Tea plant miRNA PC-5p-680261 and its application and methods in improving plant disease resistance
By constructing a silencing or overexpression vector for miRNA PC-5p-680261 in tea plants, the plant's disease resistance can be regulated, solving the problem of leaf diseases in tea plants, achieving efficient disease-resistant breeding, overcoming the shortcomings of chemical pesticides, and having broad market application prospects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUIZHOU UNIV
- Filing Date
- 2026-04-02
- Publication Date
- 2026-05-29
AI Technical Summary
In existing technologies, tea leaf diseases are caused by pathogenic fungi, leading to a decline in yield and quality. The use of chemical pesticides has problems with residues and resistance. Research on miRNAs in tea trees using genetic engineering technology is relatively scarce.
By constructing a silencing expression vector for miRNA PC-5p-680261 and transferring it into tobacco to reduce its expression or overexpress miRNA PC-5p-680261, the plant's disease resistance can be regulated, and highly disease-resistant plants can be cultivated using genetic engineering techniques.
It significantly improves the resistance of tobacco and tea trees to Botrytis cinerea, simplifies the breeding process, shortens the breeding cycle, is easy to operate, and makes it easy to obtain highly resistant materials.
Smart Images

Figure CN122104708A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biology and genetic engineering, specifically relating to tea plant miRNA PC-5p-680261 and its application and methods in improving plant disease resistance. Background Technology
[0002] Tea (Camellia sinensis (L.) O. Kuntze) is a perennial evergreen shrub or small tree, used as an important economic crop. Our research group has isolated and identified several pathogenic fungi from tea leaves in various regions, including *Botrytis cinerea*, *Lasiodiplodia theobromae*, *Didymellasegeticola*, and *Epicoccum sorghinum*, which can cause diseases in tea leaves. These pathogenic fungi have a serious impact on the yield and quality of tea leaves. Previously, fungicides and other chemical pesticides were mainly used to control fungal diseases in crops. However, safety issues such as pesticide residues, damage to non-target organisms, and increased fungal resistance have led the scientific community to pay increasing attention to the use of pesticides. Developing plants with high resistance to fungal diseases through genetic engineering technology can serve as an effective way to control fungal diseases in crops.
[0003] miRNAs are endogenous non-coding small RNAs that regulate gene expression at the post-transcriptional level, participating in physiological processes such as cell cycle, apoptosis, development, differentiation, and metabolism. Research on miRNAs in tea plants is relatively scarce. This invention provides a tea plant miRNA, PC-5p-680261, which plays an important role in plant disease resistance. Summary of the Invention
[0004] In view of this, one of the objectives of the present invention is to provide a miRNA PC-5p-680261 molecule, wherein the nucleotide sequence of the mature form of the miRNA PC-5p-680261 is shown in SEQ ID NO.1, and the nucleotide sequence of the mature form is AGAGCUCGGAUCGAAUCGGUC, or the nucleotide sequence of the precursor of the miRNA PC-5p-680261 is shown in SEQ ID NO.2.
[0005] The second objective of this invention is to provide a miRNA PC-5p-680261 precursor gene, the nucleotide sequence of which is shown in SEQ ID NO.3.
[0006] A third objective of this invention is to provide the application of the molecules or genes described above in regulating plant disease resistance.
[0007] Preferably, the disease resistance is resistance to diseases caused by pathogens including Botrytis cinerea.
[0008] Preferably, the plant includes tobacco or tea tree.
[0009] The fourth objective of this invention is to provide a method for improving plant disease resistance, including the step of reducing the expression of miRNA PC-5p-680261; the nucleotide sequence of said miRNA PC-5p-680261 is shown in SEQ ID NO.1.
[0010] Preferably, the disease resistance is resistance to diseases caused by pathogens including Botrytis cinerea.
[0011] Preferably, the reduction of miRNA PC-5p-680261 expression is achieved by introducing a silencing expression vector into the target plant.
[0012] Preferably, the silencing expression vector includes the pBI121 vector. Other vectors are also possible, such as Ti-type plasmid vectors, viral vectors, etc.
[0013] Preferably, the import is performed via the leaf disc method.
[0014] Preferably, the plant includes tobacco or tea tree.
[0015] The fifth objective of this invention is to provide a plant with high disease resistance, wherein the expression of miRNA PC-5p-680261 in the plant is reduced, and the nucleotide sequence of the miRNA PC-5p-680261 is shown in SEQ ID NO.1.
[0016] This invention constructs a silencing expression vector for miRNA PC-5p-680261 and transforms it into tobacco. Transgenic tobacco plants are obtained through stable genetic transformation, exhibiting strong fungal inhibitory activity against *Botrytis cinerea*. Overexpression of miRNA PC-5p-680261 significantly weakens the plant's resistance to *Botrytis cinerea*. Therefore, miRNA PC-5p-680261 can enhance plant disease resistance. Silencing the expression of miRNA PC-5p-680261 can improve disease resistance in plants such as tobacco, tea, or vegetables, showing broad market application prospects. This invention provides a new method for improving plant resistance to fungal diseases. Cultivating disease-resistant plants through genetic engineering overcomes the shortcomings of traditional breeding methods, shortening the breeding cycle, simplifying the operation, and easily obtaining highly resistant materials. Attached Figure Description
[0017] Figure 1 This is an electrophoretic detection image of the PCR product of the tea plant miRNA PC-5p-680261 precursor gene of the present invention;
[0018] Figure 2 This is a PCR detection image of transgenic tobacco after overexpression of miRNA PC-5p-680261 according to the present invention;
[0019] Figure 3 This is a PCR detection image of transgenic tobacco after silencing miRNA PC-5p-680261 according to the present invention;
[0020] Figure 4 This is a graph showing the results of quantitative fluorescence detection of overexpression or silencing miRNA PC-5p-680261 in this invention;
[0021] Figure 5 This is a diagram showing the resistance of tobacco to Botrytis cinerea after overexpression or silencing of miRNA PC-5p-680261 according to the present invention; wherein, A is a phenotypic diagram of lesions after inoculation with Botrytis cinerea, and B is a comparison diagram of lesion area after inoculation with Botrytis cinerea. Detailed Implementation
[0022] The present invention will be described in detail below with reference to embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of application of the present invention. The present invention is not limited to the following embodiments or examples. Any modifications and variations made without departing from the spirit of the present invention should be included within the scope of the present invention. Unless otherwise specified, the experimental materials or reagents used in the following embodiments are all conventional commercially available products.
[0023] 1. Data: This invention uses Fuding Dabaicha (Camellia sinensis cv. Fuding-dabaicha) as the experimental sample. Tea leaves infected with Lasiodiplodia theobromae are used as the treatment group, and tea leaves not infected with Lasiodiplodia theobromae are used as the control group. The experiment is repeated three times in parallel, and the infection lasts for three days. Small RNAs were extracted using commercial kits and sent to Hangzhou Lianchuan Biotechnology Co., Ltd. for sequencing and differential expression analysis. A new miRNA was identified and named PC-5p-680261.
[0024] The nucleotide sequence of the mature form of miRNA PC-5p-680261 is shown in SEQ ID NO.1, the nucleotide sequence of the precursor of miRNA PC-5p-680261 is shown in SEQ ID NO.2, and the nucleotide sequence of the precursor gene of miRNA PC-5p-680261 is shown in SEQ ID NO.3.
[0025] Unless otherwise specified, all subsequent descriptions of miRNA PC-5p-680261 refer to the mature form, and its sequence is shown in SEQ ID NO.1.
[0026] The nucleotide sequence of the mature form is SEQ ID NO.1: AGAGCUCGGAUCGAAUCGGUC.
[0027] 2. The strain used in this embodiment is Botrytis cinerea, strain number: GZFQ-1 (accession number: CGMCC3.20932). The above strain was isolated and identified by the inventor's team and can be obtained from the National Key Laboratory of Green Pesticides of Guizhou University.
[0028] 3. Preparation of some reagents
[0029] 1) Preparation of LB medium:
[0030] Yeast extract 5 g;
[0031] Tryptone 10 g;
[0032] 10 g of sodium chloride (NaCl);
[0033] For liquid culture medium, place the reagent in a 1 L glass beaker, add 1 L of ddH2O, stir with a glass rod until completely dissolved, and dispense 100 mL of liquid culture medium into 250 mL Erlenmeyer flasks. For solid LB medium, add 1.5 g of agar powder to every 100 mL of liquid LB medium.
[0034] 2) Preparation of 50 mg / mL kanamycin (Kana):
[0035] Dissolve 0.5 g of kanamycin in 10 mL of ddH2O, then filter using an aqueous filter membrane (diameter = 0.22 μm). Store the prepared solution at -20°C.
[0036] Experiment 1: Synthesis, Validation, and Sequence Analysis of the Precursor Gene Sequence and Silent Sequence of miRNA PC-5p-680261
[0037] The gene fragment was directly synthesized into a recombinant plasmid by Sangon Biotech (Shanghai) Co., Ltd. based on the nucleotide sequence of the miRNA PC-5p-680261 precursor gene (as shown in SEQ ID NO.3). The synthesized sequence was then verified to be correct by PCR and sequencing. The verification method was as follows: the recombinant plasmid was used as a template for PCR amplification using primers shown in Table 1. After PCR, 50 μL was excised and purified using a gel, and then 2 μL was subjected to agarose gel electrophoresis. The bands met expectations. Figure 1 The sample was sent to a biotechnology company (Beijing Qingke Biotechnology) for sequencing. The sequencing results confirmed that the synthesized fragment sequence was consistent with the sequence shown in SEQ ID NO.2. Therefore, the recombinant plasmid was used as a template for the amplification of the target gene fragment in the subsequent overexpression vector construction experiment.
[0038] The synthesis, verification, and sequence analysis steps of the silencing sequence of miRNA PC-5p-680261 were the same as those of the precursor gene sequence described above. The nucleotide sequence of the silencing sequence is shown in SEQ ID NO.4. The amplification and sequencing of the synthesized sequence using the primers shown in Table 2 were verified to be correct. Therefore, the recombinant plasmid of the silencing sequence was used as a template for the amplification of the target gene fragment in the subsequent silencing expression vector construction experiment.
[0039] Example 2: Agrobacterium-mediated plant genetic transformation
[0040] 1. Construction of miRNA PC-5p-680261 overexpression vector
[0041] The plant expression vector pBI121 plasmid was extracted using the SanPrep column-based plasmid DNA mini-extraction kit (Shanghai Sangon Biotech) (extraction steps are detailed in the Shanghai Sangon Biotech kit instructions). The vector was linearized by double digestion of two cloning sites, XbaI and SacI. 1 μL of the extracted plasmid was used for 1.5% agarose gel electrophoresis to check its integrity and concentration. The DNA was purified using the Trelief DNA Gel Extraction Kit (Beijing Qingke Biotechnology) (specific steps are detailed in the instructions). The size and concentration of the recovered fragments were determined by 1.5% agarose gel electrophoresis. Homologous recombination primers containing the homologous arms of the pBI121 vector were designed; the primer sequences are shown in Table 1.
[0042] Using the ClonExpress II One Step Cloning Kit (Nanjing Novizan) and its instructions, after determining the concentrations of the vector fragment and the target gene, homologous recombination was performed using the following reagents: 5×CE Ⅱ Buffer (2 μL), Exnase Ⅱ (1 μL), linearized vector (6 μL), and target gene fragment (1 μL). The reaction program was 37℃ for 30 min. After the reaction, the mixture was immediately placed on ice and then transferred to E. coli DH5α. After ligation and transformation, the mixture was plated on LB agar containing Kana antibiotic. The bacterial culture was shaken for 12 h and then analyzed. Positive clones were sent to Qingke Biotechnology Co., Ltd. for sequencing to ensure successful ligation of the target sequence into the pBI121 vector, thus obtaining the overexpression vector.
[0043] Table 1 Primers for overexpression vector construction
[0044]
[0045] 2. Construction of miRNA PC-5p-680261 silencing vector
[0046] The steps for constructing the silent expression vector are the same as in Method 1 of this embodiment, except that two cloning sites, BamHI and SacI, on the pBI121 vector are selected for double digestion. The primers for constructing the silent expression vector are shown in Table 2.
[0047] Table 2 Primers for constructing silent expression vectors
[0048]
[0049] 3. Genetic transformation of tobacco using recombinant vectors
[0050] The constructed recombinant vector was transformed into Agrobacterium using the freeze-thaw method, and then transformed into tobacco for transgenic overexpression. The transgenic recipient tobacco in this experiment was Nicotiana benthamiana. The specific steps of transgenicization are as follows:
[0051] 1) Culture of aseptic tobacco seedlings
[0052] Tobacco seeds were soaked in 75% ethanol for 1 min, then sterilized with 10% H2O2 for 15 min, followed by rinsing three times with sterile water for 3 min each time. The seeds were then seeded on MS medium in a laminar flow hood and cultured at 28°C for approximately 15 days in a light incubator.
[0053] 2) Transformation
[0054] In a clean bench, tobacco leaves were cut into 0.5×0.5 cm pieces. The tobacco leaves were then transferred into the prepared Agrobacterium tumefaciens solution (OD value around 0.8). After 5 min of inoculation, the leaves were blotted dry on sterile filter paper and then inoculated onto MS solid co-medium (1 / 2 MS + 30 g / L sucrose + 8 g / L agar, pH 5.8) and incubated in a constant temperature incubator at 22℃ in the dark for 2 days.
[0055] 3) Embryo induction
[0056] Transfer the leaves from the plate to the induction medium (MS + 0.5 mg / L BA + 30 g / L sucrose + 8 g / L agar + 500 mg / L CEF + 100 mg / L Kana, pH 5.8), with the wound facing up on the surface of the medium. After transfer, seal the plate with sealing film and place it in a light incubator for cultivation. Transfer the leaves to the same medium approximately every 15 days.
[0057] 4) Rooting
[0058] When small shoots emerged on the induction medium, they were transferred to rooting medium (MS + 0.1 mg / L NAA + 30 g / L sucrose + 8 g / L agar + 100 mg / L Kana, pH 5.8) and cultured under light conditions to induce shoot growth and root formation. The control plant was wild-type Nicotiana benthamiana.
[0059] 3. Positive detection of genetically modified tobacco
[0060] DNA was extracted from transgenic tobacco using the cetyltrimethylammonium bromide (CTAB) method. PCR was performed using universal primers from the pBI121 vector (primers for overexpression of transgenic plants are shown in Table 3, and primers for silence of transgenic plants are shown in Table 4). The following reagents were used: Taq HS (0.25 μL), dNTP Mixture (4 μL), 10 × PCR Buffer (5 μL), DNA template (2 μL), forward and reverse primers (1 μL), and ddH2O (36.75 μL). The PCR program was set to 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 55℃ annealing for 30 s, and 72℃ extension for 50 s, for 35 cycles, followed by a final extension at 72℃ for 5 min. After PCR, 5 μL was subjected to agarose gel electrophoresis. Figure 2 (Overexpression detection results, PC-5p-680261-OE) and Figure 3 (The silencing test result, PC-5p-680261-STTM, shows that the target band size is as expected, indicating successful transgenicity.)
[0061] Table 3 Primers for detecting overexpression transgenic plants
[0062]
[0063] Table 4 Primers for detecting silent transgenic plants
[0064]
[0065] Example 3: Quantitative Fluorescence Detection
[0066] Quantitative PCR was performed on transgenic Nicotiana benthamiana lines overexpressing PC-5p-680261-OE (lines 1, 2, and 3) and transgenic Nicotiana benthamiana lines silenced by PC-5p-680261-STTM (lines 3, 5, and 6). miR222 was used as an internal reference gene, and primers were designed using Primer 5.0 software. The reaction mixture was 10 μL, containing 5 μL of Advanced qPCR SYBR Master Mix (Yeasen, Shanghai), 0.4 μL each of forward and reverse primers, 1 μL of cDNA template, and 3.2 μL of ddH2O. Each sample was tested in triplicate, using 2... -ΔΔ Ct method was used to calculate relative gene expression levels. Results are as follows: Figure 4 As shown, the OE-1 transgenic Nicotiana benthamiana showed the highest expression level, while the ST-3 transgenic Nicotiana benthamiana showed the highest silencing efficiency. All lines can be used for subsequent phenotypic experiments.
[0067] Experiment Example 4: Disease Resistance Experiment with Transgenic Tobacco
[0068] The obtained PC-5p-680261-OE overexpressing transgenic tobacco, PC-5p-680261-STTM silenced transgenic tobacco, and wild-type tobacco were inoculated with *Botrytis cinerea*. The lesion area was recorded 1, 2, and 3 days after inoculation, and the data were analyzed for significance. Specifically, *Botrytis cinerea* was inoculated onto PDA solid medium and incubated upside down at 25°C. When *Botrytis cinerea* reached 3-4 days of growth, leaves were inoculated. Mycelia were broken into 6 mm diameter mycelial discs. Healthy tobacco leaves of similar shape and size without lesions were selected. Four small holes were made in each tobacco leaf, and the mycelial discs were inoculated onto the transgenic tobacco leaves using an inoculation needle, with the mycelial surface in contact with the upper surface of the leaf. The lesion size was recorded 1, 2, and 3 days after inoculation. Using lesion area as the metric, 45 lesion replicates were randomly set up. A ruler was used to photograph the lesions (scale bar = 1 cm), and the images were imported into ImageJ software to calculate the lesion area. The experimental data were analyzed, organized, and plotted using GraphPad Prism 9.0 software, and the Student's t-test was used for significance analysis. The results showed that the PC-5p-680261-STTM transgenic tobacco exhibited significant resistance to the growth of *Botrytis cinerea*, such as... Figure 5As shown, when treated with *Botrytis cinerea* for 1, 2, and 3 days, the average lesion area of the control wild-type tobacco was 0.270, 1.236, and 1.881 cm², respectively. 2 The average lesion area on PC-5p-680261-OE transgenic tobacco was 0.420, 1.801, and 2.955 cm², respectively. 2 The average lesion areas on PC-5p-680261-STTM transgenic tobacco were 0.308, 0.719, and 1.537 cm², respectively. 2 The average lesion area of PC-5p-680261-STTM transgenic tobacco was significantly different from that of wild-type tobacco within the same number of days, with the lesions being significantly smaller than those of wild-type tobacco and PC-5p-680261-OE transgenic tobacco. Therefore, PC-5p-680261-STTM transgenic tobacco has a significant disease resistance effect, indicating that silencing the miRNA PC-5p-680261 gene improves the disease resistance of tobacco.
[0069] In summary, this invention constructed a miRNA PC-5p-680261 silencing expression vector and transformed it into tobacco. Transgenic tobacco plants were obtained through stable genetic transformation, and these plants exhibited strong fungal inhibitory activity after inoculation with *Botrytis cinerea*. Conversely, constructing an miRNA PC-5p-680261 overexpression vector and transforming it into tobacco significantly weakened the plants' resistance to *Botrytis cinerea*. Therefore, miRNA PC-5p-680261 plays a role in regulating plant disease resistance and has broad market application prospects in cultivating plants with high disease resistance.
[0070] The conventional techniques and solutions not described in detail in the above embodiments are all well known in the art, and therefore will not be elaborated upon here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.
Claims
1. A miRNA PC-5p-680261 molecule, characterized in that, The nucleotide sequence of the mature form of miRNA PC-5p-680261 is shown in SEQ ID NO.1, or the nucleotide sequence of the precursor of miRNA PC-5p-680261 is shown in SEQ ID NO.
2.
2. A miRNA PC-5p-680261 precursor gene, characterized in that, The nucleotide sequence of the precursor gene is shown in SEQ ID NO.
3.
3. The application of the molecule of claim 1 or the gene of claim 2 in regulating plant disease resistance.
4. The application as described in claim 3, characterized in that, The disease resistance refers to resistance to diseases caused by pathogens including Botrytiscinerea.
5. The application as described in claim 3, characterized in that, The plants mentioned include tobacco or tea trees.
6. A method for improving plant disease resistance, characterized in that, The method includes the step of reducing the expression of miRNA PC-5p-680261 in the plant; the nucleotide sequence of said miRNA PC-5p-680261 is shown in SEQ ID NO.
1.
7. The method as described in claim 6, characterized in that, The disease resistance refers to resistance to diseases caused by pathogens including Botrytis cinerea.
8. The method as described in claim 6, characterized in that, The reduction of miRNA PC-5p-680261 expression was achieved by introducing a silencing expression vector into the target plant.
9. The method as described in claim 8, characterized in that, The silent expression vector includes the pBI121 vector.
10. A plant with high disease resistance, characterized in that, The expression of miRNA PC-5p-680261 was reduced in the plant, and the nucleotide sequence of the miRNA PC-5p-680261 is shown in SEQ ID NO.1.