invention and its application have the following beneficial effects: 1. Targeted inhibition of Salmonella Typhimurium with significant antibacterial effect: The inhibition zone diameter of this strain against Salmonella Typhimurium is 22.2±0.51mm, which is much higher than that of conventional probiotics. At the same time, it can also inhibit Escherichia coli and Staphylococcus aureus, providing new microbial resources for the prevention of various intestinal pathogens in livestock production. It can effectively reduce the use of antibiotics and reduce the risk of drug-resistant strains.

[0010] 2. Excellent stress resistance, suitable for practical production applications: This strain can tolerate a strongly acidic environment of pH 1.0 and a bile salt environment of 0.3%. It has a 100% survival rate after being treated at 60℃ for 5 minutes. It also maintains a high survival rate in artificial gastric / intestinal fluid. It can tolerate the high temperature environment of feed processing and storage as well as the harsh environment of animal gastrointestinal tract, ensuring its activity in practical applications.

[0011] 3. Good adhesion and stable colonization in the intestine: The hydrophobicity of this strain is 39.33±0.3% and the self-aggregation rate is 59.23±0.2%, which means it has good intestinal mucosal adhesion and self-aggregation ability. It can stably colonize and reproduce in the animal intestine and continuously exert antibacterial, anti-inflammatory and repair physiological functions, avoiding functional failure due to poor colonization ability.

[0012] 4. High biosafety and no application risk: The SPF-grade Kunming mouse safety test verified that the strain had no significant adverse effects on the weight, blood routine and organ index of the test animals. There were no visible lesions in the organs. It is non-toxic and can be safely applied in the field of livestock and poultry breeding. There are no residues and no side effects.

[0013] 5. Comprehensive functions, combining anti-inflammatory and mucosal repair: This strain is not simply an antibacterial strain. It can also reduce the expression of pro-inflammatory factors IL-6, IFN-γ, and TNF-α by inhibiting the JAK-STAT signaling pathway, promote the secretion of anti-inflammatory factor IL-10, and upregulate the expression of intestinal mucosal repair factors such as EGF, EGFR, and TGF-β1. This achieves a synergistic effect of "antibacterial-anti-inflammatory-repair", fundamentally improving animal intestinal health and enhancing animal immunity.

[0014] 6. Diverse application forms and simple preparation process: This strain can be prepared into various forms such as bacterial liquid, bacterial powder, and fermentation products, which are suitable for the production needs of different products such as microecological preparations, feed additives, and veterinary drugs. Moreover, the preparation process is simple, the cost is low, and it is easy to industrialize and promote its application. Attached Figure Description

[0015] The present invention will be further described below with reference to the accompanying drawings, in which LGG is Lactobacillus rhamnosus, used as a control probiotic strain; p<0.05 indicates significant difference, p<0.01 indicates extremely significant difference, p<0.001 indicates extremely significant difference, and ns indicates no significant difference (p>0.05).

[0016] Figure 1 Gram-stained photomicrograph (1000×) of Lactobacillus salivarius ZY-01. This strain is Gram-positive, non-spore-forming, rod-shaped, and arranged singly or in pairs.

[0017] Figure 2 The image shows the inhibition zone of Lactobacillus salivarius ZY-01 against Salmonella typhimurium. ZY-01 is the experimental group, with a significant inhibition zone of 22.2 ± 0.51 mm in diameter. C is the blank control group (MRS culture medium without inoculation), with no inhibition zone.

[0018] Figure 3 The graph shows the survival rate of Lactobacillus salivarius ZY-01 in different environments. A represents the survival rate under different pH conditions, and B represents the survival rate under different bile salt concentrations. This strain maintains a high survival rate at pH 1.0 / 3.0 and bile salt concentrations of 0.1%-0.3%.

[0019] Figure 4 The graph shows the survival rate of Lactobacillus salivarius ZY-01 in artificial gastrointestinal fluid. A represents the survival rate after 3 hours of incubation at 37°C in artificial gastric fluid, and B represents the survival rate after 3 hours of incubation at 37°C in artificial intestinal fluid. This strain exhibits good tolerance in artificial gastrointestinal fluid.

[0020] Figure 5 The image shows the adhesion test results of Lactobacillus salivarius ZY-01. A represents the hydrophobicity test result, and B represents the self-aggregation test result. This strain has good hydrophobicity and self-aggregation ability.

[0021] Figure 6 The figure shows the effect of Lactobacillus salivarius ZY-01 on the expression levels of inflammatory and repair factors in mouse serum. C+ represents the positive control group, ZY-01 represents the experimental group, and C- represents the blank control group. The expression of pro-inflammatory factors was significantly reduced and the expression of repair factors was significantly increased in the experimental group.

[0022] Figure 7The figure shows the effect of Lactobacillus salivarius ZY-01 on the expression levels of JAK-STAT pathway-related factors and repair factors in mouse jejunal tissue. C+ represents the positive control group, ZY-01 represents the experimental group, and C- represents the blank control group. The JAK-STAT pathway was significantly inhibited and the expression of repair factors was significantly increased in the experimental group. Detailed Implementation

[0023] The present invention will be further described in detail below with reference to specific embodiments. The scope of protection of the present invention is not limited to the following embodiments, and all technical solutions based on the present invention are within the scope of protection of the present invention.

[0024] Example 1: Isolation and Identification of Lactobacillus salivarius ZY-01 1. Sample collection: Collect 10g of fresh fecal samples from each of 20 healthy calves (1 month old and not given antibiotics), place them in sterile centrifuge tubes, add 25% glycerol, store at low temperature, and bring them back to the laboratory for processing.

[0025] 2. Strains Isolation: Add 9 mL of sterile physiological saline to the fecal sample and shake well to prepare 10. -1 The diluent was serially diluted to 10. -6 10 -7 10 -8 Take 0.1 mL of each dilution of bacterial culture, spread it on MRS solid medium, and incubate anaerobically at 37°C for 48 h. 3. Strain purification: Select typical single colonies that are round, milky white, with neat edges, smooth surface, and a diameter of 1-2 mm from MRS medium, inoculate them into MRS liquid medium, and anaerobically culture them at 37℃ for 24 h. After three streak purifications, pure culture strains are obtained.

[0026] 4. Strain identification (1) Gram staining: Take a smear of pure culture strain, stain it with Gram stain and examine it under a microscope (1000×). The strain was observed to be Gram-positive, non-spore-forming, rod-shaped, and arranged singly or in pairs. Figure 1 ).

[0027] (2) Biochemical identification: The bacterial micro-biochemical reaction tube was used for detection. This strain can ferment raffinose, sorbitol, maltose, sucrose, rhamnose, melibiose and lactose, but does not ferment aescin, arabinose, melitriose and xylose, which is consistent with the biochemical characteristics of the Lactobacillus salivarius model strain.

[0028] (3) 16S rDNA gene sequence analysis: Genomic DNA of the strain was extracted and PCR amplified using universal primers for bacterial 16S rDNA (27F: AGAGTTTGATCCTGGCTCAG; 1492R: GGTTACCTTGTTACGACTT). After sequencing the PCR product, the homology was compared with that of the GenBank database. The results showed that the homology of this strain with the Lactobacillus salivarius model strain was >99.9%, and it was identified as Lactobacillus salivarius, named Lactobacillus salivarius ZY-01.

[0029] Example 2: Detection of antibacterial activity of Lactobacillus salivarius ZY-01 1. Test strains: Lactobacillus salivarius ZY-01 of the present invention; Salmonella typhimurium S-9, Escherichia coli, and Staphylococcus aureus (preserved in this laboratory).

[0030] 2. Culture media: MRS liquid / solid medium (for culturing Lactobacillus salivarius); LB liquid / solid medium (for culturing pathogenic bacteria).

[0031] 3. Preparation of bacterial culture: Lactobacillus salivarius ZY-01 was inoculated into MRS liquid medium and cultured anaerobically at 37°C for 12 h for later use; pathogenic bacteria were inoculated into LB liquid medium and cultured with shaking at 37°C for 12 h, and then diluted with physiological saline to 1×10. 8 CFU / mL, for later use 4. Oxford cup method for antibacterial test: Melt LB solid medium and pour 20 mL into 90 mm petri dishes, and let cool and solidify; take 100 μL of pathogenic bacterial suspension and spread it evenly on the surface of LB medium. After the bacterial suspension is absorbed, place it into a 6 mm Oxford cup; add 100 μL of Lactobacillus salivarius ZY-01 bacterial suspension to the Oxford cup, and use uninoculated MRS culture medium as a blank control; after incubation at 37℃ for 24 h, measure the diameter of the inhibition zone with vernier calipers. Each treatment is repeated 3 times and the average value is taken.

[0032] 5. Experimental Results: The inhibition zone diameter of Lactobacillus salivarius ZY-01 against Salmonella typhimurium was 22.2 ± 0.51 mm. Figure 2 The inhibition zone diameters of Escherichia coli and Staphylococcus aureus were 19.14±0.05 mm and 16.22±0.03 mm, respectively, while the blank control group showed no inhibition zone. This indicates that the strain has a significant targeted inhibitory effect on Salmonella typhimurium and can also inhibit Escherichia coli and Staphylococcus aureus (see Table 1).

[0033] Table 1 Lactobacillus salivarius Lactobacillus salivarius ZY-01 exhibits inhibition zone diameters against Salmonella Typhimurium, Escherichia coli, and Staphylococcus aureus.

[0034] Example 3: Stress resistance detection of Lactobacillus salivarius ZY-01 1. Acid-base tolerance test: *Lactobacillus salivarius* ZY-01 was inoculated into MRS liquid medium and anaerobically cultured at 37℃ for 24 h to obtain seed culture; the seed culture was inoculated into MRS liquid medium at pH 1.0, 3.0, 5.0, and 6.0, and cultured at 37℃ for 12 h. The survival rate was calculated using the plate count method. The results showed ( Figure 3 (A) This strain has a survival rate of ≥60% under pH 1.0 and 3.0 conditions, and exhibits good acid resistance.

[0035] 2. Bile salt tolerance test: Bovine bile salts were prepared into MRS liquid culture media at concentrations of 0.1%, 0.2%, and 0.3% (m / v) and autoclaved. Lactobacillus salivarius ZY-01 seed culture was transferred to the above culture media at an inoculation rate of 1% (v / v) and cultured at 37℃ and 200 rpm for 12 h. Survival rate was calculated using the plate count method. The results showed ( Figure 3 (B) This strain has a 100% survival rate in 0.1% bile salts, a ≥70% survival rate in 0.2% bile salts, and a ≥40% survival rate in 0.3% bile salts, demonstrating good bile salt tolerance.

[0036] 3. Gastrointestinal fluid tolerance test: Artificial gastric fluid (pH 3.0, containing 1 g / 100 mL pepsin) and artificial intestinal fluid (pH 6.8, containing 1% trypsin) were sterilized by filtration through a 0.22 μm microporous membrane; the seed culture was inoculated into the artificial gastric fluid and artificial intestinal fluid at a 1% (v / v) inoculation rate, and cultured at 37℃ with shaking for 3 h. The survival rate was calculated by plate counting method; the results showed ( Figure 4 This strain has a survival rate of ≥30% in artificial gastric fluid and ≥60% in artificial intestinal fluid, and can tolerate the animal gastrointestinal environment.

[0037] 4. High-temperature tolerance test: Lactobacillus salivarius ZY-01 bacterial suspension was placed in water baths at 40℃, 50℃, 60℃, 70℃ and 80℃ for 5 min, respectively, and then cultured in a shaker at 37℃ and 200 rpm for 16 h before plate counting. The results showed that the survival rate of this strain was 100% after treatment at 60℃, and the survival rate decreased significantly above 70℃, indicating good high-temperature tolerance and the ability to withstand the conventional high temperatures of feed processing.

[0038] Example 4 Adhesion detection of Lactobacillus salivarius ZY-01 1. Hydrophobicity determination: Lactobacillus salivarius ZY-01 was anaerobically cultured in MRS medium at 37℃ for 24 h, and the bacterial cells were collected by centrifugation at 8000 r / min for 10 min; the cells were washed twice with PBS buffer at pH 7.2, resuspended, and the OD600 of the bacterial suspension was adjusted to 1.0; 3 mL of the bacterial suspension was taken and 1 mL of n-hexadecane was added, shaken for 2 min, and allowed to stand at room temperature for 30 min. The OD600 (OD1) of the upper aqueous phase was measured, with the bacterial suspension without n-hexadecane as the control (OD0); hydrophobicity = (1-OD1 / OD0) × 100%, and each treatment was repeated 3 times; the results showed ( Figure 5 (A) The hydrophobicity of this strain is 39.33±0.3%, indicating good hydrophobicity.

[0039] 2. Self-aggregation rate determination: *Lactobacillus salivarius* ZY-01 bacterial suspension was centrifuged at 2654 × g for 10 min, and the bacterial cells were collected and washed twice with PBS buffer at pH 7.2. The suspension was resuspended and the OD600 was adjusted to 1.0 (A0). After standing at room temperature for 6 h, the OD600 (At) was measured. Self-aggregation rate = (1 - At / A0) × 100%, with each treatment repeated three times. The results showed ( Figure 5 (B) The self-aggregation rate of this strain is 59.23±0.2%, which is excellent, and it can aggregate and colonize in the intestine.

[0040] Example 5: Biosafety Detection of Lactobacillus salivarius ZY-01 1. Experimental animals: 16 SPF-grade Kunming mice, weighing 18-22g, half male and half female.

[0041] 2. Experimental grouping: The animals were randomly divided into an experimental group and a blank control group, with 8 animals in each group; the experimental group was given Lactobacillus salivarius ZY-01 bacterial suspension (1×10) by gavage. 9 CFU / mL), 0.3 mL each time, once daily; the control group was given an equal volume of normal saline by gavage for 14 consecutive days. 3. Observation indicators: The mice's mental state, diet and defecation were observed daily; after 14 days of gavage, blood was collected from the orbital venous plexus for routine blood tests; after fasting for 12 hours, the mice were euthanized by cervical dislocation, and the heart, liver, spleen, lungs and kidneys were collected. The organ index was calculated (organ index = organ weight (g) / body weight (g) × 100%), and the organ morphology was observed.

[0042] 4. Experimental Results: No mice died during the experiment, and their mental state, diet, and defecation were normal. There were no significant differences in blood routine indicators and organ indices between the experimental group and the blank control group (p>0.05). No visible lesions were found in the organs of the experimental group mice, indicating that the strain was non-toxic and had good biosafety. Example 6: Detection of in vivo anti-inflammatory and mucosal repair functions of Lactobacillus salivarius ZY-01 1. Experimental animals: 24 SPF-grade Kunming mice, weighing 18-22g, were randomly divided into a blank control group (C-), a positive control group (C+), and an experimental group (ZY-01), with 8 mice in each group.

[0043] 2. Experimental method: The experimental group was continuously administered Lactobacillus salivarius ZY-01 bacterial suspension (1×10) by gavage at a dose of 0.1 mL / 10 g body weight. 9 On day 7, 0.5 mL of Salmonella Typhimurium S-9 bacterial suspension (1×10⁻⁶ CFU / mL) was administered by gavage on day 8. 9 The control group was administered an equal volume of physiological saline by gavage for 8 consecutive days; the positive control group was administered an equal volume of physiological saline by gavage for 7 consecutive days, and on the 8th day, an equal volume of Salmonella Typhimurium S-9 bacterial suspension was administered by gavage. Clinical symptoms of mice were observed and recorded. 3. Sample collection: All mice were euthanized by cervical dislocation on day 9, and serum, jejunum, and ileum tissues were collected. The jejunum and ileum tissues were rinsed with physiological saline and used for pathological sectioning, immunohistochemistry, and quantitative real-time PCR detection.

[0044] 4. Indicator Testing (1) Detection of serum inflammatory factors and repair factors: The expression levels of IFN-γ, IL-6, TNF-α, IL-10, EGF and EGFR in serum were measured using an ELISA kit.

[0045] (2) Detection of TGF-β1 in jejunal tissue: The expression of TGF-β1 in jejunal tissue was detected by immunohistochemistry.

[0046] (3) Detection of gene expression in jejunal tissue: The relative expression levels of JAK1, STAT1, IFN-γ, IL-6, TNF-α, IL-10, EGF and EGFR were calculated by quantitative real-time PCR with β-actin as the internal reference gene and 2^-ΔΔCt method.

[0047] 5. Experimental Results: Compared with the positive control group, the clinical symptoms of mice in the experimental group were significantly alleviated; the expression levels of pro-inflammatory factors IL-6, IFN-γ, and TNF-α in serum were significantly decreased, while the expression levels of anti-inflammatory factor IL-10 and repair factors EGF and EGFR were significantly increased. Figure 6 The expression levels of JAK1 and STAT1, genes related to the JAK-STAT pathway, were significantly decreased in jejunal tissue; the expression levels of pro-inflammatory factors were significantly decreased; and the expression levels of anti-inflammatory factors and repair factors EGF, EGFR, and TGF-β1 were significantly increased. Figure 7 This indicates that Lactobacillus salivarius ZY-01 can exert anti-inflammatory effects by inhibiting the JAK-STAT signaling pathway, while promoting the expression of intestinal mucosal repair factors, thereby achieving intestinal anti-inflammatory and mucosal repair.

[0048] Example 7 Preparation of Lactobacillus salivarius ZY-01 bacterial powder 1. Seed culture: Lactobacillus salivarius ZY-01 was inoculated into MRS liquid medium and cultured anaerobically at 37°C for 12 h to obtain primary seed culture; the primary seed culture was transferred to MRS liquid medium at an inoculation rate of 1% (v / v) and cultured anaerobically at 37°C for 24 h to obtain secondary seed culture.

[0049] 2. Fermentation culture: The secondary seed culture was transferred to the fermenter at an inoculation rate of 2% (v / v) and cultured anaerobicly at 37℃ for 36 hours, with the pH controlled at 6.0-6.5, to obtain the fermentation culture.

[0050] 3. Cell collection: The fermentation broth was centrifuged at 8000 r / min for 20 min, and the cells were collected and washed twice with PBS buffer at pH 7.2.

[0051] 4. Freeze-drying: The bacterial cells were resuspended in 10% skim milk powder as a preservative, placed in a freeze dryer, pre-frozen at -40℃ for 4 hours, and then freeze-dried under vacuum for 24 hours to obtain Lactobacillus salivarius ZY-01 bacterial powder with a viable count ≥1×10⁻⁶. 11 CFU / g.

[0052] This bacterial powder can be directly added to livestock and poultry feed as a feed additive, with a dosage of 1×10⁻⁶. 9 It can be formulated with CFU / kg feed or combined with maltodextrin, corn starch and other excipients to prepare animal microecological preparations. The Lactobacillus salivarius ZY-01 strain of this invention exhibits significant anti-Salmonella activity and anti-inflammatory repair functions, with excellent stress resistance, high biosafety, and good adhesion. Its bacterial suspension and powder preparation processes are simple and easy for industrial production. This strain and its preparations can be widely used in livestock and poultry farming, such as cattle, sheep, pigs, and poultry, as feed additives, microecological preparations, and veterinary drugs to replace antibiotics for the prevention and control of Salmonella infection, improving animal intestinal health. It has significant economic and social benefits and remarkable industrial applicability.

[0053] This invention is not limited to the above embodiments. Any non-substantial changes made by those skilled in the art based on this invention are within the scope of protection claimed by this invention.

Claims

1. Lactobacillus salivarius ZY-01, with accession number CGMCC No.37873.

2. The use of Lactobacillus salivarius ZY-01 as described in claim 1 in the preparation of anti-Salmonella or anti-inflammatory repair products for animal husbandry.

3. The application according to claim 2, characterized in that, The Lactobacillus salivarius ZY-01 has the following physicochemical and biological characteristics: (1) It has an inhibitory effect on Salmonella Typhimurium, Escherichia coli and Staphylococcus aureus. The diameter of the inhibition zone on Salmonella Typhimurium is 22.2±0.51mm, and the diameters of the inhibition zones on Escherichia coli and Staphylococcus aureus are 19.14±0.05mm and 16.22±0.03mm, respectively. (2) Acid and alkali tolerance: The survival rate after static incubation at 37℃ for 12 hours under pH conditions of 1.0 and 3.0 was ≥60%; (3) Gastrointestinal fluid tolerance: The survival rate after static culture at 37°C for 3 hours in artificial gastric fluid was ≥30%, and the survival rate after static culture at 37°C for 3 hours in artificial intestinal fluid was ≥60%; (4) High temperature tolerance: The survival rate was 100% after treatment at 60℃ for 5 min; (5) Adhesion: Hydrophobicity was 39.33±0.3%, and self-polymerization rate was 59.23±0.2%; (6) Biosafety: It is non-toxic to test animals and has no significant adverse effects on the weight and organ index of test animals; (7) Anti-inflammatory and repair activity: It can reduce the expression of IL-6, IFN-γ and TNF-α in the JAK-STAT signaling pathway and promote the expression of IL-10, EGF, EGFR and TGF-β1.

4. The use of Lactobacillus salivarius ZY-01 as described in claim 1 or 2, or its bacterial suspension, powder, or fermentation product, in the preparation of a microecological preparation for inhibiting Salmonella typhimurium in animals.

5. The use of Lactobacillus salivarius ZY-01 as described in claim 1 or 2, or its bacterial culture, powder, or fermentation product, in the preparation of microecological preparations or feed additives for improving intestinal health in animals.

6. The use of Lactobacillus salivarius ZY-01 as described in claim 1 or 2, or its bacterial culture, powder, or fermentation product, in the preparation of veterinary drugs or microecological preparations for animal anti-inflammatory and intestinal mucosal repair purposes.

7. The application according to claim 4, characterized in that, The bacterial solution was a bacterial suspension of Lactobacillus salivarius ZY-01 cultured anaerobically on MRS medium, with a concentration of 1×10⁻⁶. 9 CFU / mL; the bacterial powder is a dry powder obtained by freeze-drying the bacterial solution, with a viable count ≥1×10⁻⁶. 11 CFU / g; the fermentation product is the fermentation supernatant or whole-cell fermentation product of Lactobacillus salivarius ZY-01.

8. The application according to claim 5, characterized in that, The bacterial solution was a bacterial suspension of Lactobacillus salivarius ZY-01 cultured anaerobically on MRS medium, with a concentration of 1×10⁻⁶. 9 CFU / mL; the bacterial powder is a dry powder obtained by freeze-drying the bacterial solution, with a viable count ≥1×10⁻⁶. 11 CFU / g; the fermentation product is the fermentation supernatant or whole-cell fermentation product of Lactobacillus salivarius ZY-01.

9. The application according to claim 6, characterized in that, The bacterial solution was a bacterial suspension of Lactobacillus salivarius ZY-01 cultured anaerobically on MRS medium, with a concentration of 1×10⁻⁶. 9 CFU / mL; the bacterial powder is a dry powder obtained by freeze-drying the bacterial solution, with a viable count ≥1×10⁻⁶. 11 CFU / g; the fermentation product is the fermentation supernatant or whole-cell fermentation product of Lactobacillus salivarius ZY-01.