Thiostrepton high-yield engineering bacteria based on double reporter genes, construction method and application thereof

By employing the Kan-xylE dual reporter gene screening method, combined with screening strategies for resistance genes and chromogenic genes, the problems of false positives, throughput, and accuracy in the screening of high-yield thiostreptin strains in existing technologies have been solved, achieving efficient and stable screening of high-yield strains and yield improvement.

CN122104759APending Publication Date: 2026-05-29TIANJIN UNIV OF SCI & TECH

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TIANJIN UNIV OF SCI & TECH
Filing Date
2026-03-05
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies for screening high-thiostreptin-producing strains suffer from problems such as false positives, discrepancies between screening throughput and accuracy, poor plasmid stability, and long fermentation cycles, making it difficult to achieve efficient, accurate, and high-throughput screening.

Method used

A screening method based on the Kan-xylE dual reporter gene was adopted, which combined high-pressure screening of resistance genes with visual detection of chromogenic genes. Recombinant strains overexpressing tsrH and tsrI genes were screened by introducing recombinant expression vectors into Streptomyces laureate. Kanamycin resistance and XylE enzyme activity were used for colorimetric verification to achieve efficient screening.

Benefits of technology

It significantly improved screening accuracy, increased yield to 7.2 times the original, has high genetic stability, is suitable for industrial applications, and maintains a plasmid retention rate of up to 97% even without selection pressure, with a yield of 96.8%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104759A_ABST
    Figure CN122104759A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetically engineered bacteria, and specifically discloses a high-yield thiostrepton engineered bacterium based on double reporter genes, a construction method and application thereof. The construction method comprises the following steps: introducing a recombinant expression vector containing a promoter sequence of tsrI-tsrH and a reporter gene XylE into a host bacterium to obtain a donor bacterium; co-culturing the donor bacterium with Streptomyces laurentii to obtain a conjugant; culturing the conjugant in a culture medium containing kanamycin for screening, and then verifying XylE enzyme activity coloration, and finally screening a positive recombinant strain with yellow color. Through a double reporter gene combined screening strategy, the hit rate of screening of high-yield strains is increased from 28.0% of traditional single resistance screening to 92.0%, the fermentation titer of the screened recombinant strain reaches 333.43 U / mL, and the average yield is 3.3 times that of the single resistance screening group. The recombinant strain also has excellent genetic stability and is suitable for industrial production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetically engineered bacteria, and in particular to a high-yield thiostreptin-producing engineered bacterium based on dual reporter genes, its construction method, and its application. Background Technology

[0002] Thiostrepton ( Thiostrepton ) is a type of Streptomyces laureate ( Streptomyces laurentii Thioxetine is a sulfur-containing polypeptide antibiotic produced by bacteria or their close relatives. It inhibits protein synthesis translocation by binding to the 50S subunit of the bacterial ribosome, exhibiting strong bactericidal activity against Gram-positive bacteria (especially drug-resistant Staphylococcus aureus). Furthermore, thiosericin is widely used in veterinary medicine, and recent studies have revealed its potential medicinal value in antimalarial and anticancer applications (such as inhibiting the FOXM1 transcription factor).

[0003] Currently, the industrial production of thiostreptin mainly relies on the fermentation of *Streptomyces laureate*. To reduce production costs and increase yield, obtaining high-yielding strains is crucial. Traditional methods for selecting high-yielding strains primarily rely on physicochemical mutagenesis (such as ultraviolet light and nitrosoguanidine mutagenesis), followed by screening using inhibition zone methods or high-performance liquid chromatography (HPLC).

[0004] Although the existing single reporter gene screening methods described above offer improved throughput compared to traditional HPLC detection, they still have the following significant drawbacks for high-yield screening of thiotetracycline from Streptomyces laureensis: A key shortcoming is the inability to distinguish false positives caused by differences in biomass: the signal intensity (e.g., fluorescence value) of a single reporter gene system is the sum of "promoter activity" and "cell growth". Strains with fast growth rates and large colonies may have high total fluorescence intensity even if the yield per unit area is low, easily leading to false positives. It cannot accurately reflect "yield per unit cell".

[0005] The contradiction between screening throughput and accuracy: If HPLC is used for secondary screening, the accuracy is high but the throughput is extremely low, which cannot cope with the screening of thousands of mutant libraries after mutagenesis; if screening is based solely on single antibody markers, it can only be qualitative and not quantitative, making it difficult to screen out superior strains with slight yield increases.

[0006] Signal fluctuations caused by plasmid stability: During Streptomyces fermentation, plasmids are prone to loss or copy number fluctuations. A single reporter gene cannot correct for signal errors caused by plasmid copy number differences, resulting in poor reproducibility of screening results.

[0007] Long fermentation cycle and delayed feedback: The traditional inhibition zone method requires waiting for the fermentation broth to accumulate enough product, which usually takes 5-7 days or even longer. It is also cumbersome to operate and difficult to achieve automated high-throughput sorting (such as FACS flow cytometry sorting).

[0008] In summary, existing technologies lack a method for screening high-yield thiotetracycline strains that can eliminate differences in bacterial growth and systematic errors, provide real-time quantification, and have ultra-high throughput. Summary of the Invention

[0009] The purpose of this invention is to address the aforementioned shortcomings of existing technologies by providing a high-yield thioseriate engineered bacterium based on dual reporter genes, its construction method, and its applications. Through a Kan-xylE dual reporter gene-mediated screening method, combined with high-pressure screening of resistance genes and visualization and quantitative detection of chromogenic genes, this approach not only effectively avoids false positives in single-resistance screening but also achieves high-throughput screening. Finally, this strategy, based on the overexpression of key genes tsrH and tsrI, provides a clear and efficient new approach for rationally increasing antibiotic yield.

[0010] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of this invention is to provide a method for constructing a high-thiostreptin-producing engineered bacterium based on dual reporter genes, comprising the following steps: A recombinant expression vector containing the promoter sequence of tsrI-tsrH and the reporter gene XylE was introduced into a host bacterium and transformed to obtain a donor bacterium. The sequence of the recombinant expression vector is shown in SEQ ID NO:1. The donor bacteria were co-cultured with Streptomyces laurentii, allowing the expression vector to be transferred into Streptomyces laurentii via binding, thereby obtaining the conjugate; The conjugates were cultured and screened in a medium containing kanamycin to obtain recombinant strains with kanamycin resistance. The recombinant strain with kanamycin resistance was sprayed with catechol solution, and XylE enzyme activity was verified by colorimetric analysis. Yellow positive recombinant strains were obtained by screening.

[0011] Furthermore, the recombinant expression vector comprises: The sequence of the target promoter is shown in SEQ ID NO:1; The reporter gene XylE is located downstream of the target promoter sequence; The kanamycin resistance gene located downstream of the reporter gene XylE; The target promoter simultaneously drives the expression of the reporter gene XylE and the kanamycin resistance gene.

[0012] Furthermore, the concentration of kanamycin is 50-120 μg / mL.

[0013] Furthermore, the culture conditions in the kanamycin-containing medium are 28-29°C for 7-8 days.

[0014] Furthermore, the concentration of the catechol solution is 0.05-0.1 mol / L.

[0015] Furthermore, the host bacteria are selected from bacteria or yeast.

[0016] Furthermore, the recombinant expression vector is introduced into the host bacteria via transformation, conjugation transfer, or electroconversion.

[0017] A second aspect of the invention is to provide the application of the described construction method in the evaluation and screening of high-thiostreptin-producing bacteria.

[0018] A third aspect of the present invention is to provide an engineered bacterium that produces high levels of thiostreptin, obtained by the aforementioned construction method.

[0019] A third aspect of the present invention is to provide the application of the engineered bacteria in the preparation of thiostreptomycin. Compared with the prior art, the beneficial effects of the technical solution provided by the present invention are as follows: (1) The method provided by the present invention has a very high screening accuracy (false positive elimination): Through the dual reporter gene (Kan-xylE) joint screening strategy, the present invention increases the screening hit rate of high-yield strains from 28.0% of the traditional single antibody screening to 92.0%, effectively eliminating the interfering strains of "high growth and low expression" (see Example 2 for details).

[0020] (2) The engineered bacteria provided by the present invention significantly improve the production of thiostreptomycin: the fermentation titer of the recombinant high-yield strain (such as SL-HI-53) obtained by screening reached 333.43 U / mL, which is 7.2 times that of the original starting strain, and the average yield is 3.3 times that of the single resistance screening group.

[0021] (3) The engineered bacteria provided by the present invention have excellent genetic stability (industrial applicability): Experiments have shown that the selected strains can be continuously passaged 10 times without the addition of antibiotics, simulating continuous industrial fermentation, and the plasmid retention rate is still as high as 97%, and the yield is maintained at 96.8% of the initial level, overcoming the problem of easy degradation of engineered bacteria, and have great industrial application value (see Example 3 for details). Attached Figure Description

[0022] Figure 1 A fragment gel image of PtsrI-tsrH target; Figure 2 This is a gel image of linear segments. In the image, well 1 is the marker, and wells 1-3 are all linear segments. Figure 3This is a gel image of the pDR2-PtsrI-tsrH plasmid. Well 1 in the image is the marker, and wells 2 and 3 are both pDR2-PtsrI-tsrH plasmids. Figure 4 This is a schematic diagram of the pDR2-PtsrI-tsrH plasmid structure. Figure 5 This is a chromogenic image of the SL-HI transformant of the recombinant strain; Figure 6 This is a standard curve of the potency of thiostreptomycin; Figure 7 To screen the inhibition zones of recombinant strain transformants, from left to right, the numbers are 53, 65, 68, 87, and 91. Figure 8 This is a comparison chart showing the titers of transformants from the better recombinant strains after screening. Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of this invention clearer, the specific embodiments and accompanying drawings are described in further detail below. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in this field or according to the product manual.

[0024] The culture medium information used in the embodiments of the present invention is as follows: LB liquid medium: tryptone 10 g / L, mother extract 5 g / L, sodium chloride 10 g / L.

[0025] LB solid medium: tryptone 10 g / L, mother extract 5 g / L, sodium chloride 10 g / L, agar powder 20 g / L.

[0026] 2×YT liquid culture medium: tryptone 16 g / L, mother extract 10 g / L, sodium chloride 5 g / L.

[0027] MS solid medium: 20 g / L soybean flour, 20 g / L mannitol, 15-20 g / L agar.

[0028] Seed culture medium: 1g glucose, 1g soybean meal, 1.5g corn steep liquor, 0.1g yeast extract, 0.1g potassium dihydrogen phosphate, 0.05g ammonium sulfate, 0.1g calcium carbonate, 0.02g magnesium sulfate, 0.01g ferrous sulfate heptahydrate; 100µl micro-liquid (5% cobalt chloride hexahydrate, 1% zinc sulfate heptahydrate, 1% copper sulfate dihydrate, 0.5% boric acid, 0.5% sodium molybdate), pH 7.0, add water to make up to 50mL, sterilize at 121℃ for 20min.

[0029] Fermentation medium: 3g glucose, 1g soybean meal powder, 1.5g corn steep liquor, 0.1g yeast extract, 0.1g potassium dihydrogen phosphate, 0.05g ammonium sulfate, 0.1g calcium carbonate, 0.02g magnesium sulfate, 0.01g ferrous sulfate heptahydrate; 200µl micro-liquid (5% cobalt chloride hexahydrate, 1% zinc sulfate heptahydrate, 1% copper sulfate dihydrate, 0.5% boric acid, 0.5% sodium molybdate), pH 7.0, add water to make up to 50mL, sterilize at 121℃ for 20min.

[0030] Double-layer identification plate: 2.4 g of agar powder and 120 mL of sterile water are used to prepare agar medium for the lower layer of the test plate, and 1.2 g of test medium and 60 mL of sterile water are used to prepare test medium for the upper layer of the test plate.

[0031] TSB liquid medium: tryptone 17 g / L, soybean papain hydrolysate 3 g / L, sodium chloride 5 g / L, dipotassium hydrogen phosphate 2.5 g / L, glucose 2.5 g / L.

[0032] The pDR2 plasmid used in this invention was obtained by inserting a Kan-xyLE dual reporter gene cassette into the commercially available pSET152 plasmid. Primers were designed to obtain the pSET152 linear vector template: Upstream primer: p-F1: gaaaataccgcatcaggcgccaatgaacaaaggtgtaatg Downstream primer: p-R1: ccccgaaccccagagtcccgctcagaagaactcgtcaagaa; The Kan-xyLE dual reporter gene was homologously recombinated with the pSET152 linear vector template to obtain plasmid pDR2. The sequence of pSET152 plasmid is shown in SEQ ID NO:2, the sequence of Kan-xyLE dual reporter gene is shown in SEQ ID NO:3, and the sequence of plasmid pDR2 is shown in SEQ ID NO:4.

[0033] All sequences used in this invention are artificially synthesized. *Streptomyces laurentii* was purchased from the Guangdong Microbial Culture Collection Center, accession number DSM 41684.

[0034] Example 1 This embodiment provides the preparation and screening of a recombinant strain that produces high levels of thiostreptin.

[0035] 1. Preparation of Streptomyces laurentii SL-HI containing dual reporter genes 1.1 Construction of conjugation transfer plasmid pDR2-PtsrI-tsrH The nucleotide sequence of the conjugation transfer plasmid pDR2-PtsrI-tsrH is shown in SEQ ID NO:1.

[0036] The specific methods for constructing plasmids are as follows: (1) Cloning of the target fragment of the tsr gene cluster PtsrI-tsrH Design primers: PtsrI-tsrH upstream primer: aggcgccacgcggatccgcgttcgagattccccatgggtt PtsrI-tsrH downstream primer: ttgttcataaaagtacttttcacgggaggttccggctgttc The genome of *Streptomyces laurentii* strain was extracted using a bacterial genome extraction kit. PCR was performed using the PtsrI-tsrH primers as described above. Using the genome of *Streptomyces laurentii*, a thiotetracycline-producing bacterium, as a template, a DNA fragment of approximately 1200 bp was amplified, covering the tsrH gene to the tsrI start codon (including the intergenic promoter region). The PCR reaction system and PCR amplification program are shown in Tables 1 and 2, respectively. The obtained PCR products were purified and recovered.

[0037] Table 1. PCR reaction system.

[0038]

[0039] Table 2. PCR amplification procedure.

[0040]

[0041] (2) Preparation of linear carriers Design primers: Upstream primer for linear vector: aaaagtacttttatgaacaaaggtgtaatgcgacc Downstream primers for linear vectors: cgcggatccgcgtggcgcctgatgcggt Using pDR2 plasmid as a template, PCR was performed using the aforementioned primers (upstream and downstream primers for the linear vector) to obtain a linear fragment of approximately 7300 bp. The template was removed from the linear fragment using Dpn1 enzyme to obtain a linear vector with homologous arms to the PtsrI-tsrH target fragment. The PCR reaction system and amplification program for the linear vector are shown in Tables 3 and 4, respectively. The obtained PCR products were purified and recovered.

[0042] Table 3. Linear vector PCR reaction system.

[0043]

[0044] Table 4. Linear vector PCR amplification program.

[0045]

[0046] (3) Homologous recombination and transformation of PtsrI-tsrH target fragment and linear vector The recovered PtsrI-tsrH target fragment was added to thawed JM109 competent cells along with the linear vector. After gentle mixing, the cells were incubated on ice for 20 min. The cells were then heat-shocked at 42 ℃ for 90 s, followed immediately by an ice incubation of 3 min. Under aseptic conditions, 750 μL of LB recovery medium was added, and the cells were cultured at 37 ℃ with shaking at 220 r / min for 1 h. After centrifugation at 5000 r / min for 5 min, the supernatant was discarded, and the cells were resuspended and plated on LB agar plates (containing kanamycin and apramycin) for overnight incubation at 37 ℃. Positive transformants were screened for plasmid verification. The homologous recombination reaction system and homologous recombination PCR amplification program are shown in Tables 5 and 6, respectively. The obtained PCR products were purified and recovered.

[0047] Plasmid validation primers: Plasmid verification upstream primer: aatttatgcggtgtgaaataccg Plasmid validation downstream primer: ctggtcgtcacggtccatct Table 5. Homologous recombination reaction system.

[0048]

[0049] Table 6. Homologous recombination PCR amplification procedure.

[0050]

[0051] (4) Extraction of plasmid pDR2-PtsrI-tsrH After scaling up the validated single clones, plasmids were extracted using the Omega Plasmid Extraction Kit following these steps.

[0052] (4.1) Transfer the bacterial culture to a 1.5 mL EP tube and centrifuge at 13000 r / min for 1 min; discard the supernatant and transfer the remaining bacterial culture in the test tube to the same EP tube again, and repeat the centrifugation operation 1-2 times.

[0053] (4.2) (Gram-negative bacteria) Add 250 μL of Solution I to the bacterial pellet and gently pipette until completely resuspended.

[0054] (4.3) (Gram-positive bacteria) Add 200 μL Solution I to the bacterial pellet, resuspend the bacterial cells, add 50 μL lysozyme (10 mg / mL), and incubate in a water bath at 37 ℃ for 30 min.

[0055] (4.4) Add 250 μL Solution II and gently invert the EP tube 4-5 times to mix (avoid violent shaking).

[0056] (4.5) Add 350 μL Solution III, mix well in the same way as in step (4), and centrifuge at 13000 r / min for 15 min.

[0057] (4.6) Transfer the supernatant to the adsorption column, let it stand for 1 min, and then centrifuge at 13000 r / min for 1 min; repeat the column loading operation 3 times (discard the filtrate each time).

[0058] (4.7) Add 500 μL of HBC buffer, centrifuge at 13000 r / min for 1 min, and discard the filtrate.

[0059] (4.8) Add 700 μL DNA Wash Buffer, centrifuge at 13000 r / min for 1 min, and discard the filtrate.

[0060] (4.9) Add 500 μL DNA Wash Buffer, centrifuge at 13000 r / min for 1 min, and discard the filtrate.

[0061] (4.10) After 2 min of air separation at 13000 r / min, the adsorption column is transferred to a new EP tube and dried in a metal bath at 55 ℃ for 8-12 min (until there is no ethanol odor). At the same time, sterile water is preheated at 55 ℃.

[0062] (4.11) Add 30-40 μL of preheated sterile water, let stand for 2 min, then centrifuge at 13000 r / min for 2 min; repeat the elution once.

[0063] The extracted plasmid was verified by agarose gel electrophoresis. Figure 3 After confirming the bands were correct, the sample was sent for sequencing. After confirming the plasmid sequencing results were correct, the pDR2-PtsrI-tsrH plasmid, which manipulates the Kan-xylE dual reporter gene using the original tsrI gene promoter PtsrI, was obtained. Figure 4 ).

[0064] 2. Construction of engineered strain SL-HI containing Kan-xylE dual reporter genes Recombinant strain SL-HI containing the pDR2-PtsrI-tsrH plasmid was obtained through conjugation transfer. 1. Preparation of conjugation transfer donor bacteria ET12567 / pUZ8002+pDR2-PtsrI-tsrH The plasmid pDR2-PtsrI-tsrH prepared above was introduced into Escherichia coli ET12567 / pUZ8002 by chemical transformation to obtain the conjugation transfer donor Escherichia coli ET12567 / pUZ8002+pDR2-PtsrI-tsrH.

[0065] 2. Joining transfer The conjugation transfer was performed using *Streptomyces laurenii* as the recipient organism, following these steps: 2.1 Preparation of Streptomyces laurentii spore suspension Mature spores of *Streptomyces laureensis* cultured at 28 ℃ for 5-7 days were washed off with 2×YT liquid medium, the spores were dispersed with glass beads, impurities and mycelium were removed with two layers of gauze, and the spores were counted with a hemocytometer. The spore suspension was then adjusted to a certain concentration with 2×YT for later use. 2.2 Escherichia coli ET12567 / pUZ8002+pDR2-PtsrI-tsrH was inoculated onto LB agar plates (containing 50 μg / mL apramycin, 25 μg / mL chloramphenicol, and 25 μg / mL kanamycin) and streaked at 37 °C overnight. 2.3 Pick a newly activated single colony from 2.2 and inoculate it into 5 mL LB medium (containing 50 μg / mL apramycin, 25 μg / mL chloramphenicol, and 25 μg / mL kanamycin) and incubate overnight at 37 ℃ and 180 r / min; 2.4 Inoculate the bacterial culture at a rate of 2% into 50 mL LB liquid medium (containing 50 μg / mL apramycin, 25 μg / mL chloramphenicol, and 25 μg / mL kanamycin), and incubate at 37 °C and 180 r / min until OD. 600 Approximately 0.4, pour into a 50 mL centrifuge tube, and centrifuge at 4000 r / min for 10 min at 4 ℃; 2.5 Wash the collected bacterial cells twice with 10 mL of antibiotic-free LB liquid medium to prevent residual antibiotics from inhibiting the spores of Streptomyces laureate. Finally, suspend the bacterial cells in 1 mL of LB liquid. 2.6 Conjugation transfer of Escherichia coli and Actinomycetes Take 10 mL of *Streptomyces laureate* spore suspension and heat-shock it in a 50 °C water bath for 10 min. Cool it to room temperature and revive it in a shaker at 28 °C for 2-4 h. Take 500 μL of *Escherichia coli* ET12567 / pUZ8002+pDR2-PtsrI-tsrH suspension and 500 μL of treated spores, and mix gently. Spread 100 μL of the diluted bacterial suspension onto MS medium supplemented with 10 mmol / L MgCl2 and incubate at 30 °C for 18-20 h. After 8-20 h, cover the plate with 1 mL of sterile water containing 0.3 μg nalidixic acid, 0.5 μg apramycin, and 0.5 μg kanamycin. Spread evenly using a spreader and continue incubating at 30 °C for 3-5 days until transformants appear.

[0066] Transformants were picked and added to 15 μL of lysis buffer, then incubated at 85 °C for 30 min to obtain a template. The plasmid pDR2-PtsrI-tsrH was successfully introduced into *Streptomyces laurentii* using plasmid verification primers. This recombinant strain was named SL-HI. The control strain was the original *Streptomyces laurentii* strain.

[0067] 3. Screening of recombinant strain SL-HI with high thiosericulture production Since the original promoter PtsrI of the tsrI gene manipulates PtsrI-tsrH, theoretically, if cells tolerate high concentrations of kanamycin, it indicates that the cells contain an overexpressed kanamycin resistance gene (Kan), further demonstrating that the recombinant bacterium contains an overexpressed tsrI gene, thus yielding a recombinant strain overexpressing both tsrH and tsrI genes. However, bacteria possess multiple resistance mechanisms, and using a single resistance for screening requires significant effort and carries the risk of false positives. Therefore, after initial growth screening using kanamycin resistance, further screening is performed using xylE enzyme activity.

[0068] 3.1 Recombinant strains overexpressing tsrH and tsrI genes were obtained from high concentrations of kanamycin. The SL-HI transformants of the recombinant strain obtained above were labeled and inoculated onto MS plates containing different concentrations of kanamycin, namely 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 and 150 μg / mL, and cultured at 28 ℃ for 7 days.

[0069] The results are as follows Figure 5 As shown, transformants grown on MS plates containing 50-120 μg / mL kanamycin could not grow on MS plates containing more than 120 μg / mL kanamycin.

[0070] Therefore, the transformants that can grow on MS plates containing 120 μg / mL kanamycin are candidate recombinant strains that overexpress the tsrH and tsrI genes.

[0071] 3.2 XylE enzyme activity verification Spray a 0.1M catechol aqueous solution onto an MS plate containing 120 μg / mL kanamycin from step 1 above (spray 4 times, totaling approximately 0.5 mL). Observe the colony color and qualitatively analyze the enzyme activity. If there is color development, it is considered a recombinant strain that overexpresses the tsrH and tsrI genes. If there is no color development, it is considered not a recombinant strain that overexpresses the tsrH and tsrI genes. Figure 6 This is the color development result.

[0072] A recombinant strain containing the pDR2 plasmid (containing the PtsrI-tsrH target fragment) was used as a control (a plasmid containing both neo-xylE reporter genes but without promoter manipulation). The control strain containing the pDR2 plasmid did not produce a noticeable yellow color after being sprayed with catechol aqueous solution, while the recombinant strain containing the pDR2-PtsrI-tsrH plasmid showed a distinct bright yellow background after being sprayed with catechol aqueous solution. Therefore, it is speculated that the increased XylE activity in the recombinant strain is due to the increased expression level caused by PtsrI promoter manipulation.

[0073] 3.3 Analysis of Thioxetin Potency in Transformants of Different Recombinant Strains (1) Detection of the yield of sulfur-producing streptococci using Bacillus subtilis as an indicator bacterium.

[0074] Preparation of indicator strain activation and identification plates. In this study, Bacillus subtilis, recommended in the national standard GB / T 13092.4-2008 "Determination of Enramycin in Feed," was used as a biological indicator to prepare Bacillus subtilis spore suspensions. The suspensions maintained their biological activity for 4 months after refrigeration at 0-4℃. The bacterial suspensions were diluted using a serial dilution method, with a dilution gradient of 10. 2 -10 10 Sensitivity tests were conducted at a dilution factor of 10. 3 and 10 4 At that time, the formed inhibition zone had a clear and regular edge. Compared with other dilution factors, its accuracy was the best, significantly superior to other gradients, with a diameter variation coefficient RSD of 1.21% and 2.46%. The final working solution concentration in the two-layer culture medium system was determined to be 10. 3 Dilution, corresponding to a spore concentration of 3.4 × 10⁻⁶. 7The bioassay uses spores of a certain bioassay indicator bacteria. In the preparation of the double-layer bioassay plate, the lower layer consists of approximately 20 mL of agar matrix. The upper layer is 8 mL of antibiotic assay medium No. 1 (pH 6.5-6.7) with 200 μL of Bacillus subtilis suspension added. After the bioassay plate solidifies and cools, it can be stored at 4 ℃ for later use.

[0075] (2) Plotting the standard curve of thiosin using the Oxford cup method Accurately weigh 10.24 mg of thiostreptin standard, dissolve it in DMSO solution, and dilute to volume in a 10 mL volumetric flask to prepare a 1000 U / mL thiostreptin standard solution. Then, dilute the standard with DMSO solution to prepare working standard solutions of 500 U / mL, 250 U / mL, 100 U / mL, 50 U / mL, and 25 U / mL, using 100 U / mL as the central concentration working standard solution. Add 100 µL of the above concentration working solution to Oxford cups placed on an identification plate. Place four Oxford cups on each identification plate, three containing the working standard solution of the specified concentration and one containing the central concentration working standard solution. Cover with a ceramic lid and place the plate in a 4°C refrigerator for 3 hours to allow the thiostreptin to fully penetrate the identification medium. Remove from the refrigerator and incubate at 37°C for 10-12 hours. Measure the diameter of the inhibition zone of each group of standard working solutions, calculate the average value, and then calculate the total average diameter of the inhibition zones of all standard working solutions at the center concentration of the identification plates, which will be used as the correction value. The diameter of the inhibition zone of each concentration group is corrected according to formula ①: Aa = Ba - B + A ① Where: Aa: the diameter of the inhibition zone of the standard working solution at this concentration after correction; Ba: correction value; B: the diameter reading of the inhibition zone of the standard working solution at the center concentration of this concentration group; A: the average value of the diameter reading of the inhibition zone of the standard working solution at this concentration.

[0076] A standard curve was plotted with the logarithm of the standard solution concentration on the x-axis and the diameter of the inhibition zone (mm) on the y-axis. The regression equation was then derived. (See the standard curve below.) Figure 6 .

[0077] (3) Detection of thiosericin activity in fermentation broth Transformants 53, 65, 68, 87, and 91 from the recombinant strains screened in Example 2 were inoculated onto MS plates containing 100 μg / mL kanamycin, with the original *Streptomyces laureate* strain as a control. The plates were cultured at 28°C for 7 days. Single colonies were then inoculated into seed culture medium (50 mL in a 250 mL Erlenmeyer flask), and cultured at 200 rpm on a shaker at 28°C for 48 h. The culture was then transferred to fermentation medium (50 mL in a 500 mL Erlenmeyer flask, 10% inoculation), with three replicates per strain, and cultured at 200 rpm at 28°C for 4-5 days. The seed culture medium formulation is shown in Table 7 below. Table 7. Culture medium formulation.

[0078]

[0079] The pH was adjusted to 7.0 using sodium hydroxide, and the mixture was autoclaved at 121°C for 20 minutes. The fermentation medium was formulated by increasing glucose to 4% and trace element solution to 0.4% based on the seed culture medium. In the example, the trace element solution consisted of: 5 g / L cobalt chloride hexahydrate, 1 g / L zinc sulfate heptahydrate, 1 g / L copper sulfate dihydrate, 0.5 g / L boric acid, and 0.5 g / L sodium molybdate.

[0080] After fermentation, 2 mL of fermentation broth was collected, and the supernatant was collected by centrifugation at 8000 rpm for 10 min. Thioxetine standard (purchased from Shanghai Yuanye Biotechnology Co., Ltd.) was used as a control.

[0081] Add 100 μL of supernatant to Oxford cups placed on identification plates. Each identification plate contains four Oxford cups: three replicates of the recombinant strain transformants, and one replicate of a 100 U / mL thiostreptin standard solution (central concentration). Cover with a ceramic lid and place the plate in a 4°C refrigerator for 3 hours to allow the thiostreptin to fully penetrate the identification medium. Remove from the refrigerator and incubate at 37°C for 10-12 hours. Measure the diameter of the inhibition zone for each standard working solution, calculate the average value, and substitute it into the standard curve formula mentioned above for calculation. Figure 7-8 As shown.

[0082] Submerged fermentation titer evaluation of the transformants from the screened recombinant strains showed that all selected strains produced higher yields of thiosericin than the control group containing the empty vector pDR2. The optimal transformant (transformant 53) achieved a fermentation titer of 333.43 U / mL, approximately 7.2 times that of the control group. This result strongly confirms that tsrH and tsrI are key genes in the thiosericin biosynthetic pathway, and that overexpression driven by the original promoters of these key genes can effectively increase thiosericin yield. It also validates the accuracy and practicality of the XylE-based visual screening system in screening high-yielding engineered strains.

[0083] Example 2 A comparative analysis of the accuracy and false positive rate of the dual reporter gene screening strategy and the single screening strategy.

[0084] To verify the significant advantages of the dual reporter gene (Kan-xylE) joint screening strategy described in this invention over existing single screening marker technologies, this embodiment sets up three sets of parallel screening experiments to compare the accuracy and false positive rate of different screening strategies in obtaining high-thiostreptin-producing recombinant strains.

[0085] 1. Experimental Grouping and Design After the constructed recombinant plasmid pDR2-PtsrI-tsrH was introduced into the original strain of Streptomyces laureate, the resulting transformant libraries were divided into three groups on average, and each group was screened using the following three different strategies: Control group A (single resistance screening): simulates existing screening methods that rely solely on resistance genes.

[0086] Screening criteria: Only select well-grown single colonies from MS plates containing 100 μg / ml kanamycin. No catechol colorimetric assay was performed.

[0087] Control group B (single enzyme activity screening): simulates the screening method in the current technology that relies solely on reporter gene color development.

[0088] Screening conditions: On plates containing a low concentration (50 μg / ml, just enough to prevent plasmid loss) of kanamycin, spray with a 0.1 M aqueous solution of catechol, and select only single colonies that show a deep yellow color reaction. Resistance to high concentrations of antibiotics is not investigated.

[0089] Experimental group (dual screening of the present invention): The "survival threshold-visual coupling" screening strategy of the present invention was adopted.

[0090] Screening criteria: Select single colonies that grow well and show a deep bright yellow color reaction after spraying with catechol on MS plates containing a high concentration of 120 μg / ml kanamycin.

[0091] From the three groups mentioned above, 50 single colonies were randomly selected from each group (a total of 150 samples), and shake-flask fermentation was carried out according to the fermentation conditions described in Example 1. After fermentation, the thiostreptin titer in the fermentation broth was detected using the inhibition zone method.

[0092] Criteria for determining high-yield strains: Fermentation units ≥ 200 U / mL (significantly higher than the starting strain and ordinary transformants).

[0093] Criteria for identifying false positive strains: Although they pass the initial screening (look good or have a yellow color), their fermentation units are <100 U / mL.

[0094] Calculation formulas: Screening accuracy = (Number of high-yielding strains / Total number of selected strains) × 100% False positive rate = (Number of false positive strains / Total number of selected strains) × 100% 2. Experimental Results The validation data of the three screening strategies are shown in Table 8: Table 8. Efficiency comparison data of different screening strategies.

[0095]

[0096] 3. Results Analysis The drawbacks of control group A: The false positive rate of resistance selection alone (control group A) was as high as 56%. Experiments revealed that many well-growing strains did not actually produce high yields. This may be due to non-productive amplification of plasmid copy numbers or the bacterial cell's own growth advantage, resulting in high biomass but low yield per unit area, thus masking the true expression level.

[0097] Limitations of Control Group B: While relying solely on colorimetric screening (Control Group B) yielded slightly higher accuracy than the resistant group, it still resulted in a high rate of false positives (44%). Some strains exhibited deep color development but slow growth, leading to a lower final fermentation yield. Furthermore, the colorimetric reaction was susceptible to interference from colony size, making precise quantification difficult.

[0098] The technical advantages of this invention are as follows: The experimental group adopted the dual screening model (Kan-xylE) constructed in this invention, based on high-concentration antibiotic selection pressure and high reporter gene expression level. Experimental results showed that this strategy, by introducing the dual screening model (Kan-xylE), effectively eliminated false positives and significantly improved the screening accuracy of high-yielding strains to 92.0%. Regarding fermentation performance, the average potency of the screened recombinant strains was 310.5 U / mL, demonstrating a significant synergistic effect, being 3.3 times and 2.4 times higher than the single-resistance screening group and the single-enzyme activity screening group, respectively.

[0099] Example 3 Validation of the genetic stability and subculture fermentation performance of the recombinant high-yield strain SL-HI.

[0100] To evaluate the genetic stability of the recombinant strain containing dual reporter genes constructed in this invention under no selection pressure, and whether it meets the requirements for industrial continuous fermentation production, this embodiment uses the highest-yielding strain SL-HI-53 (hereinafter referred to as SL-HI-53) obtained by screening as the research object and conducts a continuous passage stability experiment.

[0101] 1. Experimental Methods Subculture: The SL-HI-53 strain was inoculated into liquid TSB medium without any antibiotics (kanamycin) and cultured at 28°C and 220 rpm for 24 hours (defined as generation 1). Subsequently, it was transferred to fresh antibiotic-free TSB medium at an inoculum rate of 1%, once a day, for a total of 10 generations, simulating the multi-stage expansion cycle in industrial fermentation.

[0102] Plasmid retention rate detection: The bacterial cultures of the 1st, 5th and 10th generations were diluted and spread on antibiotic-free MS plates. After single colonies grew, 100 single colonies were randomly selected and inoculated onto MS plates containing 120 μg / ml kanamycin using the duplicate plate method.

[0103] Calculation formula: Plasmid retention rate (%) = (Number of colonies growing on the resistance plate / Total number of colonies picked) × 100%. Simultaneously observe the color development of the growing strains after spraying with catechol.

[0104] Fermentation potency stability test: The culture media of the 1st, 5th and 10th generations were used as seeds and inoculated into the fermentation medium (without antibiotics). Fermentation was carried out under the conditions described in Example 1. The final yield of thiostreptomycin was determined by the inhibition zone method.

[0105] 2. Experimental Results The stability data of strain SL-HI-53 during continuous passage under no selection pressure are shown in Table 9.

[0106] Table 9. Stability test data of recombinant strain SL-HI-53 after continuous passage.

[0107]

[0108] Note: Relative yield is based on the fermentation potency of the first generation (100%).

[0109] 3. Results Analysis and Conclusions Plasmid stability: Experimental results showed that even after 10 consecutive passages (approximately 240 hours) in the absence of kanamycin selection pressure, the resistance marker retention rate of strain SL-HI-53 remained as high as 97%, and all strains retaining resistance could undergo the XylE colorimetric reaction normally. This indicates that the dual selection model (Kan-xylE) of this invention does not impose an excessive metabolic burden on the host bacteria, and the recombinant genetic material can be stably inherited and is not easily lost.

[0110] Yield stability: Fermentation potency assays showed that the thiostilbin yield of the 10th generation strain decreased by only 3.2% compared to the 1st generation, remaining at a high level above 320 U / mL. This confirms the excellent genetic stability of this high-yield trait.

[0111] Industrial Application Value: In existing technologies, many recombinant Streptomyces strains often experience rapid plasmid loss during antibiotic-free fermentation, leading to a significant drop in yield. This embodiment demonstrates that the strains screened using the method of this invention overcome this defect, maintaining high yields without the need for continuous addition of expensive antibiotics during fermentation, significantly reducing industrial production costs and ensuring batch-to-batch consistency.

[0112] Where there is no conflict, the above embodiments and features described herein can be combined with each other.

[0113] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for constructing a high-yield thiosin-producing engineered bacterium based on dual reporter genes, characterized in that, Includes the following steps: A recombinant expression vector containing the promoter sequence of tsrI-tsrH and the reporter gene XylE was introduced into a host bacterium and transformed to obtain a donor bacterium. The sequence of the recombinant expression vector is shown in SEQ ID NO:

1. The donor bacteria were co-cultured with Streptomyces laurentii, allowing the expression vector to be transferred into Streptomyces laurentii via binding, thereby obtaining the conjugate; The conjugates were cultured and screened in a medium containing kanamycin to obtain recombinant strains with kanamycin resistance. The recombinant strain with kanamycin resistance was sprayed with catechol solution, and XylE enzyme activity was verified by colorimetric analysis. Yellow positive recombinant strains were obtained by screening.

2. The construction method according to claim 1, characterized in that, The recombinant expression vector comprises: Promoter sequences containing tsrI-tsrH; The reporter gene XylE is located downstream of the promoter sequence; The kanamycin resistance gene located downstream of the reporter gene XylE; The promoter simultaneously drives the expression of the reporter gene XylE and the kanamycin resistance gene.

3. The construction method according to claim 2, characterized in that, The concentration of kanamycin is 50-120 μg / mL.

4. The construction method according to claim 3, characterized in that, The culture conditions for kanamycin-containing medium are 28-29°C for 7-8 days.

5. The construction method according to claim 1, characterized in that, The concentration of the catechol solution is 0.05-0.1 mol / L.

6. The construction method according to claim 1, characterized in that, The host bacteria are selected from bacteria or yeast.

7. The construction method according to claim 1, characterized in that, The recombinant expression vector is introduced into the host bacteria through transformation, conjugation transfer, or electroporation.

8. The application of the construction method as described in any one of claims 1-7 in the evaluation and screening of high-thiostreptin-producing bacteria.

9. An engineered bacterium that produces high levels of thiosphingomyelin, characterized in that, Obtained by the construction method according to any one of claims 1-7.

10. The use of the engineered bacteria as described in claim 9 in the preparation of thiostreptin.