Preparation method of H5N1 subtype influenza pseudovirus

By constructing a bovine H5N1 subtype influenza pseudovirus and a lentiviral packaging system containing HA and NA genes, the problems of insufficient accuracy and safety in existing detection methods have been solved, enabling the preparation and application of high-droplet pseudoviruses, which are suitable for quality control in nucleic acid detection.

CN122104745APending Publication Date: 2026-05-29谷钰

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
谷钰
Filing Date
2026-04-14
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies lack methods for preparing bovine H5N1 subtype influenza virus that can simulate the real viral nucleic acid extraction and detection process, and have high titers and are safe, especially the application of HA and NA genes, which leads to insufficient accuracy and safety of detection methods.

Method used

A bovine H5N1 subtype influenza pseudovirus was constructed, consisting of a lentiviral core and exogenous nucleic acid. The exogenous nucleic acid was the HA and NA genes of the bovine H5N1 subtype influenza virus. The pseudovirus was packaged using a specific plasmid and vector system to prepare a high-titer pseudovirus with His tag and GFP label for easy observation and quantitative analysis.

Benefits of technology

It provides highly safe and stable pseudovirus standards for quality control in nucleic acid testing, which can accurately match the detection methods for prevalent dairy bovine strains, reduce biosafety risks, and improve the accuracy and consistency of testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104745A_ABST
    Figure CN122104745A_ABST
Patent Text Reader

Abstract

The application discloses a preparation method of a dairy cow-derived H5N1 subtype influenza pseudovirus, and constructs a recombinant expression vector pCDH-CMV-MCS-EF1-copGFP-HA containing an HA gene sequence and a pCDH-CMV-MCS-EF1-copGFP-NA containing an NA gene sequence, respectively. The two vectors are used together with a pseudovirus packaging plasmid to prepare a kit for the H5N1 subtype influenza pseudovirus, and the H5N1 subtype influenza pseudovirus can be efficiently obtained. The H5N1 subtype influenza pseudovirus prepared by the method has no replication activity, is high in biological safety, and is provided with His and GFP markers, so that the preparation effect of the pseudovirus can be directly observed, and a safe and reliable tool is provided for carrying out quality control and standardization of a nucleic acid detection method for the dairy cow-derived H5N1 subtype influenza virus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the HA and NA gene sequences of bovine H5N1 subtype influenza virus and pseudoviruses prepared based thereon. Background Technology

[0002] Avian influenza (AI) is caused by influenza A virus (IAV) and primarily infects poultry, wild birds, and other bird species. The H5 subtype of avian influenza is classified as highly pathogenic avian influenza (HPAI) and is a legally reportable disease as defined by the World Organisation for Animal Health (WOAH). In my country, it is classified as a Class A animal disease.

[0003] In recent years, the H5 subtype HPAIV, especially the 2.3.4.4b branch, has continued to spread globally, with its range of infected hosts constantly expanding. In 2024, the United States first reported infection of dairy cows with the H5N1 subtype HPAIV 2.3.4.4b branch, triggering a sustained multi-state outbreak. Subsequently, multiple cases of infection among dairy farmers emerged, confirming the virus's potential to cross species and spread to mammals and humans. In addition to clinical symptoms such as decreased feed intake and a sharp drop in milk production, infected dairy cows exhibit high titers of infectious virus in their milk, posing a potential risk of continued transmission of the virus within dairy herds and to humans through dairy products.

[0004] Establishing a rapid and accurate nucleic acid detection method for H5N1 subtype influenza virus is crucial for epidemic monitoring, early warning, and prevention and control decisions. Real-time quantitative RT-PCR is currently the most widely used nucleic acid detection method, but its accuracy is highly dependent on standardized positive controls. Existing positive controls are mostly plasmid DNA or in vitro transcribed cRNA. The former cannot simulate the nucleic acid extraction process of viral particles, while the latter has poor stability and is difficult to simulate the interaction between viral nucleic acid and protein in real samples. Although live virus positive controls are closest to real samples, H5N1 influenza virus is a biosafety level 3 pathogen, posing high operational risks and making it difficult to promote its use in general laboratories and primary veterinary laboratories.

[0005] Pseudoviruses (PsVs) are recombinant viral particles whose nucleic acids and envelope / capsid proteins originate from different viruses. They exhibit single-cycle infection characteristics and have relatively high biosafety. The genes encoding envelope proteins on the pseudovirus nucleic acid molecule are modified, thus they lack self-replication capabilities and can only perform a single infection cycle. This allows them to be handled in biosafety level 2 laboratories, lowering the biosafety requirements for virus research. Using pseudoviruses as positive controls for nucleic acid detection can improve the stability and homogeneity of nucleic acids and fully participate in the quality control of the entire process from viral lysis, nucleic acid extraction and purification to nucleic acid amplification and detection, making them ideal standards for nucleic acid detection.

[0006] The IAV genome is a segmented, single-stranded, negative-sense RNA genome containing eight independent RNA segments, each encoding at least 10 proteins, including the three subunits of the virus-specific RNA polymerase PA, PB1, and PB2; two key surface glycoproteins, hemagglutinin (HA) and neuraminidas (NA); the nucleoprotein NP; the matrix protein M1; the proton channel protein M2; and two non-structural proteins, NS1 and NS2. Hemagglutinin (HA) and neuraminidas (NA) are influenza virus-specific genes and are commonly used as target genes for nucleic acid detection. Yang Xia et al. invented "Preparation method of H5N1 subtype avian influenza pseudovirus" (Publication No.: CN102191223A, Publication Date: 2011.09.21), He Jun et al. invented "Preparation method of highly pathogenic H5N8 subtype avian influenza pseudovirus" (Publication No.: CN117737004A, Publication Date: 2024.03.22), and Yu Fei et al. invented "H5N8 avian influenza pseudovirus and its preparation method and application" (Publication No.: CN118028366A, Publication Date: 2024.05.14).

[0007] Although all reported patents utilize avian influenza pseudovirus packaging systems, the HA and NA genes in these systems are primarily used as envelope proteins for assessing neutralizing antibody levels. They are not addressed as nucleic acids in the pseudovirus system for avian influenza detection quality control. Furthermore, existing technologies are mostly based on avian or human strain sequences, and there are no reports on the construction and application of pseudoviruses targeting the HA and NA genes of the currently prevalent bovine H5N1 virus. In addition, due to sequence differences in the HA and NA genes of strains from different sources, pseudoviruses constructed using non-bovine strains may not accurately match nucleic acid detection methods for prevalent bovine strains. Summary of the Invention

[0008] The technical problem to be solved by the present invention is to provide a bovine H5N1 subtype influenza pseudovirus that can simulate the real viral nucleic acid extraction and detection process, has a high titer, and is safe.

[0009] The technical solution of the present invention is: a bovine H5N1 subtype influenza pseudovirus, characterized in that the pseudovirus contains a lentiviral core and exogenous nucleic acid packaged within the core, wherein the exogenous nucleic acid is the HA and NA genes of bovine H5N1 subtype influenza virus, and its nucleotide sequence is shown in SEQ ID No. 1 and SEQ ID No. 2.

[0010] Furthermore, the HA and NA genes of the bovine H5N1 subtype influenza virus are also linked to His tags.

[0011] An expression vector containing the HA and NA genes of the bovine H5N1 subtype influenza virus described above.

[0012] Furthermore, the empty vector of the expression vector is pCDH-CMV-MCS-EF1-copGFP.

[0013] A kit containing the expression vector described above.

[0014] Furthermore, it also includes lentiviral packaging plasmids.

[0015] Furthermore, the lentivirus packaging plasmids are pMD2.G and psPAX2.1.

[0016] A method for preparing an H5N1 subtype influenza pseudovirus includes the following steps: a. Co-transfect host cells with the expression vector and lentiviral packaging plasmid described above; b. Culture host cells for 48 h; c. Harvest the supernatant from cell culture and filter it using a microporous filter with a pore size of 0.22 μm; collect the filtrate to obtain high-titer H5N1 subtype influenza pseudovirus.

[0017] Furthermore, the lentiviral packaging plasmids are pMD2.G and psPAX2.1; the host cell is HEK-293T cell; the transfection is performed using cationic liposome transfection; and the H5N1 subtype influenza pseudovirus is a 1:1 mixture of HA and NA genes after lentiviral packaging.

[0018] Preferably, the mass ratio of expression vectors psPAX2.1 and pMD2.G during transfection is 4:3:1.

[0019] Compared with the prior art, the present invention has the following beneficial effects: Based on the HA gene sequence (Genbank: PP799237.1) and NA gene sequence (Genbank: PP799239.1) of the prevalent bovine H5N1 subtype influenza virus in the United States, this invention artificially synthesized the HA and NA gene sequences and constructed recombinant vectors pCDH-CMV-MCS-EF1-copGFP-HA and pCDH-CMV-MCS-EF1-copGFP-NA carrying the above genes. Using the recombinant vectors pCDH-CMV-MCS-EF1-copGFP-HA and pCDH-CMV-MCS-EF1-copGFP-NA as lentiviral expression vectors, a kit for preparing H5N1 subtype influenza pseudoviruses was prepared together with lentiviral helper plasmids, which can obtain high-titer H5N1 subtype influenza pseudoviruses.

[0020] The pseudoviruses prepared by this invention are labeled with polyhistidine (His) and also carry green fluorescent protein (GFP), which allows for direct observation of the pseudovirus preparation effect and facilitates quantitative analysis in subsequent studies.

[0021] This invention optimizes the ratio between expression plasmids and packaging plasmids.

[0022] This invention is the first to use the HA and NA genes of the representative strain of the H5N1 2.3.4.4b branch that currently causes dairy cow epidemics, which can accurately match the nucleic acid detection method for this strain and avoid detection bias caused by differences in target sequences.

[0023] The pseudovirus prepared by this invention can be used as a safe nucleic acid standard for the establishment, optimization and routine quality control of nucleic acid detection methods such as RT-qPCR and digital PCR for H5N1 subtype influenza virus. It can also be used to evaluate the detection efficacy of different nucleic acid extraction kits and detection kits, and provide reference materials for proficiency testing in testing laboratories. It has good application value and market prospects. Attached Figure Description

[0024] Figure 1 The results of transmission electron microscopy (TEM) detection of H5N1 subtype influenza pseudovirus (4000×) are shown. (A) is the HA gene pseudovirus electron microscopy image, and (B) is the NA gene pseudovirus electron microscopy image.

[0025] Figure 2 The figures show the amplification standard curves of the H5N1 subtype influenza pseudovirus expression plasmid. (A) is the amplification standard curve of the standard plasmid pCDH-CMV-MCS-EF1-copGFP-HA, and (B) is the amplification standard curve of the standard plasmid pCDH-CMV-MCS-EF1-copGFP-NA.

[0026] Figure 3The results show the optimized ratio of expression plasmids, packaging plasmids, and envelope plasmids in the pseudovirus system.

[0027] Figure 4 The images show the results of inverted fluorescence microscopy imaging of HEK293T cells infected with H5N1 subtype influenza pseudovirus. (A) is the uninfected negative control, and (B) is the effect of H5N1 subtype influenza pseudovirus on HEK293T cells. Detailed Implementation

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from commercial sources.

[0029] Experimental reagents: Total RNA extraction kit was purchased from Beijing Tiangen Biotech Co., Ltd.; reverse transcription kit and SYBR Green fluorescent dye were purchased from Beijing TransGen Biotech Co., Ltd.; Lipofectamine 3000 was purchased from Shanghai Ingenic Semiconductor Co., Ltd.; DMEM and PEG8000 were purchased from Shanghai Sangon Biotech Co., Ltd.

[0030] Experimental instruments: Bio-rad T100 PCR instrument; Bio-rad CFX96 real-time PCR instrument; Thermo Multifuge X1R high-speed centrifuge. Experimental cells: HEK-293T cells were purchased from ATCC and preserved by the Swine Disease Research Center of the College of Veterinary Medicine, Sichuan Agricultural University; packaging plasmids pMD2.G and psPAX2.1 were preserved by the Swine Disease Research Center of the College of Veterinary Medicine, Sichuan Agricultural University.

[0031] Example 1: Preparation of Recombinant Vector The HA gene sequence (Genbank: PP799237.1) and NA gene sequence (Genbank: PP799239.1) of H5N1 subtype influenza virus were selected from NCBI. The original sequences (SEQ ID No.1, SEQ ID No.2) were sent to Suzhou Hongxun Company for synthesis and ligation of the His tag. The His tag was then ligated into the lentiviral expression vector pCDH-CMV-MCS-EF1-copGFP to obtain the recombinant vectors pCDH-CMV-MCS-EF1-copGFP-HA and pCDH-CMV-MCS-EF1-copGFP-NA.

[0032] The expression vector was transformed into *E. coli* DH5α competent cells, plated on Amp plates, and incubated upside down at 37°C for 16 h. Single colonies from the plates were randomly picked and inoculated into 5 mL of LB broth containing Amp (50 μg / mL). After shaking and incubation, a small amount of plasmid was extracted and subjected to dual identification via plasmid PCR and double enzyme digestion. The recombinant vector correctly identified by both PCR and double enzyme digestion was named pCDH-CMV-MCS-EF1-copGFP-HA / NA; the recombinant bacteria carrying the recombinant vector pCDH-CMV-MCS-EF1-copGFP-HA / NA was named DH5α / pCDH-CMV-MCS-EF1-copGFP-HA / NA.

[0033] Example 2: Preparation of H5N1 subtype influenza pseudovirus kit The recombinant vector pCDH-CMV-MCS-EF1-copGFP-HA / NA was prepared according to the method in Example 1. Lentiviral packaging plasmids pMD2.G and psPAX2.1 were used together with the recombinant vector pCDH-CMV-MCS-EF1-copGFP-HA / NA to construct the kit of this invention.

[0034] Example 3: Preparation and Identification of H5N1 Subtype Influenza Pseudovirus 1. Plasmid co-transfection and ratio optimization The kit prepared using the method in Example 2 was transfected using cationic liposomes. Plasmids were packaged in commonly used packaging ratios, such as 5:3:2, 3:2:1, 2:2:1, and 4:3:1 for recombinant expression plasmid: packaging plasmid: envelope plasmid. The pseudovirus copy number was then measured for each packaging ratio. Preferably, the mass ratio of plasmids used during transfection was 4:3:1 for recombinant expression plasmid: packaging plasmid: envelope plasmid. HEK-293T cells were co-transfected according to a total plasmid mass:Lipofectamine 3000 ratio of 1 μg:1.5 μL.

[0035] 2. Harvesting H5N1 subtype influenza pseudovirus Host cells were cultured for 48 h, and the supernatant was collected by centrifugation (centrifugation conditions: 4℃, 5000×g, 10 min). The supernatant was filtered using a sterile 0.22 μm filter. Using a virus concentration reagent (prepared as follows: 8.766 g NaCl and 50 g PEG8000 dissolved in 200 mL ultrapure water), the pseudovirus supernatant was mixed with the virus concentration reagent at a volume ratio of 4:1 and incubated overnight at 4℃. Then, the mixture was centrifuged (centrifugation conditions: 4℃, 7000×g, 30 min), the supernatant was discarded, and the supernatant was resuspended in DMEM at 1 / 50 of its original volume. The separately packaged HA gene and NA gene influenza pseudoviruses were mixed at a 1:1 ratio to obtain the H5N1 subtype influenza pseudovirus solution of this invention. After aliquoting, it was stored at -80℃.

[0036] 3. Electron microscopy observation of H5N1 subtype influenza pseudovirus morphology The H5N1 subtype influenza pseudovirus solution was fixed with standard electron microscopy fixative and examined by negative staining transmission electron microscopy. Figure 1 As shown, influenza virus-like particles appear in the field of view, surrounded by a dense envelope, with a diameter of approximately 80-120 nm. This demonstrates that the pseudovirus system of this invention successfully packaged pseudovirus particles.

[0037] Real-time quantitative RT-PCR detection of HA / NA gene copy number Take 500 μL of pseudovirus solution, extract total RNA using TRIZOL reagent according to the product instructions, and detect the expression level of HA gene in the virus after reverse transcription.

[0038] Using the HA and NA genes of H5N1 subtype influenza virus as target genes, specific primers were designed using Primer Premier 5.0 software. The amplified fragment size of the HA gene was 85 bp, and the amplified fragment size of the NA gene was 89 bp.

[0039] Upstream primer (HA-F): 5'-AGGGAGGATGGCAGGGAATG-'3 Downstream primer (HA-R): 5'-TCTTTGTCCGCAGCGTACCCACT-'3 Upstream primer (NA-F): 5'-AAGATTTGAGTCTGTTGCTTGGTC-'3 Downstream primer (NA-R): 5'-CTCCATTGTCTGGACCAGAAAT-'3 Reaction procedure: pre-denaturation at 95℃ for 3 min; then denaturation at 95℃ for 15 s, annealing at 60℃ for 20 s, extension at 68℃ for 20 s, and fluorescence values ​​were read. The reaction was repeated 40 times.

[0040] The OD260 and OD280 of the standard plasmid were measured using a nucleic acid protein analyzer, and then the concentration (ng / μL) was calculated. The copy number of the plasmid was then calculated using the formula: Copy number = plasmid concentration × 6.02 × 1023 / (660 × total plasmid length), where 6.02 × 1023 is Avogadro's constant; 660 is the average molecular weight per base; and the total length of the recombinant plasmid is in bp.

[0041] The standard high-quality plasmid was serially diluted 10-fold. The logarithm of the initial template number for each concentration gradient was set as the Y-axis, and the corresponding cycle number Ct value was set as the X-axis to plot the regression curve. The expression equation for the quantitative PCR standard curve was then plotted (see [link to graph]). Figure 2 When testing the sample, the initial copy number of the sample can be obtained by substituting the corresponding Ct value into the equation. The results are shown in Table 1.

[0042] Table 1. Copy number of H5 subtype influenza pseudovirus HA gene

[0043] 6. Determination of H5N1 subtype influenza pseudovirus cell infection level After digesting healthy HEK-293T cells, they were seeded into 6-well cell culture plates. When the cell monolayer in the plate grew to about 50%, 100 μL of concentrated H5N1 influenza pseudovirus solution was used to infect the cells. Three wells were infected in parallel, and the cells were observed and photographed under a fluorescence microscope after 48 h.

[0044] The results of inverted fluorescence microscopy are as follows Figure 4 As shown, the results indicate that the H5N1 subtype influenza pseudovirus can successfully infect HEK-293T cells.

[0045] Electron microscopy, real-time quantitative RT-PCR, and determination of pseudovirus cell infection levels demonstrated that this invention successfully prepared a bovine H5N1 subtype influenza pseudovirus. SEQ ID No.1 1 atggagaaca tagtactact tcttgcaata gttagccttg ttaaaagtga tcagatttgt 61 attggttacc atgcaaacaa ttcgacagag caagttgaca cgataatgga aaagaacgtc 121 actgttacac atgcccaaga catactggaa aaaacacaca acgggaagct atgcgaccta 181 aatggggtga agccactgat tttaaaggac tgcagtgtag ctggatggct cctcggaaac 241 ccaatgtgcg acgaattcat cagagtgccg gaatggtctt acatagtgga gcgggctaac 301 ccagctaatg acctctgtta cccagggagc ctcaatgact atgaagaact gaaacacatg 361 ttgagcagaa taaatcattt tgagaagatt cagatcattc ccaagagttc ctggccaaat 421 catgaaacat cactagggt gagcgcagct tgtccatacc agggagcacc ctcctttttc 481 agaaatgtgg tgtggcttat caaaaagaac gatgcatacc caacaataaa gataagctac 541 aataatacta atcgggaaga tctcttgata ctgtggggga ttcatcattc caacaatgca 601 gaagagcaga caaatctcta caaaaaccca atcacctaca tttcagttgg aacatcaact 661 ttaaaccaga ggttggcacc aaaaatagct actagatccc aagtaaacgg gcaacgtgga 721 agaatggact tcttctggac aatcttaaaa ccagatgatg caatccattt cgagagtaac 781 ggaaatttca ttgctccaga atatgcatac aaaattgtta agaaagggga ctcgacaatt 841 atgaaaagtg gagtggaata tggccattgc aacaccaaat gtcaaacccc agtaggtgcg 901 ataattcta gtatgccatt tcacaacata catcctctca ccattgggga atgccccaaa 961 tacgtgaat caaacaagtt ggtccttgcg actgggctca aatagtcc tctaagagaa 1021 aagagaagaa aaagaggtct gtttggggcg atagcagggt ttatagggaggatggcag 1081 ggaatggttg atggttggta tgggtaccat catagcaatg agcaggggagtgggtacgct 1141 gcggacaaag aatccaccca aaaggcaata gatggagtta ccaataggtcaactcaatc 1201 attgacaaaa tgaacactca atttgaggca gttggaaggg agtttataacttagaaagg 1261 aggatagaga atttgaacaa gaaaatgga gacggattcc tagatgtctggacatataat 1321 gctgaacttc tagttctcat ggaaaacgag aggactctag atttccatgattcaaatgtc 1381 aagaaccttt acgacaaagt cagattacag cttagggata atgcaaaggagctgggtaac 1441 ggctgtttcg aattctatca caaatgtgat aattgta tggaaagtgtgagaaatggg 1501 acgtatgact accctcagta ttcagaagaa gcaagataa aaagagaagaaataagcgga 1561 gtgaaattag aatcagtagg aacttaccag atactgtcaa tttattcaacagcggcaagt 1621 tccctagcac tggcaatcat gatggctggt ctatctttat ggatgtgctccaatgggtcg 1681 ttacaatgca gaatttgcat ttag SEQ ID No.2 1 atgaatccaa atcaaaagat aacaaccatt ggatcaatct gtatggtaat tgggatagtc 61 agtttgatgc tgcaaattgg gaacataatc tcaatatggg ttagccattc aatccaaaca 121 gggaatcaat accacgcctga accatgcaat caaagcatca ttacctatga gaacaacacc 181 tgggtaaatc agacgtatat caacatcagc agtaccaatt ttcttgctga gcaggctgtt 241 acttcggtaa cattagcggg caattcatct ctttgcccta ttagtgggtg ggcaatatac 301 agtaaggaca acggtataag aattgggtct aaggggggatg tgtttgttat aagagaacca 361 ttcatctcat gctcccactt ggaatgcaga acctttttcc tgacccaggg agctctgctg 421 aatgaaac attctaatgg gacagttaag gatagaagcc cttatagaac tttgatgagt 481 tgtcccgtgg gtgaggctcc ttccccgtac aattcaagat ttgagtctgt tgcttggtcg 541 gcaagtgctt gtcatgatgg catcagttgg ttgacaatcg gtatttctgg tccagacaat 601 ggagctgtgg ctgtattgaa gtacaatggc ataataacgg atactatcaa gagttggaga 661 aacaacattt tgagaactca agaatctgaa tgtgcttgcg taaatggctc ctgcttcacc 721 gtaatgactg atggaccaag caatgggcag gcctcatata aaatcttcaa gatagagaaa 781 gggaaagttg tcaaatcagt tgaaatgaat gcccctaatt accactacga ggaatgctcc 841 tgttatcctg atgcgggtga tattatgtgt gtgtgcaggg acaattggca tggctcgaac 901 cggccgtggg tatctttaa tcaaaatctg gagtatcaaa taggatatat atgcagtggg 961 atttcgggg acaatccccg ccccaatgat ggaacaggca gttgcagtcc aatgccctct 1021 aatggggcat atggggtaaa agggttttca tttaagtacg gtaatggggtttggatcgga 1081 agaacaaaaa gcactagttc cagaagcggc tttgagatga ttgggatccgaatgggtgg 1141 actgagacgg acagtagttt ctcagtgaag caagacattg tagaaataactgactggtca 1201 ggatatagtg ggagttttgt ccagcatcca gaactgacag gattagattgcatgaggcct 1261 tgtttctggg ttgagctaat tagagggagg cccaaagaga atacaatttggactagcggg 1321 agcagcatat ccttttgtgg tgtaaatagt gacactgtgg gttggtcttggccagacggt 1381 gctgagttgc cattcaccat tgacaagtag

Claims

1. Expresses the HA and NA genes of bovine H5N1 subtype influenza virus, the nucleotide sequences of which are shown in SEQ ID No. 1 and SEQ ID No.

2.

2. The bovine H5 subtype influenza virus HA and NA genes according to claim 1, characterized in that, The bovine H5N1 subtype influenza virus also has His tags attached to its HA and NA genes.

3. An expression vector containing the HA and NA genes of bovine H5N1 subtype influenza virus as described in claim 1 or 2.

4. The expression vector according to claim 3, characterized in that, The empty vector of the expression vector is pCDH-CMV-MCS-EF1-copGFP.

5. A kit containing the expression vector of claim 3 or 4.

6. The reagent kit according to claim 5, characterized in that, It also includes lentiviral packaging plasmids.

7. The reagent kit according to claim 6, characterized in that, The lentivirus packaging plasmids are pMD2.G and psPAX2.

1.

8. A method for preparing an H5N1 subtype influenza pseudovirus, characterized in that, Includes the following steps: a. Co-transfect host cells with the expression vector described in claim 3 or 4 and the lentiviral packaging plasmid, respectively; b. Culture host cells for 48 h; c. Harvest the supernatant from cell culture and filter it using a microporous filter with a pore size of 0.22 μm; collect the filtrate to obtain high-titer H5N1 subtype influenza pseudovirus.

9. The preparation method according to claim 8, characterized in that, The lentiviral packaging plasmids are pMD2.G and psPAX2.1; the host cell is HEK-293T cell; the transfection is performed using cationic liposomes; the H5N1 subtype influenza pseudovirus is a 1:1 mixture of HA and NA genes after lentiviral packaging.

10. According to the preparation method of claim 9, preferably, the mass ratio of expression vector, psPAX2.1, and pMD2.G expression vector during transfection is 4:3:1.