A product, method and use for mutation dna enrichment / detection

By designing primer sets for PCR reactions and combining hairpin competition reactions with Cas14a detection technology, the problem of detecting low-abundance mutant DNA in small solid tumors or minimal residual disease lesions has been solved, achieving highly sensitive enrichment and detection of mutant DNA.

CN122104918APending Publication Date: 2026-05-29WUXI PEOPLES HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610500356.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-15
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies are insufficient for highly sensitive detection of mutated DNA in small solid tumors or minimal residual disease (MRD), especially low-abundance mutated DNA. Traditional methods are cumbersome, costly, and lack sufficient sensitivity.

Method used

A primer set based on PCR reaction was designed to enrich mutant DNA through hairpin competition reaction, and combined with Cas14a detection technology to improve detection sensitivity and achieve the ability to detect low-abundance mutations of 0.002%.

Benefits of technology

It achieves ultrasensitive detection of mutated DNA, enables co-amplification of multiple mutation targets in single-tube PCR, improves multiplex detection capability, and is suitable for tumor mutation and methylation detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104918A_ABST
    Figure CN122104918A_ABST
Patent Text Reader

Abstract

The application provides a product, a method and an application for mutant DNA enrichment / detection, and belongs to the technical field of biological medicines.The application provides a primer group for enriching mutant DNA based on a PCR reaction, and realizes enrichment of mutant DNA based on the primer group.The mutant DNA enrichment method provided by the application realizes efficient enrichment of mutations through a hairpin competition reaction, and lays a foundation for high-sensitivity detection of mutations.The application further combines a CRISPR / Cas14a detection technology, provides a double-hairpin competition CRISPR / Cas14a system, realizes supersensitive detection of mutations, can realize co-amplification of multiple mutant targets, has the advantages of supersensitive detection and multi-target enrichment, and can be used for detection of small solid tumors or micro residual lesions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a product, method, and application for the enrichment / detection of mutant DNA. Background Technology

[0002] Effective detection of circulating tumor DNA (ctDNA) point mutations is crucial for targeted cancer therapy and postoperative monitoring. However, small solid tumors or minimal residual disease (MRD) release extremely low levels of mutant circulating tumor DNA (ctDNA), with a very high background proportion of wild-type template. For example, ctDNA accounts for only 0.002% to 0.03% of a 1 cubic centimeter tumor volume. Currently, although next-generation sequencing (NGS), electrochemical biosensors, and various polymerase chain reaction (PCR)-based technologies are in use, NGS, known for its high throughput, is widely used for variant detection. It can identify low-abundance mutations by increasing sequencing depth, but deep sequencing methods suffer from drawbacks such as cumbersome operation steps, long analysis time, and high cost. Furthermore, in addition to NGS, quantitative PCR (qPCR) and digital PCR are also key technologies for mutation detection; however, traditional qPCR lacks the sensitivity required to detect low-frequency variants, while digital PCR requires dedicated droplet generation and fluorescence reading equipment, leading to increased costs. In addition, the clustered regularly spaced short palindromic repeats / CRISPR-related protein (CRISPR / Cas) system is also an important molecular diagnostic technology platform. Cas proteins achieve target-specific recognition under the guidance of guide RNA (sgRNA) and exhibit high specificity and sensitivity through their trans-cleavage activity. Studies have shown that combining Cas14a technology with ligase chain reaction (LCR) or blocking substitution amplification (BDA) can identify BRAF V600E mutations at variant allele frequencies (VAF) of 0.5% and 0.1%; however, sensitivities of 0.5% and 0.1% are still insufficient to meet the high-sensitivity detection requirements for low-frequency mutations in circulating tumor DNA (ctDNA). Therefore, how to develop new mutation enrichment methods to achieve ultrasensitive detection of mutations for the detection of small solid tumors or minimal residual disease (MRD) remains one of the important problems that urgently need to be solved in this field. Summary of the Invention

[0003] To address the problems existing in the prior art, this invention provides products and methods for enriching / detecting mutant DNA, achieving ultrasensitive detection of mutant DNA, which can be used for the detection of small solid tumors or minimal residual disease (MRD).

[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a primer set for enriching mutant DNA based on PCR reaction. The primer set is designed according to the mutant DNA sites to be enriched and includes wild-type specific primers and competitive primers. The wild-type special primer is complementary to its own product chain, forming a hairpin structure; the wild-type special primer is obtained by connecting two sequence fragments: the first sequence fragment is a 3' end sequence fragment, which is complementary to both the wild-type template and the mutant template, and is 10-30 bases long; the second sequence fragment is a 5' end sequence fragment, which is a wild-type sequence fragment containing the mutant DNA site, and is 5-25 bases long. The competitive primers are 10-30 bases long, complementary to both wild-type and mutant templates, and complementary to the template sequence containing the hairpin structure; the competitive primers do not contain the mutant DNA sites that need to be enriched.

[0005] This invention provides the application of the primer set in any of the following: (1) Prepare reagents or kits for the enrichment of mutant DNA; (2) PCR reaction was used to enrich mutant DNA.

[0006] This invention provides a kit for enriching mutant DNA based on PCR reaction, comprising the above-mentioned primer set.

[0007] This invention provides a method for enriching mutant DNA based on PCR reaction, which uses the above-mentioned primer set or kit to perform PCR reaction and obtain PCR reaction products.

[0008] This invention provides the application of the above-described PCR-based method for enriching mutant DNA in the detection of mutant DNA.

[0009] This invention provides a method for real-time quantitative qPCR detection of mutant DNA. The method enriches mutant DNA using the above method, and fluorescent dyes or fluorescent probes are added to the PCR reaction system to perform real-time quantitative qPCR detection of mutant DNA.

[0010] This invention provides a method for detecting mutant DNA. The mutant DNA is enriched using the above method, and the obtained PCR products are subjected to Sanger sequencing, NGS sequencing, microarray hybridization analysis, or CRISPR / Cas detection analysis.

[0011] This invention provides a reaction system for detecting mutant DNA based on CRISPR / Cas14a, including the primer set or kit described above, and also including a Cas14a reaction system; the Cas14a reaction system includes Cas14a enzyme, sgRNA and reporter probe; the sgRNA is complementary to the mutant template, and the mutant template contains mutant DNA sites.

[0012] This invention provides a method for detecting mutant DNA using the above reaction system. The method involves performing a PCR reaction using the above primer set or kit to obtain PCR products, adding the PCR products to the Cas14a reaction system, incubating, and collecting fluorescence.

[0013] This invention provides the application of the above-mentioned primer set, kit, or reaction system in the preparation of reagents for detecting small solid tumors or minimal residual lesions.

[0014] Compared with the prior art, the beneficial effects of the technical solution of the present invention are as follows: This invention designs PCR primer sets based on mutated DNA and achieves efficient enrichment of mutations through hairpin competition reaction, laying the foundation for highly sensitive mutation detection. This invention combines Cas14a detection with ultrasensitive mutation detection technology, possessing the ability to detect low-abundance mutations (0.002%). Single-tube PCR can achieve co-amplification of multiple mutation targets, improving multiplex detection capabilities. This invention offers advantages such as ultrasensitive detection and multi-target enrichment, and can be used in the fields of tumor mutation detection and methylation detection. Attached Figure Description

[0015] Figure 1 The principle and detection results of constructing hairpin structures to achieve mutation amplification and enrichment.

[0016] Figure 2 The principle and detection results of the Cas14a mutation hypersensitive detection system based on dual-card competition.

[0017] Figure 3 : Results of plasma ctDNA detection using a multiplex detection system. Detailed Implementation

[0018] This invention provides a primer set for enriching mutant DNA based on PCR reaction. The primer set is designed according to the mutant DNA sites to be enriched and includes wild-type specific primers and competitive primers. The wild-type special primer is complementary to its own product chain, forming a hairpin structure; the wild-type special primer is obtained by connecting two sequence fragments: the first sequence fragment is a 3' end sequence fragment, which is complementary to both the wild-type template and the mutant template, and is 10-30 bases long; the second sequence fragment is a 5' end sequence fragment, which is a wild-type sequence fragment containing the mutant DNA site, and is 5-25 bases long. The competitive primers are 10-30 bases long, complementary to both the wild-type and mutant templates, and complementary to the template sequence containing the hairpin structure. The competitive primers do not contain the mutant DNA sites to be enriched. Preferably, the 5' end sequence fragment is complementary to both the wild-type and mutant templates, the 3' end sequence fragment is complementary to the template sequence containing the hairpin structure, and the 5' end sequence fragment of the wild-type special primer does not contain the mutant DNA site.

[0019] This invention constructs an artificial hairpin structure using PCR to initiate a competitive reaction with primers, achieving selective amplification and enrichment of mutant DNA. In the amplification reaction, the second sequence fragment of the wild-type specific primer is a prominent sequence. This prominent sequence is introduced into the amplicon and, when amplifying the wild-type template, it is complementary to its own product strand, folding and forming a stable hairpin structure. However, when amplifying the mutant template, a one-base mismatch exists between the wild-type prominent sequence and the mutant template, leading to an unstable hairpin structure. The stable hairpin structure formed in the wild-type template hinders the binding of the competitive primer to the template, thus inhibiting wild-type template amplification. The unstable hairpin structure in the mutant template allows the competitive primer to bind to and amplify the mutant template, thereby achieving the enrichment of mutant DNA.

[0020] The present invention provides the use of the primer set in any of the following: (1) preparing reagents or kits for enriching mutant DNA; (2) enriching mutant DNA using PCR reactions.

[0021] This invention provides a kit for enriching mutant DNA based on PCR reaction, comprising the primer set described above. As an optional embodiment, the kit of this invention further includes MgCl2, dNTPs, and a hot-start polymerase in the PCR amplification system.

[0022] This invention provides a method for enriching mutant DNA based on PCR reaction. The method involves using the primer set or kit described above to perform a PCR reaction and obtain the PCR product. In the PCR reaction system, the concentration of the wild-type specific primer is 0.01–3 μM, and the concentration of the competitive primer is 0.01–3 μM. As an optional embodiment, the reaction system of this invention is as follows: a reaction volume of 30 μL, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.03 U / μL hot-start polymerase, 0.2 μM upstream specific primer, 0.04 μM downstream competitive primer, and 10 μL template. The template in this invention includes sample DNA, cDNA obtained from reverse transcription, synthetic plasmid DNA, single-stranded DNA, or methylsulfite-converted template.

[0023] This invention provides the application of the above-described PCR-based method for enriching mutant DNA in the detection of mutant DNA.

[0024] This invention provides a method for real-time quantitative qPCR detection of mutant DNA. The method involves enriching mutant DNA using the aforementioned technique, and simultaneously adding a fluorescent dye or fluorescent probe to the PCR reaction system for real-time quantitative qPCR detection of the mutant DNA. As an optional embodiment, the concentration of the fluorescent probe in the reaction system of this invention is 0.1 μM.

[0025] This invention provides a method for detecting mutant DNA. The method enriches mutant DNA, and the resulting PCR products are then subjected to Sanger sequencing, NGS sequencing, microarray hybridization analysis, or CRISPR / Cas detection analysis. The PCR products described in this invention are single-stranded or double-stranded DNA products enriched with a large number of mutations. These PCR products can be subjected to Sanger sequencing, NGS sequencing, microarray hybridization analysis, and CRISPR / Cas detection analysis, thereby further amplifying the signal or obtaining other information, achieving highly sensitive or ultrasensitive detection of mutations.

[0026] This invention provides a reaction system for detecting mutant DNA based on CRISPR / Cas14a, including the primer set or kit described above, and also including a Cas14a reaction system; the Cas14a reaction system includes Cas14a enzyme, sgRNA and reporter probe; the sgRNA is complementary to the mutant template, and the mutant template contains mutant DNA sites.

[0027] The guide RNA (sgRNA) described in this invention is complementary to the mutant template but has a one-base mismatch with the wild-type template. The hairpin structure in the mutant template is unstable, offering less resistance to the binding of sgRNA and the mutant template, while the hairpin structure in the wild-type template is more stable, further hindering the non-specific binding of the mutant sgRNA and the wild-type template. Upon binding to the template, the sgRNA activates the trans-cleavage activity of the Cas14a enzyme, hydrolyzing the surrounding single-stranded DNA reporter probe.

[0028] The single-stranded DNA reporter probe of this invention is modified with fluorescent or quenching groups at both ends and is 15-40 bases in length. It can be a linear probe or a hairpin-structured reporter probe, and can be a TaqMan probe, a double-quenched probe, an MGB probe, or any reporter probe that releases fluorescence after hydrolysis or can be used in chromatographic test strips. The reporter probe of this invention is a synthetic single-stranded DNA or a modified DNA with altered hybridization affinity, including one or more of locked nucleic acids (LNA), peptide nucleic acids (PNA), or DNA minor groove binders (MGB).

[0029] This invention provides a method for detecting mutant DNA using the above-described reaction system. A PCR reaction is performed using the aforementioned primer set or kit to obtain PCR products. The PCR products are then added to a Cas14a reaction system, incubated, and fluorescence is collected. As an optional embodiment, in the Cas14a reaction system described in this invention, the concentration of Cas14a enzyme is 0.04 μM, the concentration of sgRNA is 0.04 μM, and the concentration of the reporter probe is 0.15 μM.

[0030] This invention provides the application of the above-mentioned primer set, kit, or reaction system in the preparation of reagents for detecting small solid tumors or minimal residual lesions.

[0031] The technical solutions of this invention will be clearly and completely described below with reference to the embodiments thereof. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0032] Unless otherwise specified, the following embodiments are all conventional methods.

[0033] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0034] Example 1 A hairpin structure was constructed to enrich and detect EGFR L858R mutations (one of the most common driver gene mutations in non-small cell lung cancer (NSCLC), an EGFR-sensitive mutation, and a classic target for targeted therapy). 1. Design of primer set for EGFR L858R mutation Designed based on the required enriched mutant DNA sites (wild-type gene template SEQ ID No. 1 and mutant gene template SEQ ID No. 2): The design principle of wild-type specific primers (upstream specific primers) is as follows: they are obtained by ligating two sequence fragments. The first sequence fragment is the 3' end sequence fragment, which is complementary to both the wild-type and mutant templates, and is 10-30 bases long. The second sequence fragment is the 5' end sequence fragment, which is the wild-type sequence fragment containing the mutant DNA site, and is 5-25 bases long. The wild-type specific primer is complementary to its own product strand, forming a hairpin structure. The wild-type specific primer designed for EGFR L858R is shown in SEQ ID No. 3: 5'-aaAGTTTGGCCAGCCCAAAAATGAACTACTTGGAGGACCG-3'.

[0035] The design principles for competitive primers (downstream competitive primers) are: 10-30 bases in length, complementary to both wild-type and mutant templates, and complementary to the template sequence containing the hairpin structure; competitive primers do not contain the mutant DNA sites to be enriched. A competitive primer designed for EGFR L858R is shown in SEQ ID No. 4: 5'-ACCCAGCAGTTTGGCC-3'.

[0036] The fluorescent probe is CY5-SEQ ID No. 5-BHQ; the sequence information of SEQ ID No. 5 is: 5'-CTGGCAGCCAGGAACGTACTGGT-3'.

[0037] 2. Enrichment of EGFR L858R mutant DNA: Reaction system: 30 μL reaction volume, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.03 U / μL hot-start polymerase, 0.2 μM upstream specific primer, 0.04 μM downstream competing primer, 0.1 μM fluorescent probe, and 10 μL template.

[0038] The mutant template is synthetic plasmid DNA (the mutant sequence SEQ ID No. 2 is inserted into the pUC-GW plasmid). Sma The wild-type template was genomic DNA from the 293T cell line, and simulated samples with different mutation frequencies (0%, 0.1%, 1%, 10%) were prepared according to the specified proportions. The specific PCR amplification procedure was as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing and extension at 58℃ for 20 s; and illumination, for 50 cycles. PCR amplification and signal acquisition were performed using the SLAN-96S system.

[0039] 3. The amplification product obtained in step 2 is amplified again, the product is extracted by gel cutting, and Sanger sequencing is performed.

[0040] The reaction volume was 30 μL, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.03 U / μL hot-start polymerase, 0.2 μM upstream specific primer, 0.2 μM downstream competing primer, and 5 μL template product. The specific PCR amplification program was as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing and extension at 58℃ for 20 s; 40 cycles. PCR amplification was performed using the SLAN-96S system. The nucleotide sequences of the upstream and downstream primers for amplifying the PCR product are shown in SEQ ID No. 6 and SEQ ID No. 4, respectively; the nucleotide sequence shown in SEQ ID No. 6 is: 5'-ATGAACTACTTGGAGGACCG-3'; the nucleotide sequences of the primers used for sequencing are shown in SEQ ID No. 6.

[0041] The principle and detection results of constructing hairpin structures to achieve mutation amplification and enrichment are as follows: Figure 1 As shown in the figure, (A) is a schematic diagram of the principle of mutation enrichment based on hairpin competition, (B) is the amplification curve of qPCR for detecting EGFR L858R, and (C) is the sequencing peak diagram obtained by amplifying the enriched product and performing Sanger sequencing. The results show that qPCR based on hairpin competition effectively detected 0.1% VAF mutant templates. Further product amplification and sequencing verified the mutation enrichment ability of the hairpin competition reaction; the 0.1% VAF mutant sample, after selective enrichment, could be sequenced by Sanger sequencing to obtain the peak diagram of the mutant bases.

[0042] Example 2 A gene mutation detection method is used to detect EGFR T790M (one of the most common driver gene mutations in non-small cell lung cancer (NSCLC), a sensitive EGFR mutation, and a key target after drug resistance) and EGFR L858R mutations, respectively. 1. Design of primer set for EGFR T790M mutation Designed based on the required enriched mutant DNA sites (wild-type gene template SEQ ID No. 7 and mutant gene template SEQ ID No. 8): The design principles for the wild-type specific primers (upstream specific primers) are the same as in Example 1. The wild-type specific primers designed for EGFR T790M are shown in SEQ ID No. 9: 5'-taTCATCACGCAGCAGGCAGCCGAAGGGCA-3'.

[0043] The design principles for the competitive primers (downstream competitive primers) are the same as in Example 1. The competitive primers designed for EGFR T790M are shown in SEQ ID No. 10: 5'-ACCGTGCAGCTCATCA-3'.

[0044] 2. Enrichment of EGFR T790M mutant DNA: Reaction system: 30 μL reaction volume, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.03 U / μL hot-start polymerase, 0.2 μM upstream specific primer, 1 μM downstream competing primer, and 10 μL template.

[0045] The mutant template is synthetic plasmid DNA (the mutant sequence SEQ ID No. 8 is inserted into the pUC-GW plasmid). SmaThe wild-type template was genomic DNA from the 293T cell line, and simulated samples with different mutation frequencies (0%, 0.002%, 0.005%, 0.05%, 0.50%, 5%, 50%) were prepared according to the specified proportions. The specific PCR amplification procedure was as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing and extension at 59℃ for 30 s; 55 cycles. PCR amplification was performed using the SLAN-96S system.

[0046] 3. Detection of EGFR T790M mutant DNA based on CRISPR / Cas14a: Add 3 μL of the amplification product from step 2 to the Cas14a reaction system: the Cas14a reaction volume is 20 μL, containing 0.04 μM Cas14a enzyme, 0.04 μM specific sgRNA, and 0.15 μM reporter probe. The reaction system was incubated and fluorescence was collected using a SLAN-96S system at a reaction temperature of 42 °C.

[0047] The nucleotide sequence of the reporting probe is FAM-SEQ ID NO.11-BHQ1, and the sequence of SEQ ID NO.11 is: 5'-CTCTCTTTTTTTTTTTTTTTTTTTTGAGAG-3'.

[0048] sgRNA sequence is SEQ ID NO.12: CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUC UUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACCAGCUCAUCAUGCAGCTCAU.

[0049] 4. Primer set for EGFR L858R mutation Designed based on the required enriched mutant DNA sites (wild-type gene template SEQ ID No. 1 and mutant gene template SEQ ID No. 2): The design principles for the wild-type specific primers (upstream specific primers) are the same as in Example 1. The wild-type specific primers designed for EGFR L858R are shown in SEQ ID No. 13: 5'-taTTTGGCCAGCCCAAGCAGCATGTCAAGATCACA-3'.

[0050] The design principles for the competitive primers (downstream competitive primers) are the same as in Example 1. The competitive primers designed for EGFR L858R are shown in SEQ ID No. 4.

[0051] 5. Enrichment of EGFR L858R mutant DNA: Reaction system: 30 μL reaction volume, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.03 U / μL hot-start polymerase, 0.3 μM upstream specific primer, 0.04 μM downstream competing primer, and 10 μL template.

[0052] The mutant template is synthetic plasmid DNA (the mutant sequence SEQ ID No. 2 is inserted into the pUC-GW plasmid). Sma The wild-type template was genomic DNA from the 293T cell line, and simulated samples with different mutation frequencies (0%, 0.002%, 0.005%, 0.05%, 0.50%, 5%, 50%) were prepared according to the specified proportions. The specific PCR amplification procedure was as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing and extension at 59℃ for 30 s; 55 cycles. PCR amplification was performed using the SLAN-96S system.

[0053] 6. Detection of EGFR L858R mutant DNA based on CRISPR / Cas14a: Add 3 μL of the amplification product from step 5 to the Cas14a reaction system: the Cas14a reaction volume is 20 μL, containing 0.04 μM Cas14a enzyme, 0.04 μM specific sgRNA, and 0.15 μM reporter probe. The reaction system was incubated and fluorescence was collected using a SLAN-96S system at a reaction temperature of 42 °C.

[0054] The nucleotide sequence of the reporting probe is FAM-SEQ ID NO.11-BHQ1. The sgRNA sequence is SEQ ID NO.14: CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAAC AGUUUGGCCCGCCCAAAAUC.

[0055] The principle and detection results of the Cas14a mutation hypersensitive detection system based on dual-sponge competition are as follows: Figure 2 As shown in the figure, (A) is the Cas14a mutation hypersensitive detection principle based on dual hairpin competition, (B) is the fluorescence curve for detecting EGFR L858R, and (C) is the fluorescence curve for detecting EGFR T790M. The results show that the mutation recognition ability is greatly improved through a two-step hairpin competition reaction, achieving a detection sensitivity of 0.002% VAF for both mutations (EGFR T790M and EGFR L858R).

[0056] Example 3 A gene mutation detection method, a four-way reaction system, simultaneously detects the internal control target (ACTB), as well as the targets EGFR L858R, EGFR G719A, and NRAS Q61K: 1. Design of primer set for EGFR L858R mutation Designed based on the required enriched mutant DNA sites (wild-type gene template SEQ ID No. 1 and mutant gene template SEQ ID No. 2): The design principles for the wild-type specific primers (upstream specific primers) are the same as in Example 1. The wild-type specific primers designed for EGFR L858R are shown in SEQ ID NO.15: 5'-taTTTGGCCAGCCCAAAGCAGCATGTCAAGATCACA-3'.

[0057] The design principles for the competitive primers (downstream competitive primers) are the same as in Example 1. The competitive primers designed for EGFR L858R are shown in SEQ ID No. 4.

[0058] 2. Design of primer sets for EGFR G719A mutation Design the wild-type specific primers (upstream specific primers) based on the required enriched mutant DNA sites (wild-type gene template SEQ ID NO. 16 and mutant gene template SEQ ID NO. 17): The design principle for wild-type specific primers (upstream specific primers) is the same as in Example 1. The wild-type specific primers designed for EGFR G719A are shown in SEQ ID NO. 18: 5'-atCCGGAGCCCAGCTTGAGGATCTTGAAGGAAACT-3'.

[0059] The design principles for the competitive primers (downstream competitive primers) are the same as in Example 1. The competitive primers designed for EGFR G719A are shown in SEQ ID NO.19: 5'-CCGAACGCACCGGAG-3'.

[0060] 3. Design primer set for NRAS Q61K mutation Designed according to the required enriched mutant DNA sites (wild-type gene template SEQ ID No. 20 and mutant gene template SEQ ID No. 21): The design principle of wild-type special primers (upstream special primers) is the same as in Example 1. The wild-type special primers designed for NRAS Q61K are shown in SEQ ID NO. 22: 5'-atCTCTTCTTGTCCAGCTAACCTGTTTGTTGGACATAC-3'.

[0061] The design principles for the competitive primers (downstream competitive primers) are the same as in Example 1. The competitive primers designed for NRAS Q61K are shown in SEQ ID NO.23: 5'-ATGGCACTGTACTCTTCTT-3'.

[0062] 4. Primer set for ACTB (internal reference gene) The nucleotide sequences of the upstream and downstream primers are SEQ ID NO.24: 5'-AGGCATCCTCACCCTGAAG-3'; SEQ ID NO.25: 5'-CATTGTAGAAGGTGTGGTGCC-3'.

[0063] 5. Multiplex PCR amplification The reaction volume was 30 μL, containing 3.5 mM MgCl2, 0.2 mM dNTPs, and 0.05 U / μL hot-start polymerase. The specific upstream primer for EGFR L858R was 0.35 μM, and the competing downstream primer was 0.15 μM; the specific upstream primer for EGFR G719A was 0.25 μM, and the competing downstream primer was 0.05 μM; the specific upstream primer for NRAS Q61K was 0.25 μM, and the competing downstream primer was 0.1 μM; the upstream primer for ACTB was 0.1 μM, and the downstream primer was 0.06 μM. The specific program was: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing and extension at 59℃ for 30 s; 55 cycles. PCR amplification was performed using the SLAN-96S system. The template was a simulated sample containing different mutation frequencies or a plasma ctDNA sample.

[0064] Each simulated sample contained only one mutation, for a total of three groups. The first group consisted of samples with the EGFR L858R mutation, with mutation frequencies of 0%, 0.005%, 0.05%, 0.50%, 5%, and 50%, respectively. The second group consisted of samples with the EGFR G719A mutation, with mutation frequencies of 0%, 0.005%, 0.05%, 0.50%, 5%, and 50%, respectively. Samples with the NRAS Q61K mutation had mutation frequencies of 0%, 0.01%, 0.05%, 0.50%, 5%, and 50%, respectively. Plasma ctDNA samples were also analyzed using digital PCR for comparison.

[0065] Multiplex PCR products were added to Cas14a reaction tubes containing different sgRNAs: 3 μL of amplified product was added to the Cas14a reaction system. The Cas14a reaction volume was 20 μL, containing 0.04 μM Cas14a enzyme, 0.04 μM specific sgRNA, and 0.15 μM reporter probe.

[0066] The EGFR L858R sgRNA sequence is SEQ ID NO.13.

[0067] EGFR G719A sgRNA sequence is SEQ ID NO.26: CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAAC CACCGGAGGCCAGCACU; NRAS Q61K sgRNA sequence is SEQ ID NO.27: CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCU UCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACGUACUCUUCUUUUCCAGCUGU.

[0068] The ACTB detection system contains 0.08 μM Cas14a enzyme and 0.08 M specific sgRNA. The ACTB sgRNA sequence is SEQ ID NO.28: CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACGUCCCAGUUGGUGACGA. The system was incubated with SLAN-96S and fluorescence was collected at a reaction temperature of 42℃.

[0069] The nucleotide sequence of the reported probe is FAM-SEQ ID NO.11-BHQ1.

[0070] Multiplex detection system for plasma ctDNA detection results Figure 3 As shown in the figure, (A) a multiplex detection system that enables single-tube co-amplification and separate Cas14a detection of different mutation targets; (B) evaluation of the detection sensitivity of the multiplex system; (C) application of the Cas14a method to clinical plasma ctDNA sample detection; (D) fluorescence values ​​of different targets, where 1-22 represent 22 plasma ctDNA samples, MT-1 represents a simulated sample containing the EGFR L858R mutation (mutation frequency 0.5%), MT-2 represents a simulated sample containing the EGFR G719A mutation (mutation frequency 0.5%), MT-3 represents a simulated sample containing the NRAS Q61K mutation (mutation frequency 0.5%), and WT represents the wild-type template; (E) comparison of results from the two methods. The results show that the multiplex reaction system can achieve detection sensitivities of 0.005% or 0.01% for different mutations. In the detection of plasma ctDNA samples, 4 EGFR L858R mutation-positive samples were detected out of 22 samples, and complete consistency was obtained by digital PCR, indicating that the method of the present invention has the ability to be applied to plasma samples and achieve effective detection of low abundance mutations.

[0071] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer set for enriching mutant DNA based on PCR reaction, characterized in that, The primer set is designed according to the mutant DNA sites to be enriched, including wild-type specific primers and competitive primers; The wild-type special primers and their own product chains are complementary, forming a hairpin structure; The wild-type specific primer is obtained by connecting two sequence fragments: the first sequence fragment is a 3' end sequence fragment, which is complementary to both the wild-type and mutant templates, and is 10-30 bases long; the second sequence fragment is a 5' end sequence fragment, which is a wild-type sequence fragment containing the mutant DNA site, and is 5-25 bases long. The competitive primers are 10-30 bases long, complementary to both wild-type and mutant templates, and complementary to the template sequence containing the hairpin structure; the competitive primers do not contain the mutant DNA sites that need to be enriched.

2. The use of the primer set according to claim 1 in any of the following: (1) Prepare reagents or kits for the enrichment of mutant DNA; (2) PCR reaction was used to enrich mutant DNA.

3. A kit for enriching mutant DNA based on PCR reaction, characterized in that, Includes the primer set as described in claim 1.

4. A method for enriching mutant DNA based on PCR reaction, characterized in that, PCR reaction was performed using the primer set described in claim 1 or the kit described in claim 3 to obtain PCR reaction products.

5. The application of the PCR-based method for enriching mutant DNA as described in claim 4 in the detection of mutant DNA.

6. A method for detecting mutant DNA using real-time quantitative qPCR, characterized in that, The mutant DNA was enriched using the method described in claim 4, and a fluorescent dye or fluorescent probe was added to the PCR reaction system to perform real-time quantitative qPCR detection of the mutant DNA.

7. A method for detecting mutant DNA, characterized in that, The mutant DNA was enriched using the method described in claim 4, and the resulting PCR products were subjected to Sanger sequencing, NGS sequencing, microarray hybridization analysis, or CRISPR / Cas detection analysis.

8. A reaction system for detecting mutant DNA based on CRISPR / Cas14a, characterized in that, The kit includes the primer set of claim 1 or the kit of claim 3, and further includes a Cas14a reaction system; the Cas14a reaction system includes the Cas14a enzyme, sgRNA and a reporter probe; the sgRNA is complementary to a mutant template, and the mutant template contains a mutant DNA site.

9. A method for detecting mutant DNA using the reaction system of claim 8, characterized in that, PCR reaction was performed using the primer set described in claim 1 or the kit described in claim 3 to obtain PCR reaction products. The PCR reaction products were added to the Cas14a reaction system, incubated, and fluorescence was collected.

10. The use of the primer set of claim 1, the kit of claim 3, or the reaction system of claim 8 in the preparation of a reagent for detecting small solid tumors or minimal residual lesions.