Reagent composition, kit and application for detecting cervical cancer and precancerous lesions
By detecting the methylation status of the MDGA2, ZNF773, CSDAP1, and CLEC14A genes, the problem of missed diagnoses and false positives in the detection of cervical cancer and precancerous lesions in existing technologies has been solved, achieving highly sensitive and specific cervical cancer screening and providing a non-invasive and rapid detection method.
Patent Information
- Application Number
- CN202610412712.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-31
- Publication Date
- 2026-05-29
AI Technical Summary
Existing methods for detecting cervical cancer and precancerous lesions, such as TCT and HPV testing, have high rates of missed diagnoses and cannot distinguish between transient infection and carcinogenic risk. DNA methylation testing suffers from insufficient specificity, high false positive rates, and complex operation, making it difficult to meet the screening requirements of high sensitivity, specificity, and ease of operation.
The methylation levels of MDGA2, ZNF773, CSDAP1, and CLEC14A genes were detected using quantitative real-time PCR technology with specific primers and probes. The methylation status of cervical marker genes was detected, and reagent compositions and kits were provided for screening cervical cancer and precancerous lesions.
It has improved the detection rate and specificity of cervical cancer, enabling non-invasive and rapid detection of cervical cancer and precancerous lesions, significantly improving clinical compliance, and effectively distinguishing the risk of cancer.
Smart Images

Figure CN122104913A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, specifically to a reagent composition, kit, and application for detecting cervical cancer and precancerous lesions. Background Technology
[0002] Cervical cancer is one of the fourth leading causes of cancer death among women worldwide. Early detection through screening in the precancerous stage, followed by timely intervention and treatment, can effectively reduce the incidence and mortality rates of cervical cancer. Currently, the main screening methods for cervical cancer include cervical cytology (TCT) and HPV testing, but both have significant limitations: TCT testing is subject to subjective interpretation and has a high rate of missed diagnoses; HPV testing cannot distinguish between "transient infection" and "carcinogenic risk." Therefore, there is an urgent need to develop more effective early screening and diagnosis technologies to compensate for the shortcomings of existing testing methods.
[0003] DNA methylation, as an epigenetic alteration, plays a crucial role in the early development and progression of cervical cancer: the methylation level of specific gene promoter regions increases with the progression of cervical intraepithelial neoplasia (CIN). Compared with traditional TCT and HPV tests, DNA methylation testing offers advantages such as precise quantification of cancer risk, higher specificity, superior sensitivity for adenocarcinoma detection, and the ability to identify high-risk patients with potential progression, providing more valuable information for clinical practice. Currently, several NMPA-certified cervical cancer methylation PCR testing products are available on the market, but they still suffer from problems such as insufficient specificity and high false positive rates, DNA damage and degradation, incomplete transformation, and complex operation. Therefore, there is an urgent need to develop a cervical cancer screening technology that achieves high levels of sensitivity, specificity, and accuracy, along with good stability and ease of operation. Summary of the Invention
[0004] The purpose of this invention is to overcome the aforementioned problems in the prior art and provide a reagent composition, kit, and application for detecting cervical cancer and precancerous lesions. The reagent composition and kit provided by this invention, by detecting the methylation level of specific genes, have high detection specificity and sensitivity, and can efficiently screen for the risk of cervical cancer and (advanced) precancerous lesions.
[0005] To achieve the above objectives, a first aspect of the present invention provides a reagent composition for detecting cervical cancer and precancerous lesions, the reagent composition comprising a reagent for detecting the methylation level of cervical cancer marker genes or fragments thereof, wherein the marker genes include MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A Gene.
[0006] A second aspect of the present invention provides a reagent composition for detecting the methylation level of a marker gene, the marker gene comprising... MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A At least one of the genes, the reagent composition comprising at least one of the following primers and optional probes: (1) Detection MDGA2 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:6-7, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:8; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:25-26, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:27; (2) Detection ZNF773 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:9-10, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:11; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:28-29, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:30; (3) Detection CSDAP1 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:12-13, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:14; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:31-32, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:33; (4) Detection CLEC14A Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:15-16, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:17; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:34-35, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:36.
[0007] A third aspect of the present invention provides a kit for detecting cervical cancer and precancerous lesions, the kit comprising the reagent composition described in the first or second aspect.
[0008] The fourth aspect of the present invention provides the use of the reagent composition described in the first or second aspect, or the kit described in the third aspect, in the preparation of products for screening cervical cancer or precancerous cervical lesions.
[0009] The fifth aspect of the present invention provides joint detection MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A Application of reagents for gene methylation levels in the preparation of products for screening cervical cancer or precancerous cervical lesions.
[0010] Through the above technical solution, the present invention can achieve at least the following beneficial effects: (1) This invention screened out four relevant biomarker genes and their optimal methylation regions. The combined detection of multi-gene methylation significantly improved the detection rate of cervical cancer. The sensitivity and specificity were both high, which could effectively distinguish cervical cancer and assist clinical judgment of cervical cancer risk.
[0011] (2) The present invention has a short detection time and a simple operation procedure. In addition, the present invention can realize non-invasive detection / diagnosis of cervical cancer and precancerous lesions, which significantly improves patients' clinical compliance. Attached Figure Description
[0012] Figure 1 This is a graph showing the results of using the reagent combination of the present invention to perform real-time PCR detection on positive samples; Figure 2 This is a graph showing the results of quantitative real-time PCR detection of negative samples using the reagent combination of the present invention. Detailed Implementation
[0013] The endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0014] In this invention, "methylation level" and "methylation status" both refer to the methylation status of the target sequence in the marker gene (which may include whether the target sequence in the marker gene is methylated, the degree of methylation, etc.), have similar meanings, and can be used interchangeably.
[0015] In this invention, the term "detection of cervical cancer and precancerous lesions" includes the detection and diagnosis of cervical cancer and precancerous lesions. Based on the severity of the lesions, cervical cancer and precancerous lesions are mainly classified into four grades: CIN1, CIN2, CIN3, and cervical cancer (CC). "CIN" refers to the grade of cervical intraepithelial neoplasia; "CIN1" refers to grade 1 cervical intraepithelial neoplasia, "CIN2" refers to grade 2 cervical intraepithelial neoplasia, and "CIN3" refers to grade 3 cervical intraepithelial neoplasia. The higher the grade, the higher the risk of cervical cancer. In this invention, "high-grade cervical precancerous lesions" include CIN2 and CIN3. "CIN2+" refers to CIN2, CIN3, and CC; "CIN3+" refers to CIN3 and CC.
[0016] Studies have shown that the methylation status of specific genes is closely related to the occurrence and development of cancer. In the field of cervical cancer and precancerous lesions, multiple genes have been identified as being associated with their pathogenesis, and detection methods targeting the methylation levels of these genes are constantly being updated for preliminary screening of cervical cancer and precancerous lesions. However, the screening efficacy of existing gene detection methods is still unsatisfactory, with frequent problems such as missed screenings and false positives, making it difficult to meet the needs of precise clinical screening. Through long-term research, the inventors of this invention have ingeniously discovered that the combined detection of the methylation levels of several specific genes among cervical cancer-related marker genes has excellent sensitivity and specificity, thereby effectively improving screening accuracy and significantly reducing referral rates. Therefore, this invention provides a method for detecting the methylation levels of specific genes in a sample... MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A A method for in vitro detection of cervical cancer and / or precancerous cervical lesions based on the methylation status of target sequences in genes. The method provided by this invention can detect cervical cancer and / or precancerous cervical lesions non-invasively and rapidly.
[0017] Based on this, a first aspect of the present invention provides a reagent composition for detecting cervical cancer and precancerous lesions, the reagent composition comprising a reagent for detecting the methylation level of cervical cancer marker genes or fragments thereof, wherein the marker genes include MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A Gene. The methylation status of the marker gene or a fragment thereof is characterized by the methylation of the target sequence of the marker gene.
[0018] The gene names involved in this invention have general meaning in the art, and their complete sequences can be obtained through conventional methods in the art, such as by querying public bioinformatics databases like NCBI. For example, MDGA2The gene (MAMdomain containing glycosylphosphatidylinositol anchor 2) is located on human chromosome 14 and encodes a protein containing a MAM domain and anchored to the cell membrane via glycosylphosphatidylinositol (GPI). This protein is primarily involved in the regulation of synapse formation and interneuronal communication, playing a crucial role in brain development. MDGA2 The complete gene sequence can be found in Genbank accession number: NC_000014.9. ZNF773 (Zinc Finger Protein 773) is a gene belonging to the C2H2 type zinc finger protein family, located on human chromosome 19. It is involved in transcriptional regulation, plays a potential role in embryonic development and cell differentiation, and is associated with a variety of diseases such as cancer and nervous system disorders. ZNF773 The complete gene sequence can be found in Genebank accession number: NC_000019.10. CLEC14A The gene (C-type lectin domain containing 14A) is located on human chromosome 14 and encodes a member of the C-type lectin family, an endothelial cell-specific transmembrane protein that plays a regulatory role in angiogenesis, bone formation, and tumor development. CLEC14A The complete gene sequence can be found in Genebank accession number: NC_000014.9. CSDAP1 Gene (CSDA pseudogene 1), also known as YBX3P1 (Y-box binding protein 3 pseudogene 1) is a pseudogene located on human chromosome 16. YBX3P1 With functional genes YBX3 (Y-boxbinding protein 3) is homologous, and the protein encoded by the latter may be involved in RNA metabolism or cell cycle regulation, but YBX3P1 It is not labeled as having protein-coding capabilities. CSDAP1 The complete gene sequence can be found in Genebank accession number: NC_000016.10.
[0019] The reagent composition provided by this invention can target the complete MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A The methylation level (or state) of a gene can be detected, or the methylation level of a specific segment (e.g., a single segment or multiple segments) within the aforementioned gene can be detected. The inventors discovered in their research that, for MDGA2 Gene, ZNF773 Gene, CSDAP1Genes and CLEC14A Detecting and analyzing the methylation levels of specific regions within a gene can achieve the goal of screening for cervical cancer and precancerous lesions with high sensitivity and specificity. Compared to detecting the entire gene, detection of specific regions is simpler and easier to perform; therefore, this invention preferably uses a specific region in the reagent composition. MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A A reagent for detecting the methylation level of specific regions in a gene.
[0020] According to some preferred embodiments of the present invention, the reagent used to detect the methylation status of cervical cancer and precancerous lesion marker genes or fragments thereof is a reagent used to detect the methylation level of CpG island regions or fragments thereof in cervical cancer and precancerous lesion marker genes. CpG is an abbreviation for cytosine (C)-phosphate (p)-guanine (G), and a "CpG island" refers to a region on the genome rich in CpG dinucleotides.
[0021] The reagent composition provided by this invention can detect the methylation level in the complete sequence of the CpG island region in the aforementioned genes, or it can detect the methylation level in a portion of the region (such as a single fragment or multiple fragments).
[0022] According to some particularly preferred embodiments of the present invention, the reagent composition includes reagents for detecting the methylation status of gene fragments (also referred to as “target sequences” or “target marker sequences” in the present invention) such as SEQ ID NO:1-4 or SEQ ID NO:21-24.
[0023] The reagent composition of the present invention can detect the methylation level of the target detection region sequence, or it can detect the methylation level of a segment in a characteristic gene that has at least 80% identity with the target sequence (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 100%, or any range of two of the above values, or any intermediate value within that range). For example, it can detect the methylation level of a gene fragment that contains additional nucleotides on top of the above sequence.
[0024] In this invention, "identity" refers to the percentage of identical sequences between two sequences. For example, 90% identity between sequence 1 and sequence 2 means that 90% of sequence 1 is identical to sequence 2, or 90% of sequence 2 is identical to sequence 1. Differences between the two sequences can be due to nucleotide deletions, additions, or substitutions. For example, sequence b is obtained by deleting 20 consecutive nucleotides from the 5' end of sequence a, which contains 100 nucleotides. Sequence a and sequence b have 80% identity, while sequence b and sequence a have 100% identity.
[0025] According to a preferred embodiment of the present invention, the reagent composition further includes a reagent for detecting an internal standard. An "internal standard" refers to a non-target gene (or fragment thereof) that is detected together with the target gene (or a fragment thereof). Adding an internal standard reagent during detection can further improve detection accuracy. Typically, a known conserved gene from the target analyte (e.g., the sample used for detection) can be selected as the internal standard.
[0026] Preferably, the internal label is at least one of human housekeeping genes or fragments thereof. "Housekeeping genes," also known as "family-managing genes" or "housekeeping genes," are a class of genes that are stably expressed in all cells.
[0027] According to a particularly preferred embodiment of the present invention, the internal standard is... ACTB The gene (whose complete sequence can be found in Genebank accession number: NC_000007.14) or a fragment thereof. ACTB The gene is the gene that encodes human cytoskeleton actin (β-Actin).
[0028] Preferably, the nucleotide sequence (target sequence) of the internal standard is as shown in SEQ ID NO:5.
[0029] In this invention, the reagents used to detect the methylation level of the marker gene and (optionally) the internal standard can be conventional reagents used in methods capable of performing the corresponding detections in the art. For example, detection can be performed using amplification-sequencing, biochips, quantitative PCR for methylation, etc. Correspondingly, the reagent composition of this invention can use reagents commonly used in the above-mentioned methods.
[0030] For example, when using quantitative real-time PCR for methylation detection, according to a preferred embodiment of the present invention, the reagent composition includes nucleic acid primers and probes. "Quantitative real-time PCR for methylation" refers to a method that involves converting the region to be detected by sulfite conversion or digesting it with a methylation-sensitive restriction endonuclease, followed by quantitative real-time PCR detection using primers and probes specifically designed for the detection target, thereby determining the methylation level of the region to be detected.
[0031] Any nucleic acid primers and probes capable of detecting the aforementioned marker genes and (optionally) internal standards are applicable to this invention. "Primer" refers to an oligonucleotide that, when placed under conditions that induce the synthesis of primer extension products complementary to the nucleic acid strand—that is, in the presence of nucleotides and an inducer such as a DNA or RNA polymerase and at suitable temperature and pH—can serve as a synthesis initiation site. Primers typically contain at least about 9, 10, 15, 20, or 25 or more nucleotides. "Probe" refers to a nucleic acid sequence that, under specified conditions, hybridizes to a target sequence and can be used to detect the presence of that target sequence.
[0032] According to a preferred embodiment of the present invention, the reagent composition comprises a combination of primers and optionally probes: (1) Detection MDGA2 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:6-7, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:8; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:25-26, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:27; (2) Detection ZNF773 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:9-10, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:11; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:28-29, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:30; (3) Detection CSDAP1 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:12-13, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:14; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:31-32, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:33; (4) Detection CLEC14A Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:15-16, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:17; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:34-35, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:36.
[0033] According to a particularly preferred embodiment of the present invention, the reagent composition further includes a detection... ACTB Primers and optional probes for the gene: primers with nucleic acid sequences as shown in SEQ ID NO: 18-19, and optional probes with nucleic acid sequences as shown in SEQ ID NO: 20.
[0034] According to the present invention, in order to realize the detection of the above-mentioned marker genes by quantitative real-time PCR of methylation, the probe is modified with a reporter group (usually modified at the 5' end), preferably a fluorescent reporter group. Any fluorescent reporter group commonly used in the art can be used in the present invention, such as ATTO 425, HEX, FAM, ROX, CY5, Quasar705, Alexa Fluor405, etc. Preferably, the (fluorescent) reporter groups modified on different probes are (fluorescent) reporter groups that are detected using different fluorescence detection channels (that is, the reporter groups on different probes are different).
[0035] According to a preferred embodiment of the present invention, the probe is further modified with a quenching group (usually modified at the 3' end), preferably a fluorescence quenching group. Any quenching group commonly used in the art in conjunction with a reporter group is applicable to the present invention. For example, it can be BHQ0, BHQ1, BHQ2, SQ1, SQ2, etc. Those skilled in the art are familiar with the pairing between reporter groups and their corresponding quenching groups; the quenching groups on different probes can be the same or different, which will not be elaborated here.
[0036] According to some preferred embodiments of the present invention, the reagent composition further includes a negative control reagent and / or a positive control reagent.
[0037] Negative control reagents refer to unmethylated target detection genes (such as the aforementioned marker genes or fragments thereof). In the reagent compositions provided by this invention, the negative control may contain only one verified unmethylated marker gene or fragment thereof, or it may contain multiple verified unmethylated marker genes or fragments thereof.
[0038] A positive control reagent refers to a target gene known to be methylated (such as the aforementioned marker gene or its fragment). In the reagent composition provided by this invention, the positive control may contain only one validated methylated marker gene or its fragment, or it may contain multiple validated methylated marker genes or their fragments.
[0039] In the reagent composition provided by the present invention, both the negative control and the positive control can be obtained by conventional means, such as by artificial synthesis.
[0040] It should be noted that the above-described reagent composition of the present invention actually achieves the following: MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A The detection of gene methylation can therefore serve as a product for detecting the aforementioned gene methylation.
[0041] Therefore, a second aspect of the present invention provides a reagent composition for detecting the methylation level of a marker gene, the marker gene comprising... MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A At least one of the genes, the reagent composition comprising at least one of the following primers and optional probes: (1) Detection MDGA2 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:6-7, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:8; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:25-26, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:27; (2) Detection ZNF773 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:9-10, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:11; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:28-29, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:30; (3) Detection CSDAP1 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:12-13, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:14; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:31-32, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:33; (4) Detection CLEC14A Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:15-16, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:17; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:34-35, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:36.
[0042] The reagent composition may also contain other components of the reagent composition in the first aspect, as described above, and will not be repeated here. This reagent composition can be used to detect cervical cancer and precancerous lesions, and can also be used in any other scenario requiring the detection of the methylation levels of the aforementioned marker genes.
[0043] A third aspect of the present invention provides a kit for detecting cervical cancer and precancerous lesions, the kit comprising the reagent composition described in the first or second aspect.
[0044] The kit provided by this invention may contain only the core reagents for detecting cervical cancer and precancerous cervical lesions (such as primers and probes used in the aforementioned marker gene detection), or it may further contain other conventional reagents required for the detection process (such as buffer systems, enzymes, dNTPs, and other reagents required for PCR detection; or reagents required for sample pretreatment steps such as nucleic acid extraction, purification, and methylation detection). Any reagent commonly used in the field for marker gene detection can be applied to this invention, and those skilled in the art can select and adjust it according to the actual detection technology used.
[0045] According to some preferred embodiments of the present invention, the kit further includes at least one of an enzyme, a buffer solution, a magnesium source, and dNTPs.
[0046] Preferably, the enzyme comprises a methylation-sensitive restriction endonuclease and / or a DNA polymerase. Any enzyme suitable for use in methylation-based quantitative PCR is applicable to this invention. Preferably, the methylation-sensitive restriction endonuclease comprises at least one of HpaII, HinP1I, and HhaI. Any DNA polymerase available in the art for methylation-based quantitative PCR can be used in this invention; for example, conventional DNA polymerases or hot-start DNA polymerases (such as Taq polymerase) can be used.
[0047] Preferably, the magnesium source comprises a water-soluble inorganic magnesium salt. Typically, the magnesium source can be provided in aqueous solution form, such as Mg... 2+ Magnesium chloride, magnesium sulfate, magnesium nitrate, etc., with a final concentration of 1-6 mM.
[0048] More preferably, the kit also includes reagents and instruments for nucleic acid extraction and / or purification.
[0049] The reagents (or instruments) used for nucleic acid extraction and / or purification are primarily used to extract nucleic acids from samples, and the extracted nucleic acids are further detected using the reagents contained in the kit of this invention for detecting the methylation level of marker genes. Any reagents in the art that can be used to extract / purify nucleic acids from biological samples are applicable to this invention; they can be purchased directly from commercial sources or prepared according to existing technology. Biological samples can be test samples collected from subjects in need, such as at least one of histological sections, tissue biopsies / paraffin-embedded tissues, and cells (e.g., cervical exfoliated cells).
[0050] In this invention, there are no particular restrictions on the concentration of the various reagents contained in the kit, and they can be adjusted according to actual testing needs.
[0051] To achieve better detection results (such as improved sensitivity, specificity, and accuracy), according to some preferred embodiments of the present invention, the reagents included in the kit contain Mg. 2+ The final concentration of the primer can be 1-6 mM; the final concentration of the dNTPs can be 1-80 mM; the final concentration of the methylation-sensitive restriction endonuclease can be 0.01-30 U / μL; the final concentration of the primer can be 0.1-40 μM; and the final concentration of the probe can be 0.1-20 μM. The final concentrations of primers and probes refer to the final concentration of one primer / probe.
[0052] The present invention further provides a method for detecting cervical cancer and precancerous lesions, the method comprising detecting a sample using the reagent composition described in the first or second aspect, or the kit described in the third aspect.
[0053] The methods provided by this invention can be diagnostic or non-diagnostic. For example, diagnostic methods may include using the reagent compositions or kits provided by this invention to test samples from subjects in need and determine whether they pose a risk of cervical cancer or precancerous lesions (especially high-grade precancerous lesions), thereby determining subsequent treatment plans (e.g., whether to refer the patient, whether to proceed with further treatment, etc.). As another example, non-diagnostic methods may include using the reagent compositions or kits provided by this invention to test samples in research or non-diagnostic testing, such as in studies of the mechanisms of cervical cancer and precancerous lesions, drug development, etc.
[0054] The fourth aspect of the present invention provides the use of the reagent composition described in the first or second aspect, or the kit described in the third aspect, in the preparation of products for screening cervical cancer or precancerous cervical lesions.
[0055] Similarly, the present invention also provides the use of the reagent composition described in the first or second aspect, or the kit described in the third aspect, in screening samples for cervical cancer or precancerous cervical lesions.
[0056] The fifth aspect of the present invention provides joint detection MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A Application of reagents for gene methylation levels in the preparation of products for screening cervical cancer or precancerous cervical lesions.
[0057] Similarly, the present invention further provides for... MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A Application of combined detection of gene methylation levels in the detection of cervical cancer or precancerous lesions of the cervix.
[0058] The applications of the fourth and fifth aspects provided by the present invention can be diagnostic (e.g., for medical testing to further determine and identify subsequent testing / treatment plans) or non-diagnostic (e.g., for research work, for drug screening, disease mechanism research and verification, etc.).
[0059] The present invention will be described in detail below through embodiments. It should be understood that the following embodiments are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.
[0060] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available products purchased from regular chemical or biological reagent / material suppliers, and all reagents are of analytical grade.
[0061] Example 1 This example illustrates the detection target and primer sequence.
[0062] by MDGA2 , ZNF773 , CSDAP1 as well as CLEC14A The four gene promoter regions' CpG islands were used as combined detection targets (target sequences are shown in SEQ ID NO: 1-4, respectively), and were employed... ACTB Using the gene as an internal standard for detection, with its target sequence as shown in SEQ ID NO: 5, a detection system (reagent composition) for early cervical cancer screening has been developed.
[0063] MDGA2 Target sequence: GCCACCGCCACCGCTCTCCAAAATAGCCTTTAGCGCCCGGCCAGCGTAGAGGTGCTCTGGCCGGCCGCACCAATTCCCGGAGCCGAAAGCAGAGTCCAGGCACCGCCACTTGCAAGAGAGGGAGAATGCCAGGCAAATACCCGATCCGCACACACGTC (SEQ ID NO: 1) ZNF773 Target sequence: GCGCCGCGCCGTGAGCCGCGATGCTTGGCCAATGAAAAGAGGTCTACCCGAGAGTGCGACGCGCAATGGGCGGGACTTCCGGCGTCTCCCCTCGGCGGTTGCTTTCGCTGCCCTCAAGAGAACTCAGCTTGCCGGAAGCTGGTTGTTCGCTGCGGCGACCAGCTCCGGAAAGCGCGGTGGGGACGCGCTGTGTTCTCGCAGCTCAGAGGCGGGTCTGAGGCTCGGTGGCGGCGCCCAGGGTGGCCCGGGCCCTT (SEQ ID NO: 2) CSDAP1 Target sequence: CACCCGGCTCTTGGTCGCGGGGTCCTGGGGAGCCGCGGCGGCCGCCACCGCAGGAGCCTGCTGGAGGGTGGTGGTGATGATGGTGGCCTCGCCCGCCTCGCTCATGCCTCCTCCTCCTCTGCTCTCGCTCATGCGCCTCGGTGGCGGTTGGTCGGCGGTTAGTGCGGCTGGTGGTCGCCGCGGCCGGGGCTCGCTCTCGGGGAGGCCGGGGCTGATCTCGCGGCGCAG (SEQ ID NO: 3) CLEC14A Target sequence: GGGGCAGGGACACAACACATCGCCCGAGAGTTTGTCCCAGCGAGCGCCGATTTCGTCCGCGATGCAAGTAACTGAGATCGGGAGCTGTCCCCGGCAGAGCGCACTCACCTCGGTCCCAGGTGGACTGAAGTCCAGAGCGGCGCTGTGCAGCTGGAAGGGCGCGCGATAGCTCAAGTTAGAGGCGGCCCCGGGGCGCG (SEQ ID NO: 4) ACTB Target sequence: TTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTTTTTTTAATAGTCATTCCAAATATGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCACTTCTCTCTAAGGAGA ATGGCCCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAGCATTGCTTTCGTGTAAATTATGTAATGCAAAATTTTTTTAATCTTCGCCTTAATACTTTTTTATTTTGTTTTATTTTGAATGATGAGCCTTCGTGCCCCCCTCCCCCTTTTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGA (SEQ ID NO: 5) The primers and probes used for detection are shown in Table 1, and all were synthesized by Hunan Kangde Biotechnology Co., Ltd. In Table 1, primers marked with "F" are upstream primers, primers marked with "R" are downstream primers, and probes are marked with "P".
[0064] Table 1
[0065] Example 2 This example illustrates the detection of reference sample gene methylation levels.
[0066] Positive samples: prepared by mixing fully methylated human genomic DNA and unmethylated cervical exfoliated cell genomic DNA from normal individuals, targeting the target gene. The prepared concentrations are: 1 ng / μL containing 10% fully methylated human genomic DNA (1 ng / μL unmethylated cervical exfoliated cell genomic DNA from normal individuals: 1 ng / μL fully methylated human genomic DNA = 9:1); 1 ng / μL containing 1% fully methylated human genomic DNA (1 ng / μL unmethylated cervical exfoliated cell genomic DNA from normal individuals: 1 ng / μL fully methylated human genomic DNA = 99:1); and 1 ng / μL containing 0.5% fully methylated human genomic DNA (1 ng / μL unmethylated cervical exfoliated cell genomic DNA from normal individuals: 1 ng / μL fully methylated human genomic DNA = 199:1).
[0067] Negative sample: Human genomic DNA with no target gene methylation verified by sequencing, at a concentration of 10 ng / uL.
[0068] Testing process: 1. PCR system preparation: Prepare PCR reaction solution according to the reagent formula in Table 2. In Table 2, PCR amplification buffer (S10) was purchased from Hunan Kangde Biotechnology Co., Ltd., catalog number PR001-10; hot-start enzyme was purchased from Hunan Kangde Biotechnology Co., Ltd., catalog number TQ006-03; methylation sensitive restriction endonuclease mix was MRE S01 purchased from Hunan Kangde Biotechnology Co., Ltd., catalog number ME012-01.
[0069] Table 2
[0070] Add 10 μL of sample to the PCR reaction tube, then add 40 μL of PCR reaction solution, cap the PCR tube, vortex to mix, and centrifuge briefly for 5 seconds.
[0071] 2. Fluorescent PCR reaction and result analysis (1) Place the PCR reaction tube into the sample slot of the amplification instrument and set the name of the sample to be tested in the corresponding order.
[0072] (2) Fluorescence detection channel selection: Select the FAM channel (Reporter: FAM, Quencher: None) for detection. MDGA2 Select the HEX channel (Reporter: HEX, Quencher: None) for detection. ZNF773 Select the ROX channel (Reporter: ROX, Quencher: None) for detection. CLEC14ASelect Alexa Fluor 405 channel (Reporter: Alexa Fluor 405, Quencher: None) for detection. CSDAP1 The CY5 channel (Reporter: CY5, Quencher: None) was selected as the internal standard for detecting housekeeping genes. ACTB .
[0073] (3) The reaction conditions for real-time PCR are shown in Table 3: Table 3
[0074] (4) Results Analysis After the reaction, the instrument automatically saves the results and performs automatic analysis using its built-in software. The intersection of the amplification curve and the threshold line is called Ct (i.e., cycle threshold, which refers to the number of cycles required for the fluorescence signal in the PCR reaction tube to reach the set threshold). The amplification curve for the standard is shown below. Figure 1 and Figure 2 As shown, the detection reagent provided by this invention has a sensitivity that can reach 0.5% methylation of the target gene in 1 ng / µL nucleic acid, and no non-specific amplification in 100 ng / µL unmethylated DNA (see [reference]). Figure 2 This indicates that the kit of the present invention has good specificity, and it can also be detected even when the detection concentration in the positive control is low, indicating that the reagent composition of the present invention has high sensitivity.
[0075] Example 3 This example illustrates the clinical detection of exfoliated cervical cell samples.
[0076] The test samples used in this embodiment were all cervical exfoliated cell samples collected clinically, and the research content of this embodiment has obtained informed consent from the relevant personnel.
[0077] A total of 487 clinical cervical exfoliated cell samples were collected, including 85 patients with cervical cancer, 195 cases of cervical intraepithelial neoplasia grade 1 (CIN1), 100 cases of cervical intraepithelial neoplasia grade 2 (CIN2), 50 cases of cervical intraepithelial neoplasia grade 3 (CIN3), and 57 normal samples. Nucleic acid extraction was performed using Sansure Biotech's S10025 nucleic acid extraction reagent and the Natch48 extraction instrument. Following the procedure in Example 2, the nucleic acid samples underwent enzyme digestion and PCR amplification detection in the same reaction tube.
[0078] Based on the lowest detection limit of the test reagent, set MDGA2 , ZNF773 , CSDAP1 as well as CLEC14AThe positive threshold Ct value for the four target genes was 32. A positive result was defined as a Ct value ≤ 32 for the presence of a target gene; otherwise, a negative result was defined as negative. The methylation test results of the above samples were used to determine the positive outcome, and the results are shown in Table 4. CIN3+ includes CIN3 and cervical cancer, and CIN2+ includes cervical cancer, CIN3, and CIN2.
[0079] Sample detection sensitivity (%) = (Number of positive cases detected / Total number of positive cases) × 100%; Sample detection specificity (%) = (Total number of negative detections / Total number of negative samples) × 100%; Table 4
[0080] As shown in Table 4, the reagent composition of the present invention has a sensitivity and specificity of 65.11% and 94.44% for detecting high-grade cervical lesions CIN2 and CIN3 and cervical cancer (CIN2+), respectively, and a sensitivity and specificity of 91.11% and 87.50% for detecting CIN3 and cervical cancer (CIN3+), respectively.
[0081] Therefore, when using the reagent composition of the present invention to detect known high-grade cervical lesions and cervical cancer samples, it exhibits good specificity and a low false diagnosis rate, verifying that it can be used as a new method for screening high-grade cervical lesions and cervical cancer.
[0082] Example 4 Following the method in Example 3, the clinical samples used in Example 3 were tested, and the test results of each clinical sample were analyzed. The difference was that the primers and probes used in the kit to detect the marker gene target sequences were replaced with primers and probes targeting the following target sequences (the target sequence and primer / probe for the internal standard remained unchanged). The specific primer and probe sequences are shown in Table 5, where "F" indicates the upstream primer, "R" indicates the downstream primer, and "P" indicates the probe. The analysis and calculation results for the clinical samples are shown in Table 6.
[0083] MDGA2 Replace the target sequence: TACGCAACGGGACCTTCAGGAGGCCGGCGGCCAGCCAGGCGCGCTCCACTCGCGCCCGGGCCAAGCCGAGGTGCCCGGGAACCGCTCGCCGAAGGAGGAAGCGCCGTCCGTCTGTCCTTCCCCGGCGGCGGCGGCGAGCGGAGCGCAGGAGCCCCGCACTCCACACACTCATGCACACACACACTCACACACACTCACACACTCTCCCACAACACAATACCCTGAC (SEQ ID NO: 21) ZNF773 Replacement target sequence: CGCGTCCTCCCGGCCTCCCCCGAATCCTAAAGCCCTGTGAGGGCCGCCTGCTCAGGTCCCCGGGTGCAGAACTGTGGGGCGTTCGTGGGCGGCGTCCCGTTTCTGACACGCAGTGTGATGGGGTGGCAATGGAGGGCAAGGG (SEQ ID NO: 22) CSDAP1 Replacement target sequence: GGGGGGTCAAATCCTTCACTGCTGCCGCTCCCTTCTTCCTCCTCCTCCCAGCGTAATCCCGGGGAGGGCCATGGCGCCTTCCATAGTAGCCACGTCTGTAACGGCGCCAATCAGCGCGTAACGACTGCCCTCCACAGGAACTCC (SEQ ID NO: 23) CLEC14A Replacement target sequence: CAAACTGGTACTTGCACAGGTAGCCGTTGGCGCGCAGGTGGCATCGCATCTCCTTCCAGCCTGCGGGCTCGACCCCACCGGTGGCCTGGAGTACCGCGCATCTCCGCGCGGTGCAGGAGCGTTGGGGCTCCTCCACCCACTGCAGCGTGTCGCTTTCGAGACCGCCGGGGTCGGAGGACAGCCAGGAGAAACCCCGC (SEQ ID NO: 24) Table 5
[0084] Table 6
[0085] As shown in Table 6, the sensitivity and specificity of other segment combinations for detecting high-grade cervical lesions CIN2 and CIN3 and cervical cancer (CIN2+) were 64.26% and 92.46%, respectively, while the sensitivity and specificity for detecting CIN3 and cervical cancer (CIN3+) were 89.63% and 86.08%, respectively. These combinations also exhibited high sensitivity and specificity.
[0086] Comparative Example 1 The clinical samples used in Example 3 were tested, and the testing and judgment methods were the same as in Example 3. The difference was that one of the target genes was replaced with... ASCL1 The diagnostic performance of combined detection of different target genes for cervical cancer was compared.
[0087] MDGA2 Gene, ZNF773 Gene, CLEC14A Gene, CSDAP1 The target sequences of the gene and the internal standard ACTB gene are shown in SEQ ID NO:1-4, and their primers and probes are detailed in Table 1. ASCL1 The target sequence of the gene (Genebank accession number: NC_000012.11) is shown in SEQ ID NO:37, and its primers and probes are shown in Table 7 below.
[0088] ASCL1 Target sequence: GCCCTCAGGGGGGCGGTCACAAGTCAGCGCCCAAGCAAGTCAAGCGACAGCGCTCGTCTTCGCCCGAACTGATGCGCTGCAAACGCCGGCTCAACTTCAGCGGCTTTGGCTACAGCCTGCCGCAGCAGCAGCCGGCCGCCGTGGCGCGCCGCAACGAGCGCGAGCGCAACCGCGTCAAGTTGGTCAACCTGGGCTT (SEQ ID NO: 37) Table 7
[0089] Note: CC- ASCL1 -P is modified with a fluorescent reporter group at the 5' end and a corresponding fluorescent quencher group at the 3' end. The specific modified group depends on the fluorescent reporter group modified on the probes of other genes being detected together (so that the fluorescent reporter group modified on this probe is detected in a different channel than the fluorescent reporter group modified on the probes of other genes).
[0090] The sensitivity and specificity of cervical exfoliated cell samples were calculated using the method described in Example 3, and the results are detailed in Table 8.
[0091] Table 8
[0092] As shown in Table 8, compared to combinations targeting the other four genes, the reagent combination provided by this invention exhibits the best detection sensitivity and specificity when using CIN2+ or CIN3+ as the outcome variable. Therefore, this invention ultimately determined that... MDGA2 , ZNF773 , CLEC14A and CSDAP1 This is a combined detection system. Specifically, among these combined detection systems, this combination has the lowest rate of missed diagnoses and false diagnoses when used for screening high-grade cervical lesions and cervical cancer, indicating that this gene combination testing method for cervical cancer screening is more suitable for widespread application in clinical and research work.
[0093] The research related to this invention was funded by the Hunan Provincial Science and Technology Innovation Program, project number 2024RC9025.
[0094] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.
Claims
1. A reagent composition for detecting cervical cancer and precancerous lesions, characterized in that, The reagent composition includes reagents for detecting the methylation level of cervical cancer marker genes or fragments thereof, wherein the marker genes include MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A Gene.
2. The reagent composition according to claim 1, wherein, The reagent composition includes reagents for detecting the methylation level of gene fragments with nucleotide sequences such as SEQ ID NO:1-4 or SEQ ID NO:21-24.
3. The reagent composition according to claim 1 or 2, wherein, The reagent composition also includes a reagent for detecting an internal standard; Preferably, the internal standard is selected from at least one of human housekeeping genes or fragments thereof; More preferably, the internal standard is ACTB The gene or a fragment thereof, preferably the nucleotide sequence of the internal standard as shown in SEQ ID NO:5; And / or, the reagent composition may further include a negative control reagent and / or a positive control reagent.
4. A reagent composition for detecting the methylation level of a marker gene, said marker gene comprising... MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A At least one of the genes, characterized in that, The reagent composition includes at least one of the following primers and optional probes: (1) Detection MDGA2 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:6-7, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:8; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:25-26, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:27; (2) Detection ZNF773 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:9-10, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:11; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:28-29, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:30; (3) Detection CSDAP1 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:12-13, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:14; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:31-32, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:33; (4) Detection CLEC14A Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:15-16, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:17; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:34-35, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:
36.
5. The reagent composition according to claim 4, wherein, The reagent composition also includes a reagent for detecting an internal standard; Preferably, the internal standard is selected from at least one of the human housekeeping gene or a fragment thereof, preferably... ACTB The gene or a fragment thereof, more preferably the nucleotide sequence of the internal standard as shown in SEQ ID NO:5; More preferably, the reagent for detecting the internal standard includes primers for detecting the internal standard and an optional probe, which includes: primer pairs with nucleotide sequences as shown in SEQ ID NO: 18-19, and optionally, probes with nucleotide sequences as shown in SEQ ID NO: 20; And / or, the reagent composition may further include a negative control reagent and / or a positive control reagent.
6. The reagent composition according to claim 4 or 5, wherein, The probe is modified with a fluorescent reporter group and / or a fluorescent quencher group.
7. A reagent kit for detecting cervical cancer and precancerous lesions, characterized in that, The kit comprises the reagent composition according to any one of claims 1-6.
8. The kit according to claim 7, wherein, The kit also includes at least one of the following: enzyme, buffer, magnesium source, and deoxyribonucleoside triphosphate; Preferably, the enzyme comprises a methylation-sensitive restriction endonuclease and / or a DNA polymerase, and more preferably, the methylation-sensitive restriction endonuclease comprises at least one of HpaII, HinP1I, and HhaI; Preferably, the magnesium source comprises a water-soluble inorganic magnesium salt; More preferably, the kit also includes reagents for nucleic acid extraction and / or purification.
9. The use of the reagent composition according to any one of claims 1-6, or the kit according to claim 7 or 8, in the preparation of a product for screening cervical cancer or precancerous lesions of the cervix.
10. Joint detection MDGA2 Gene, ZNF773 Gene, CSDAP1 Genes and CLEC14A Application of reagents for gene methylation levels in the preparation of products for screening cervical cancer or precancerous cervical lesions.