Targeted sequencing primer sets and kits for detecting a variety of pathogenic microorganisms in murine species

By designing targeted sequencing primer sets and kits, and combining multiplex PCR and high-throughput sequencing, the problems of low detection throughput and insufficient sensitivity in existing technologies have been solved, achieving efficient, economical, and sensitive detection of common rodent pathogens, and making it suitable for rapid detection of a variety of rodent pathogens.

CN122104969APending Publication Date: 2026-05-29TECH CENT OF GUANGZHOU CUSTOMS

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TECH CENT OF GUANGZHOU CUSTOMS
Filing Date
2026-04-27
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies for detecting pathogenic microorganisms carried by rodents suffer from low throughput of real-time quantitative PCR, low sensitivity of metagenomic sequencing, and susceptibility to high levels of host nucleic acid, making it difficult to comprehensively and accurately detect a variety of common rodent pathogens.

Method used

We designed targeted sequencing primer sets and kits, combined multiplex PCR amplification with high-throughput sequencing, designed primers for pathogen-specific genes, and carried out targeted sequencing library construction and data analysis to achieve high-throughput, low-cost pathogen detection.

Benefits of technology

It achieves efficient, sensitive, and economical detection of 50 common rodent pathogens, with broad coverage, accurate pathogen identification, reduced influence of host nucleic acid, and rapid output of test results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104969A_ABST
    Figure CN122104969A_ABST
Patent Text Reader

Abstract

The application discloses a kind of target sequencing primer set and kit for detecting multiple rodent carrying pathogenic microorganisms.The nucleotide sequence of the primer set is shown as SEQ ID NO:1-400.The kit comprises the primer set shown as SEQ ID NO:1-400.The application can simultaneously detect 50 kinds of rodent carrying pathogenic microorganisms, with the advantages of high detection throughput, clear pathogen spectrum range, low sequencing cost, high sensitivity, and no influence of host nucleic acid, etc.The target sequencing primer set and kit are developed for common pathogen spectrum carried by rodents, which can effectively make up for the shortcomings of prior art, expand the detection range, improve the detection sensitivity, and provide key technical support for early warning, prevention and control of plague, hemorrhagic fever with renal syndrome, fever with thrombocytopenia syndrome and other rodent-borne diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection and high-throughput sequencing technology, specifically to targeted sequencing primer sets and kits for detecting various rodent pathogens. Background Technology

[0002] Rodents are important hosts for zoonotic pathogens, possessing a rich diversity and carrying a wide range of pathogens. They serve as natural reservoirs of pathogens in natural foci, and zoonotic diseases caused by rodents account for a large proportion of infectious diseases. Currently, over 100 pathogens have been confirmed to be able to carry and transmit these pathogens, of which approximately 56 can cause common, emerging, and re-emerging infectious diseases in humans. Plague caused by Yersinia pestis is a Class A infectious disease, while hemorrhagic fever with renal syndrome and leptospirosis caused by hantavirus and pathogenic leptospirosis, respectively, are Class B infectious diseases, all requiring close monitoring. The novel Bunyavirus is a newly discovered RNA virus with a low morbidity rate but a high mortality rate. Bartonella can cause Bartoninosis in humans and is prevalent in rodents. In addition, rodents can carry worms (such as Schistosoma japonicum, Angiostrongylus cantonensis, Capillaria hepatica, etc.) and protozoa (Toxoplasma gondii, Giardia lamblia, Cryptosporidium, etc.) that cause zoonotic diseases. In the transmission of zoonotic parasitic diseases, they can act as transmission vectors, as reservoir hosts to directly transmit pathogens, or indirectly transmit pathogens to humans through ectoparasites.

[0003] Currently, the primary method used in laboratories to detect pathogenic microorganisms carried by rodents is real-time quantitative polymerase chain reaction (qPCR). However, it has limitations such as not providing pathogen gene sequences and low throughput. Metagenomic next-generation sequencing (mNGS) offers higher throughput and is one of the most widely used detection technologies in laboratories, but it also suffers from limitations related to the high proportion of host nucleic acids and low detection sensitivity.

[0004] Targeted NGS (tNGS) combines ultramultiplex PCR amplification with high-throughput sequencing. Primers are designed to target pre-defined targets (such as pathogen-specific genes), and ultramultiplex PCR is used to selectively amplify the target gene to obtain a targeted sequencing library. Sequencing and data analysis are then performed to detect pathogenic microorganisms in a sample. Targeted sequencing requires less data, has significantly lower sequencing costs than metagenomics, eliminates the need for complex assembly, simplifies the analysis process, and offers high economic efficiency and timeliness. Therefore, this technology has advantages such as high detection throughput, a well-defined pathogen spectrum, low sequencing cost, high sensitivity, and independence from host nucleic acid influence.

[0005] Currently, there is an increasing number of products using tNGS as the technology route for pathogen detection, often detecting dozens or more pathogens. However, targeted sequencing kits specifically for common pathogenic microorganisms carried by rodents are rare. This invention aims to provide a targeted sequencing primer set and kit for detecting multiple common pathogenic microorganisms carried by rodents, overcoming the problems of existing detection technologies. For example, polymerase chain reaction (PCR) and real-time quantitative polymerase chain reaction (qPCR) suffer from issues such as not providing pathogen gene sequences and low throughput. MetamNGS detection of pathogenic microorganisms is affected by the high proportion of host nucleic acids and has low detection sensitivity. Summary of the Invention

[0006] To address the aforementioned technical issues, this invention designs targeted sequencing primer sets and kits based on common pathogens carried by rodents, providing technical support for gene detection services of rodent-borne pathogens.

[0007] The first objective of this invention is to provide a set of targeted sequencing primers for detecting various rodent pathogens, the nucleotide sequences of which are shown in SEQ ID NO:1 to SEQ ID NO:400.

[0008] Preferably, the pathogens include: Bacillus anthracis, Yersinia pestis, Tula Francisella, Borrelia burgdorferi, Borrelia dutoni, Bartonella spp., Bartonella henri, Bartonella elizabeth, Coxiella benazepis, Ehrlich mikul, Leptospira, Leptospira bovis, Leptospira savantis, Leptospira velutipes, Leptospira question mark, Anaplasma phagocytophilia, Yersinia enterocolitica, Yersinia pseudotuberculosis, Salmonella spp., Shigella spp., Orientia scrub typhus, Klebsiella pneumoniae, Rickettsia prowleri, and Rickettsia typhus. Rickettsia, Ehrlich. chafie, spotted fever group Rickettsia, Australian Rickettsia, Rickettsia leucis, Rickettsia konjac, Rickettsia spp., Bocavirus, Hantavirus, Seoul virus, Puma virus, Dobrava virus, Novel Bunyavirus, Crimean-Congo hemorrhagic fever virus, Lassa virus, tick-borne encephalitis virus, Cryptosporidium, Cryptosporidium microsporidium, Babesia, Babesia microsporidium, Babesia dibuds, Hymenolepis shortis, Fasciola hepatica, Trypanosoma gambiae, Angiostrongylus cantonensis, Leishmania, Schistosoma japonicum.

[0009] A second objective of this invention is to provide a kit for detecting various rodent-borne pathogens, comprising the aforementioned primer set.

[0010] Preferably, the kit further includes multiplex PCR reagents, primers containing specific index sequences and universal adapter sequences, and PCR product purification reagents.

[0011] A third objective of this invention is to provide the application of the above-described primer set or kit in the preparation of rodent pathogen detection products.

[0012] Preferably, the pathogens include: Bacillus anthracis, Yersinia pestis, Tula Francisella, Borrelia burgdorferi, Borrelia dutoni, Bartonella spp., Bartonella henri, Bartonella elizabeth, Coxiella benazepis, Ehrlich mikul, Leptospira, Leptospira bovis, Leptospira savantis, Leptospira velutipes, Leptospira question mark, Anaplasma phagocytophilia, Yersinia enterocolitica, Yersinia pseudotuberculosis, Salmonella spp., Shigella spp., Orientia scrub typhus, Klebsiella pneumoniae, Rickettsia prowleri, and Rickettsia typhus. Rickettsia, Ehrlich. chafie, spotted fever group Rickettsia, Australian Rickettsia, Rickettsia leucis, Rickettsia konjac, Rickettsia spp., Bocavirus, Hantavirus, Seoul virus, Puma virus, Dobrava virus, Novel Bunyavirus, Crimean-Congo hemorrhagic fever virus, Lassa virus, tick-borne encephalitis virus, Cryptosporidium, Cryptosporidium microsporidium, Babesia, Babesia microsporidium, Babesia dibuds, Hymenolepis shortis, Fasciola hepatica, Trypanosoma gambiae, Angiostrongylus cantonensis, Leishmania, Schistosoma japonicum.

[0013] A fourth objective of this invention is to provide a method for detecting various rodent-borne pathogens for non-disease diagnostic and therapeutic purposes, comprising the following steps: 1) Using the nucleic acid of the sample to be tested as a template, perform the first round of multiplex PCR amplification using the primer set or the kit described above. Purify the amplification product to obtain the purified PCR product. Add primers containing the sample-specific index sequence and the universal sequencing adapter sequence to perform the second round of PCR amplification. 2) After purifying and quality-checking the second round of PCR amplification products, qualified libraries were obtained, and then high-throughput sequencing was performed on the qualified libraries; based on the sequencing and bioinformatics comparison results, the types of pathogens in the rodent samples were determined.

[0014] Preferably, the qualified library standard is a library concentration > 1 ng / μL; during sequencing, the fragment size of the library is 250-350 bp.

[0015] Preferably, the reaction system for the first round of multiplex PCR is as follows: 5 μL primer set, 10 μL 3×T Enzyme Mix, 5 μL template cDNA, and 10 μL template DNA or total nucleic acid; the reaction program is: 95℃ for 3 min; 95℃ for 20 s, 63℃ for 2 min, 72℃ for 2 min, for 23 cycles; 72℃ for 5 min; and stored at 10℃. The reaction system for the second round of PCR is as follows: 18 μL of the first round of multiplex PCR product, 2 μL primers containing Illumina Index PCR, and 10 μL 3×T PCR Mix; the reaction program is: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 30 s, 72℃ for 30 s, for 8 cycles; 72℃ for 5 min; and stored at 10℃.

[0016] This invention provides a primer set consisting of 200 pairs of specific primers, with at least two pairs of specific primers for each pathogen, covering 50 common rodent-borne pathogens: Yersinia pestis, Bacillus anthracis, Tula Francisella, Borrelia burgdorferi, Borrelia dutoni, Bartonella spp., Bartonella henri, Bartonella elizabeth, Benacoxiella, Ehrlich aspergillus miculosus, Leptospira, Leptospira bovis, Leptospira savantis, Leptospira velutipes, Leptospira brevis, Leptospira question mark, Anaplasma phagocytophilia, Yersinia enterocolitica, Yersinia pseudotuberculosis, Salmonella spp., Shigella spp., and Tsutsumzu moschata. *Rhizoctonia solani*, *Klebsiella pneumoniae*, *Rickettsia prowleri*, *Rickettsia typhus*, *Erhizoctonia chafie*, *Rickettsia spectabilis*, *Rickettsia australis*, *Rickettsia rickettsia*, *Rickettsia konjac*, *Rickettsia spp.*, Hantavirus, Seoul virus, Puma virus, Dobrava virus, novel Bunyavirus, Crimean-Congo hemorrhagic fever virus, Lassa virus, tick-borne encephalitis virus, Bocavirus, *Cryptosporidium*, *Cryptosporidium microsporidium*, *Babesia*, *Babesia microsporidium*, *Babesia dibuds*, *Hymenolepis shortissima*, *Fasciola hepatica*, *Treatisena gambiae*, *Angiostrongylus cantonensis*, *Leishmania*, *Schistosoma japonicum*. Primer sequences for each pair are shown in Table 1.

[0017] The kit of this invention includes reverse transcription reagent, primer set, multiplex PCR reagent, tag, and purification reagent.

[0018] The kit for detecting common pathogens in rodents provided by this invention was used for reverse transcription and amplification; the amplification products were purified; the library underwent quality control, and the qualified libraries were mixed and sequenced; based on the sequencing results, common pathogens in rodent samples were identified.

[0019] The quality control standard for qualified libraries is a library concentration > 1 ng / μL. During the sequencing of mixed libraries, the fragment size is approximately 300 bp.

[0020] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: This invention discloses a primer set and kit for detecting common pathogens carried by rodents, employing targeted sequencing to detect these pathogens. This invention targets the detection of rodent-borne pathogens, covering 1 Gram-positive bacterium, 29 Gram-negative bacteria, 1 DNA virus, 8 RNA viruses, and 11 parasites, encompassing common rodent-borne pathogens and enabling comprehensive and accurate detection of target pathogens. This invention utilizes 200 pairs of specific primers to achieve multiplex targeted amplification of pathogen target regions and employs a high-performance sequencing platform for precise pathogen identification, improving detection efficiency. This kit covers a wide range of pathogens, enabling the detection of over 50 pathogens in a single test. Library preparation, sequencing, and data analysis can be completed within 15 hours, and with the aid of a data analysis system, test results can be automatically output.

[0021] This invention designs targeted sequencing primer sets based on the characteristics of common rodent pathogens and develops a kit for detecting these pathogens. The kit can simultaneously detect 50 common rodent pathogens, providing crucial technical support for early warning and control of rodent-borne diseases. The primer set and kit provided by this invention solve the technical problems of limited pathogen diversity in conventional rodent pathogen detection, low sensitivity in metagenomic detection, and significant influence from host genes. It offers advantages such as high efficiency, high sensitivity, speed, and cost-effectiveness, making it highly valuable for detecting rodent pathogens.

[0022] In summary, this invention provides a targeted sequencing primer set and kit for detecting multiple common rodent pathogens, capable of simultaneously detecting 50 rodent-borne pathogens. It offers advantages such as high throughput, a well-defined pathogen spectrum, low sequencing cost, high sensitivity, and independence from host nucleic acid interference. Developing targeted sequencing primer sets and kits for common rodent pathogens effectively overcomes the shortcomings of existing technologies, expands the detection range, and improves detection sensitivity, providing crucial technical support for the early warning and prevention of rodent-borne diseases such as plague, hemorrhagic fever with renal syndrome, and fever with thrombocytopenia syndrome. Attached Figure Description

[0023] Figure 1 This is a flowchart of the reagent kit's detection process. Detailed Implementation

[0024] The technical solution of the present invention will be described below with reference to the embodiments, but the present invention is not limited to the following embodiments.

[0025] The usage procedure of the targeted sequencing primer set and kit for detecting common pathogens carried by rodents provided by this invention is as follows: When used to detect common pathogens carried by rodents, such as Figure 1 The steps shown are as follows: (1) Nucleic acid extraction from samples: extract nucleic acid RNA / DNA or total nucleic acid from rodent samples; reverse transcribe the RNA in the extracted nucleic acid using a reverse transcription reagent; (2) Multiplex targeted amplification of the target gene: Using the total nucleic acid and reverse transcription product cDNA extracted in step (1) as templates, the first round of PCR amplification was performed using primers for targeted sequencing detection of 50 pathogens (Table 1); (3) Purification of the first round of PCR products: Purify the first round of PCR products obtained in step (2) to obtain the first round of purified PCR products; (4) Second round of PCR amplification: Add primers containing sample-specific index sequences and universal sequencing adapter sequences to the PCR purified product obtained in step (3) for a second round of PCR amplification; (5) Second round of PCR product purification: The product obtained in step (4) is purified, and the resulting product is the library, a mixed library; (6) Library sequencing; (7) Data analysis: Sequencing data is split according to adapters, and the split data is imported into the matching data analysis system for analysis and report generation.

[0026] The multiplex PCR targeting primer set provided by this invention contains 50 pathogen-specific primers, the sequence information of which is shown in Table 1. The 50 pathogens include 1 Gram-positive bacterium, 29 Gram-negative bacteria, 1 DNA virus, 8 RNA viruses, and 11 parasites. The specific pathogens involved are as follows: One type of Gram-positive bacterium: Bacillus anthracis; 29 Gram-negative bacteria: Yersinia pestis, Tula Francisella, Borrelia burgdorferi, Borrelia dutoni, Bartonella spp., Bartonella henri, Bartonella elizabeth, Benacoxella, Ehrlich aspergillus miculae, Leptospira, Leptospira bovis, Leptospira savantis, Leptospira velutipes, Leptospira velutipes, Leptospira leptospira, Anaplasma phagocytophilia, Yersinia enterocolitica, Yersinia pseudotuberculosis, Salmonella spp., Shigella spp., Orientia scrub typhus, Klebsiella pneumoniae, Rickettsia prowleri, Rickettsia typhus, Ehrlich aspergillus chaffeensis, Rickettsia spectabilis, Rickettsia australis, Rickettsia rickettsiae, Rickettsia kossini, Rickettsia arachnoidea; One type of DNA virus: Bocavirus; Eight RNA viruses: Hantavirus, Seoul virus, Puma virus, Dobrava virus, novel Bunyavirus, Crimean-Congo hemorrhagic fever virus, Lassa virus, tick-borne encephalitis virus; Eleven parasites: Cryptosporidium, Cryptosporidium microsporidium, Babesia, Babesia microsporidium, Babesia dibuds, Hymenolepis shortissimus, Fasciola hepatica, Trypanosoma gambiae, Angiostrongylus cantonensis, Leishmania, and Schistosoma japonicum.

[0027] Example 1: Primer Design This invention designs primers for targeted sequencing detection of 50 common pathogens carried by rodents (see Table 1 for details).

[0028] Example 2: Construction and testing of recombinant plasmids 1. Construction of recombinant plasmids The target gene sequences (Table 2) for constructing recombinant plasmids were provided to Sangon Biotech (Shanghai) Co., Ltd., which artificially synthesized sequence fragments containing each target gene using gene synthesis methods. Then, each target gene sequence was cloned into the puc57 plasmid (Shanghai Sangon: B522201-0100), retaining the tNGS primer binding sequences at both ends of the inserted sequences. To obtain more plasmids, the plasmids were transformed into engineered bacteria (E. coli competent cells) for cloning and extraction.

[0029] 2. Recombinant plasmid amplification

[0030] Each of the above recombinant plasmids containing the synthesized sequence was diluted to 1 ng / μL. To scale up the amount of recombinant plasmids, a 30 μL PCR system was constructed for each recombinant plasmid as follows: 1 μL of recombinant plasmid, 1 μL each of the universal amplification primers M13-F / R for the puc57 plasmid vector, 10 μL of 3×T PCR mix, and ddH2O to a final volume of 30 μL. PCR program: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 30 s, 72℃ for 15 s, 30 cycles; 72℃ for 3 min, stored at 4℃.

[0031] 3. Purification of PCR products The specific steps for magnetic bead purification are as follows: 1) Add ultrapure water to the PCR product obtained in step 2 to a final volume of 100 μL, vortex or invert thoroughly to ensure homogeneity. 2) Add 80 μL of magnetic beads to the DNA solution from step 1), vortex or pipette 10 times to mix. 3) Incubate at room temperature for 5 min. 4) Briefly centrifuge the centrifuge tube and place it on a magnetic rack. After the solution becomes clear (approximately 5 min), carefully remove the supernatant. 5) Keeping the centrifuge tube on the magnetic rack, add 200 μL of freshly prepared 80% ethanol (v / v) to rinse the magnetic beads, incubate at room temperature for 30 s, and carefully remove the supernatant. 6) Repeat step 5). 7) Keeping the centrifuge tube on the magnetic rack, open the cap to dry the magnetic beads. 8) Remove the centrifuge tube from the magnetic rack, add 30 μL of ddH2O (≥20 μL), vortex or pipette gently to mix thoroughly, and incubate at room temperature for 5 min. 9) Briefly centrifuge the centrifuge tube and place it on a magnetic rack to separate the magnetic beads and liquid. After the solution becomes clear (about 5 minutes), carefully aspirate the supernatant into a clean tube to complete the purification.

[0032] 4. Quantification of PCR products The purified products of each reaction in step 3 were quantified using a Qubit instrument, measured three times, and the average value was taken.

[0033] 5. Mixing PCR products

[0034] The purified PCR product obtained in step 4 above was diluted to 10,000 copies / μL according to its DNA concentration and molecular weight. The same volume of each homogenized PCR product was mixed together to form a product mixture, which was used as the template for amplification in step 6.

[0035] 6. Multiplex PCR amplification of the target gene PCR system: The copy number of each target gene in each reaction was 2000 copies / reaction, 200 copies / reaction, 100 copies / reaction, and 20 copies / reaction. The dilution and system preparation were as follows (1 μL template was added to each reaction). Primer set (Table 1) 4 μL, 3×T Enzyme Mix (Hebei Bingyuan Shengkang Medical Technology Co., Ltd.) 10 μL, ddH2O added to 30 μL; The reaction program was: 95℃ for 3 min; 95℃ for 20 s, 63℃ for 2 min, 72℃ for 2 min, 23 cycles; 72℃ for 5 min; Store at 10℃.

[0036] 7. Magnetic bead sorting and recycling

[0037] The specific procedure for magnetic bead sorting is as follows: 1) Add ultrapure water to each of the PCR products obtained in step 6 to a final volume of 100 μL. Vortex or thoroughly invert the magnetic beads to ensure homogeneity. 2) Add 50 μL of the first round of sorting magnetic beads to the DNA solution from step 1). Vortex or pipette 10 times to mix. 3) Incubate at room temperature for 5 min. 4) Briefly centrifuge the centrifuge tube and place it on a magnetic rack. After the solution has clarified (approximately 5 min), carefully transfer the supernatant to a clean centrifuge tube. (When transferring the supernatant, leave 2 μL of liquid at the bottom of the tube; do not aspirate all of the supernatant to avoid aspirating the magnetic beads and affecting the sorting effect). 5) Add 50 μL of the second round of sorting magnetic beads to the supernatant. 6) Vortex or pipette 10 times to mix. Let stand at room temperature for 5 min. 7) Briefly centrifuge the centrifuge tube and place it on a magnetic rack. After the solution has clarified (approximately 5 min), carefully remove the supernatant. 8) Keep the centrifuge tube in the magnetic rack at all times. Add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads. Incubate at room temperature for 30 s, then carefully remove the supernatant. 9) Repeat step 8). 10) Keep the centrifuge tube in the magnetic rack at all times. Open the cap to dry the magnetic beads. 11) Remove the centrifuge tube from the magnetic rack, add 30 μL of ddH2O, vortex or gently pipette to mix thoroughly, and incubate at room temperature for 5 min. 12) Briefly centrifuge the centrifuge tube and place it in the magnetic rack to separate the magnetic beads and liquid. After the solution has clarified (approximately 5 min), carefully aspirate the supernatant into a clean tube. The separation is now complete.

[0038] 8. Second round of PCR amplification PCR amplification system: Take 18 μL of the sorted and purified PCR product obtained in step 7, add 2 μL of primers containing Illumina Index PCR, and 10 μL of 3×T PCR Mix (Hebei Bingyuan Shengkang Medical Technology Co., Ltd.). PCR program: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 30 s, 72℃ for 30 s, 8 cycles; 72℃ for 5 min, incubate at 10℃.

[0039] Primer sequence 1: AATGATACGGCGACCACCGAGATCTACAC (i5 barcode) ACACTCTTTCCCTACACGACGCTCTTCCGATCT Primer sequence 2: CAAGCAGAAGACGGCATACGAGA (i7 barcode) GACTGGAGTTCCTTGGCACCCGAGAATTCCA In the Illumina sequencing pipeline, the core purpose of the second round of PCR amplification (also known as "Index PCR") is to add sample-specific index sequences and universal adapters to the library so that the sequencer can identify different samples and complete cluster generation.

[0040] 9. Magnetic bead purification The purification steps are the same as in step 3. The amplified product is subjected to Qubit concentration determination, requiring a concentration higher than 1 ng / μL. 1 μL of the product is taken and analyzed for fragment distribution using a 2100 bioanalyzer. The correct library size is approximately 300 bp, with no dimer peaks and no large fragment peaks.

[0041] 10. High-throughput sequencing Sequencing was performed using a Nimbo sequencer. The sequencing process was as follows: (1) Prepare SBS and cluster generation reagent cartridges: First, the SBS (Sample Buffer Solution) and cluster generation reagent cartridges need to be thawed. (2) Mix and denature the library: Mix the library with ExAmp reagent and denature it. (3) Select sequencing mode: Select "Sequence" in the software interface, and then specify dual flow cell operation. (4) Load consumables: Remove the consumables left over from the last run, and then load the new consumables required for the current run. (5) Set running parameters: Set the running parameters in the "Run Setup" screen. (6) Monitor the run: Monitor the run from the "Sequence" screen, or use SequencingAnalysis Viewer to monitor the run from a network computer. Data will be transferred to the specified output folder. (7) Cleaning after sequencing: After sequencing is completed, the instrument will automatically start cleaning.

[0042] 11. Data Analysis (1) Quality control uses FASTP software to filter low-quality reads and reads below 50 bp after quality control; (2) BWA alignment software is used to align FASTQ to the target plasmid sequence; (3) Alignment filtering is performed to filter out reads with more than 10% mismatch and count the number of reads for each pathogen and each plasmid.

[0043] 12. Result Interpretation: Count the number of amplified reads for each pathogen and each plasmid at the minimum input level, and observe whether it is greater than 5.

[0044] tNGS detection sensitivity analysis: As shown in Table 3, in each PCR detection system, when the template concentration reached 20 copies or more, all pathogenic microorganism plasmids could be detected without any missed detections. This detection sensitivity is comparable to that of many pathogenic microorganism PCR detection reagents. Negative control (0 copies, template: water): No pathogens were detected, indicating no cross-contamination and good specificity. The above results demonstrate the excellent design and amplification efficiency of tNGS primers.

[0045] Therefore, it can be seen that in each PCR detection system of this invention, when the template concentration reaches 20 copies or more, all pathogenic microorganism plasmids can be detected, indicating that the primer set described in this invention can effectively detect pathogenic microorganisms, and the detection sensitivity is comparable to that of PCR. Furthermore, the detection method of this invention has the advantages of being rapid and efficient, low-cost, having a wide and accurate detection range, and meeting the requirements of high sensitivity and low sample volume.

[0046] Example 3: This example demonstrates the detection of positive mouse organ samples.

[0047] Samples of known Bartonella, Klebsiella pneumoniae, Anaplasma phagocytophilum, Yersinia enterocolitica, Seoul virus, and Babesia microbes were collected from mouse organs (lung, spleen, kidney, and liver) that were positive for Bartonella, Klebsiella pneumoniae, Anaplasma phagocytophilum, Yersinia enterocolitica, Seoul virus, and Babesia microbesii. The samples were ground under sterile conditions, and nucleic acids were extracted according to the instructions of the nucleic acid extraction reagent (Shanghai ZJ, Z-ME-0044A). The obtained nucleic acids were first reverse transcribed, and then the reverse transcription product cDNA and total nucleic acids were used together as tNGS amplification templates. The method of Example 2 of this invention was used for further detection.

[0048] The reaction system for the first round of multiplex PCR was as follows: 5 μL primer set, 10 μL 3×T Enzyme Mix, 5 μL template cDNA, and 10 μL template DNA / total nucleic acid. The remaining steps were the same as in Example 2.

[0049] The test results are shown in Table 4. As can be seen from Table 4, the targeted sequencing kit can detect pathogens in known positive samples.

[0050] Example 4: This example demonstrates the detection of rat organ samples at the port of entry.

[0051] Nucleic acid was extracted from 93 samples of organs (lung, spleen, kidney, and liver) from port rats (rats collected at border ports). The extracted nucleic acids were first reverse transcribed, and then the reverse transcribed cDNA and total nucleic acid were used together as tNGS amplification templates. The method described in Example 2 of this invention was compared with the widely used Bartonella nucleic acid assay kit (fluorescent PCR method) (Shanghai Zhijiang, ER-0501-02) to validate the detection of the 93 rat organ samples. The results are shown in Table 6. Based on the sample statistics in Table 5, the detection results were analyzed, and the detection sensitivity, specificity, positive predictive value, negative predictive value, and overall concordance rate were calculated. The detection results are shown in Table 6.

[0052] The formulas for calculating sensitivity, specificity, positive predictive value, negative predictive value, and overall accuracy in Table 6 are as follows: Sensitivity (%) = TP / (TP + FN) × 100% Specificity (%) = TN / (TN + FP) × 100% Positive predictive value (%) = TP / (TP + FP) × 100% Negative predictive value (%) = TN / (TN + FN) × 100% Overall compliance rate (%) = (TN + TP) / (TP + FN + TN + FP) × 100% As shown in Table 6, the primer set and kit of the present invention can detect common pathogens carried by rodents well, and its sensitivity, specificity, positive predictive value, negative predictive value and overall concordance rate are comparable to those of the fluorescent PCR method.

[0053] The results of Examples 2-4 show that, using the targeted sequencing primer set and kit for detecting common pathogens carried by rodents provided by this invention, only a small amount of sample is needed to simultaneously detect 50 pathogens. Library construction, sequencing, and data analysis can be completed in 15 hours, and the detection results can be output with the help of a data analysis system.

[0054] As described above, the basic principles, main features, and advantages of the present invention have been well described. The above embodiments and specifications are merely descriptions of preferred embodiments of the present invention. The present invention is not limited to the above examples. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the protection scope defined by the present invention.

[0055] Table 1 Primer sequence information for 50 pathogens ; ; ; ; ; ; ; ; ; .

[0056] Table 2 ; ; ; ; ; ; ; ; ; .

[0057] Table 3. Statistical analysis of the corresponding pathogen names and the number of sequences detected by tNGS under different plasmid template concentration gradients. ; .

[0058] Table 4 Results of mouse organ sample testing .

[0059] Q30: The probability of incorrect base identification is 0.1%, and the probability of correct identification is 99.9%. Table 5 Sample Statistics .

[0060] In Table 5, TP (True Positive): Correctly detected positive samples; TN (True Negative): Correctly detected negative samples; FP (False Positive): Number of negative samples that were mistakenly identified as positive; FN (False Negative): Positive samples that were missed.

[0061] Table 6 Results of fluorescence PCR and tNGS detection in mouse samples .

Claims

1. A targeted sequencing primer set for detecting various rodent-borne pathogens, characterized in that, The nucleotide sequences of the primer set are shown in SEQ ID NO:1~SEQ ID NO:

400.

2. The primer set according to claim 1, characterized in that, The pathogens include: Bacillus anthracis, Yersinia pestis, Tulafrancsis, Borrelia burgdorferi, Borrelia dutoni, Bartonella spp., Bartonella henri, Bartonella elizabeth, Benacoxiella, Ehrlich aspergillus miculosus, Leptospira, Leptospira bovis, Leptospira savantis, Leptospira velutipes, Leptospira leptospira, Anaplasma phagocytophilia, Yersinia enterocolitica, Yersinia pseudotuberculosis, Salmonella spp., Shigella spp., Orientia tsutsugamushi, Klebsiella pneumoniae, Rickettsia prowleri, and Rickettsia typhus. One or more of the following: *Erickettsia chafie*, *Rickettsia spectabilis*, *Rickettsia australis*, *Rickettsia rickettsia*, *Rickettsia konjac*, *Rickettsia scutellario*, *Bocavirus*, *Hantavirus*, *Seoul virus*, *Puma virus*, *Dobrava virus*, *Novel Bunyavirus*, *Crimea-Congo Hemorrhagic Fever Virus*, *Lassa virus*, *Tick-borne Encephalitis Virus*, *Cryptosporidium*, *Cryptosporidium microsporidium*, *Babesia*, *Babesia microsporidium*, *Babesia dibuds*, *Hymenolepis shortissimus*, *Fasciola hepatica*, *Treatisena gambiae*, *Angiostrongylus cantonensis*, *Leishmania*, and *Schistosoma japonicum*.

3. A kit for detecting various pathogens carried by rodents, characterized in that, Contains the primer set as described in claim 1.

4. The reagent kit according to claim 3, characterized in that, The kit also includes PCR reagents, primers containing specific index sequences and universal adapters, and PCR product purification reagents.

5. The use of the primer set of claim 1 or the kit of claim 3 in the preparation of a product for detecting pathogens carried by rodents.

6. The application according to claim 5, characterized in that, The pathogens include: Bacillus anthracis, Yersinia pestis, Tulafrancsis, Borrelia burgdorferi, Borrelia dutoni, Bartonella spp., Bartonella henri, Bartonella elizabeth, Benacoxiella, Ehrlich aspergillus miculosus, Leptospira, Leptospira bovis, Leptospira savantis, Leptospira velutipes, Leptospira leptospira, Anaplasma phagocytophilia, Yersinia enterocolitica, Yersinia pseudotuberculosis, Salmonella spp., Shigella spp., Orientia tsutsugamushi, Klebsiella pneumoniae, Rickettsia prowleri, and Rickettsia typhus. One or more of the following: *Erickettsia chafie*, *Rickettsia spectabilis*, *Rickettsia australis*, *Rickettsia rickettsia*, *Rickettsia konjac*, *Rickettsia scutellario*, *Bocavirus*, *Hantavirus*, *Seoul virus*, *Puma virus*, *Dobrava virus*, *Novel Bunyavirus*, *Crimea-Congo Hemorrhagic Fever Virus*, *Lassa virus*, *Tick-borne Encephalitis Virus*, *Cryptosporidium*, *Cryptosporidium microsporidium*, *Babesia*, *Babesia microsporidium*, *Babesia dibuds*, *Hymenolepis shortissimus*, *Fasciola hepatica*, *Treatisena gambiae*, *Angiostrongylus cantonensis*, *Leishmania*, and *Schistosoma japonicum*.

7. A method for detecting multiple rodent-borne pathogens for non-disease diagnostic and therapeutic purposes, characterized in that, Includes the following steps: 1) Using the nucleic acid of the sample to be tested as a template, perform the first round of multiplex PCR amplification using the primer set described in claim 1 or 2 or the kit described in claim 3 or 4, purify the amplification product to obtain the purified PCR product, and add primers containing the sample-specific index sequence and the universal sequencing adapter sequence for the second round of PCR amplification. 2) After purifying and quality-checking the second round of PCR amplification products, qualified libraries were obtained, and then high-throughput sequencing was performed on the qualified libraries. Based on sequencing and bioinformatics comparison results, the types of pathogens in rodent samples were determined.

8. The method according to claim 7, characterized in that, The qualified library standard is a library concentration > 1 ng / μL; the fragment size of the library during sequencing is 250-350 bp.

9. The method according to claim 7, characterized in that, The reaction system for the first round of multiplex PCR was as follows: 5 μL primer set, 10 μL 3×T Enzyme Mix, 5 μL template cDNA, and 10 μL template DNA or total nucleic acid; the reaction program was: 95℃ for 3 min; 95℃ for 20 s, 63℃ for 2 min, 72℃ for 2 min, for 23 cycles; 72℃ for 5 min; and stored at 10℃. The reaction system for the second round of PCR was as follows: 18 μL of the first round of multiplex PCR product, 2 μL primers containing Illumina Index PCR, and 10 μL 3×T PCR Mix; the reaction program was: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 30 s, 72℃ for 30 s, for 8 cycles; 72℃ for 5 min; and stored at 10℃.