Methods for promoting the conversion of ginsenosides to rare ginsenosides, combinations of ginseng and goldflower ginseng, and uses thereof

Abstract

This invention relates to a method for promoting the conversion of ginsenosides into rare saponins, a *Gynostemma pentaphyllum* ginseng composition, and its applications. The process involves individually inoculating ginseng slices with *Gynostemma pentaphyllum* for fermentation, increasing the saponin content in the ginseng and promoting the conversion of ginsenoside Rb1 into more easily absorbed rare ginsenosides Rg3(S / R), Rh2, and Rg5. This significantly increases the content of the rare saponin active ingredients Rg3(S / R), Rh2, and Rg5 in ginseng, while also increasing the flavor compounds in the product, resulting in a richer flavor and texture. Furthermore, the low-temperature ultrafine grinding process locks in the flavor and nutrients, further improving the taste recovery. The *Gynostemma pentaphyllum* ginseng composition of this invention has a rich flavor, high content of active ingredients, is safe and non-toxic, has a smooth and non-drying taste, and can be used as a substitute tea, food ingredient, or health food (blue hat) ingredient.

Description

Technical Field

[0001] This invention belongs to the field of food and health food, and in particular relates to a method for promoting the conversion of dry ginsenosides into rare ginsenosides, a composition of golden ginseng and its application. Background Technology

[0002] Golden Flower Fungus, scientifically known as *Eurotium cristatum*, is a fungus that plays a crucial role in the fermentation process of Fu brick tea, significantly impacting its quality. It offers numerous health benefits, including antioxidant properties, aiding digestion, regulating blood lipids, and promoting gut health.

[0003] Existing products containing *Aureobasidium aureum* (a type of fungus) are mostly based on tea leaves, combined with other materials to create tea slices or substitute teas to exert corresponding health benefits. However, both tea leaves and tea slices require drying and other processing for preservation, which results in the loss of antioxidants and glycosides. Therefore, these products suffer from short shelf life and poor taste recovery. Furthermore, the fermentation process for these tea slices or tea leaves typically involves: a) co-fermentation with target materials using tea containing *Aureobasidium aureum*, such as Fu brick tea. Generally, the tea leaves are fermented first, then mixed with the target materials, utilizing the *Aureobasidium aureum* produced by the tea leaves to transfer to the materials. This process results in inconsistent fermentation results from batch to batch, the *Aureobasidium aureum* cannot fully ferment on the materials, and the product also absorbs the flavor of the tea. b) After mixing and pulping the tea and target materials, the strain is added for fermentation. This method results in completely uniform fermentation, and the product quality and flavor are relatively consistent. However, it also introduces the flavor of auxiliary materials that contribute to the formation of *Aureobasidium aureum*, such as tea leaves and sucrose. Moreover, the mixing and crushing methods cause the loss of nutrients and flavor compounds. Moreover, the above process involves fermenting tea leaves and other materials together, which cannot guarantee the prevention of the growth of other molds and poses certain safety risks.

[0004] Ginseng is a traditional Chinese medicine that is both food and medicine. There are many ginseng health teas and other products on the market, but most of these products are simply made by mixing ginseng with other materials, such as tea leaves, and cannot effectively release the active ingredients.

[0005] The existing technology, Chinese patent application number 202310932714.5, describes a method and application for increasing ginsenoside content. This method employs a process of sequentially fermenting ginseng with probiotics in aerobic and anaerobic conditions, followed by inoculating sterilized ginseng with *Aspergillus cristatus* activated by tea infusion for a three-stage fermentation. This method still relies on tea infusion as the activation and fermentation medium for *Aspergillus cristatus*, essentially remaining bound to the *Aspergillus cristatus* fermentation system by tea. Furthermore, it still suffers from the aforementioned problems of introducing exogenous flavors from tea and the risk of contamination by other microorganisms in the fermentation system. Moreover, residual metabolites after probiotic fermentation may alter the fermentation microenvironment of *Aspergillus cristatus*, affecting its enzyme activity and leading to unstable saponin conversion efficiency and a diverse range of conversion products. Summary of the Invention

[0006] To address the shortcomings of the existing technology, this invention provides a ginseng composition using solid-state fermentation. Ginseng slices are individually inoculated with Mycorrhiza uralensis for fermentation to obtain a tea beverage. The fermentation process uses a single raw material, and the product's flavor is locked in while its nutrients are preserved.

[0007] A first aspect of the present invention provides a method for promoting the conversion of ginsenosides into rare saponins, comprising the following steps: S1 Preparation of raw materials for *Golden Flower Fungus*: Extracting *Golden Flower Fungus* strains from Fu tea, culturing, screening, separating and purifying them to obtain *Golden Flower Fungus*; S2 Ginseng Solid-State Fermentation: The Golden Flower Mycorrhizae are inoculated onto ginseng slices for fermentation.

[0008] Preferably, the drying ginsenoside is Rb1, and the rare ginsenosides are Rg3(S / R), Rh2, and Rg5.

[0009] This process involves inoculating ginseng slices with Mycorrhiza uralensis for fermentation, which can significantly increase the content of beneficial components in ginseng, such as ginsenosides. It promotes the conversion of the drying ginsenoside Rb1 into the more easily absorbed rare ginsenosides Rg3 (S / R), Rh2, and Rg5. At the same time, the introduction of Mycorrhiza uralensis components into the product results in a richer flavor and a greater abundance of beneficial components.

[0010] Preferably, the Fu tea is compressed Fu tea conforming to standard DB43 / T657.4-2021 Anhua Dark Tea Part 4: Fu Tea, with a quality rating of Super and a golden flower fungus content >20×10⁻⁶. 4 The bacterial count per gram of dry tea is used to ensure that the dominant bacteria during ginseng fermentation is Mycorrhiza uralensis, ensuring product safety and compliance with food safety requirements.

[0011] Preferably, step S1 specifically involves: weighing a Fu brick tea sample, adding it to 0.85% sterile physiological saline, shaking it at 180 r / min for 30-60 min in a constant temperature shaker at 28℃, diluting and spreading it on a PDA plate after shaking, then incubating it at 28℃, screening for colonies with good growth, and then separating and purifying it on a PDA medium using the dilution plating method; wherein, Fu brick tea sample: 0.85% sterile physiological saline = 25-50g: 225-450mL.

[0012] Preferably, step S2 includes: S21 Select *Aureobasidium aureum* mycelium cultured on plates for 5-7 days and place it in sterile water, shake well to obtain a single-spore suspension of *Aureobasidium aureum*, the concentration of which is 1×10⁻⁶. 7 -10×10 7 CFU / mL; S22 Add 5-10% sterilized glucose solution to ginseng slices, control the moisture content of the material to 30%±5%, stir evenly and then sterilize. S23 Spray the single spore suspension of *Mycorrhiza uralensis* onto the ginseng slices obtained in step S22 at an inoculation rate of 10-20%, ferment at 28±5℃, control the material moisture content at 30%±5%, and culture for 8-10 days.

[0013] During the fermentation process, instead of adding sucrose water, 5-10% glucose water is added and mixed with the suspension of ginseng spores. This utilizes the saponins, polysaccharides, and monosaccharides in ginseng for fermentation, significantly increasing the content of beneficial components in the product, resulting in more nutrients compared to tea products.

[0014] Preferably, the ginseng slices are 1-3 mm thick and 10-20 mm long and 20 mm wide.

[0015] Preferably, the process also includes step S3: pulverization: the fermented ginseng slices are dried at low temperature and then freeze-pulverized to obtain golden ginseng powder. Using low-temperature ultrafine pulverization locks in flavor and nutrients, resulting in a smooth, non-dry texture and better flavor recovery.

[0016] Preferably, in step S3, the moisture content of the material after low-temperature drying is 5-8%.

[0017] Preferably, in step S3, during cryogenic pulverization, the material is first coarsely pulverized at -20°C until the particle size is ≤2mm, and then subjected to cell-level ultrafine pulverization to better retain the nutrients in the material.

[0018] In a second aspect, the present invention provides a method for promoting the conversion of ginsenosides into rare saponins, thereby preparing a golden ginseng composition. The golden ginseng composition of the present invention can be in the form of tablets, capsules, pills, granules, etc.

[0019] A third aspect of the present invention also provides the application of the aforementioned golden ginseng composition, which can be used to make food, health food, etc., such as as a substitute tea, or as a food material or health food material.

[0020] Compared with the prior art, the present invention has the following beneficial effects: This invention utilizes ginseng slices inoculated with *Gynostemma pentaphyllum* for fermentation, increasing the saponin content in ginseng and promoting the conversion of the drying ginseng saponin Rb1 into more easily absorbed rare ginseng saponins Rg3(S / R), Rh2, and Rg5. This significantly increases the content of the rare saponin active ingredients Rg3(S / R), Rh2, and Rg5 in ginseng, and also increases the flavor compounds in the product, improving its flavor and resulting in a richer flavor and texture. Furthermore, the low-temperature ultrafine grinding process locks in the flavor and nutrients, leading to better taste recovery. The *Gynostemma pentaphyllum* ginseng composition of this invention has a rich flavor, high content of active ingredients, is safe and non-toxic, has a smooth and non-drying texture, and can be used in the production of food, especially health food. Attached Figure Description

[0021] Figure 1 The morphology of *Aureobasidium aureum* colony 1; Figure 2 The morphology of colony II of *Aureobasidium aureum*; Figure 3 The morphology of colony three of *Aureobasidium aureum*; Figure 4 Optical micrograph of *Aureobasidium aureum*; Figure 5 Images were taken to record the fermentation process of the samples (the conical flask on the left in the image shows the fermentation result of Comparative Example 1, and the conical flask on the right in the image shows the fermentation result of Example 3). Figure 6 This is a schematic diagram of the fermented sample after drying (the conical flask on the left in the figure is the fermentation result of Comparative Example 1, and the conical flask on the right in the figure is the fermentation result of Example 3). Figure 7 SPME-HS-GCMSMS analysis results of ginseng slices that were unfermented and fermented with Mycorrhizal ginseng; Figure 8 This refers to the transformation of dry ginsenoside Rb1 into rare ginsenoside Rh2. Detailed Implementation

[0022] The present invention will be further illustrated below with reference to specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.

[0023] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0024] Example 1: Preparation of *Agaricus esculentus* raw material The selected tea is pressed Fu brick tea produced in Anhua, Hunan Province, that meets the standards of "DB43 / T657.4-2021 Anhua Dark Tea Part 4: Fu Brick Tea". The quality is rated as "Super", with *Golden Flower Fungus* > 20 × 10⁻⁶. 4 Bacteria count / g dry tea.

[0025] In a sterile laboratory, 25g of Fu brick tea sample was weighed and added to 225mL of 0.85% sterile physiological saline (with glass beads); the mixture was shaken for 30 min at 28℃ and 180 r / min in a constant temperature shaker. After shaking, the sample was diluted to 10 mL. -1 10 -2 10 -3 10 -4 10 -5 10 -6 Six gradients were prepared, with 100 µL of each dilution spread onto PDA plates. The plates were then inverted and incubated at 28°C. After colonies appeared, their growth was observed. Three colonies with good growth were selected and isolated and purified on PDA medium using the dilution plating method.

[0026] Figure 1-3 The images show the colony morphology of three well-grown *Aureobasidium aureum* colonies after incubation at 28°C for 4, 7, and 10 days on PDA medium. The top image shows the front view of the colonies, and the bottom image shows the back view.

[0027] Optical microscopic identification Add 2-3 drops of lactophenol cotton blue staining solution to a glass slide. Use a toothpick to pick up hyphae that have been cultured on a PDA plate for 4-5 days, mix them with the staining solution, cover with a coverslip, blot off excess staining solution with filter paper, let stand for 5 minutes, place on the microscope stage, adjust the microscope, and observe the morphology of hyphae, cleistothecia, spores, etc. under the eyepiece, and take pictures for recording. Figure 4 Some examples are shown, in which the sporangia in Figure A are spherical with a cleistothecia structure and contain a large number of ascospheres; in Figure B, the ascospheres rupture after maturation, releasing a large number of ascospores, which are elliptical to round.

[0028] Biological identification DNA extraction from *Aureobasidium aureum*: DNA samples were extracted using the Fungi Genomic DNA Extraction Kit (sample preparation required the addition of an appropriate amount of lysozyme to dissolve the fungal cell wall or grinding with liquid nitrogen). Universal primers and ITS fragment sequencing were performed. Two universal primers were used: ITS1 (SEQ ID No.1: 5'-TCCGTAGGTGAACCTGCGG-3'), ITS4 (SEQ ID No. 2: 5'-TCCTCCGCTTATTGATATGC-3'); DNA fragment amplification. DNA purification: Ligation and transformation using a universal DNA purification and recovery kit (Tiangen Biotech Co., Ltd.), followed by sequencing.

[0029] Sequence alignment: The sequenced results were copied to NCBI Blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) for sequence alignment. The DNA sequences of the three colonies of *Aureobasidium aureum* were identical, all corresponding to SEQ ID No. 3. TTAAGTTCAGCGGGTATCCCTAACCTGATCCGAGGTCAACCTGGTTAAAAAGATTGGTTGCGAGGCTAGCTGCCAGCTGGACCTACGGGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCAGACATG GTGCCGCCACTGCCTTTTGGGCCCGTCCCCGTTGCCAGGGACGGAAGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCG TTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAATTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACGATTGTTTAACTAAAAACTC AGACTGCAAACTTCAGACAGCGTTCAAATGTTAGTCTCCGGCGGGCCGTGGCCACGCCGAAGCACAGGGTACAGATAGACACGGATGGGAGGTTGGACCCAGAGGGCCCGCACTCGGTAATGATCCTT The sequence was submitted to NCBI for BLAST alignment analysis, which showed that the ITS-amplified sequence had 100% similarity to *Aureobasidium aureum*.

[0030] Example 2: Ginseng Solid-State Fermentation 2.1 Preparation of *Aureobasidium aureum* suspension In a sterile workroom, the mycelium of *Aureobasidium aureum* cultured on a plate for 6 days in Example 1 was picked up and placed in sterile water, shaken evenly to obtain a single spore suspension. The spores were counted using a hemocytometer, and the concentration of the spore suspension was adjusted to reach 1 × 10⁻⁶. 7 CFU / mL.

[0031] 2.2 Ginseng processing Cut the ginseng into slices 1-3mm thick and 10-20mm x 10-20mm in size. Spray with sterilized 10% glucose solution, then stir evenly. Control the moisture content of the material to 30% ± 5%. After stirring evenly, sterilize at 121℃ for 20 minutes.

[0032] 2.3 Inoculation and Fermentation The spore suspension obtained in step 2.1 was sprayed onto the ginseng slices obtained in step 2.2 at an inoculation ratio of 15%. The moisture content of the material was controlled at 30% ± 5%, the fermentation temperature was 28 ± 5℃, and the ginseng was cultured in an Erlenmeyer flask. The changes in the ginseng were observed over the number of days of culture.

[0033] Example 3: Crushing 3.1 Low-temperature drying. The fermented ginseng from Example 2 was dried in a low-temperature drying oven to achieve a material dryness (moisture content) of 5%-8%. The dried sample looked like... Figure 6 As shown.

[0034] 3.2 Pre-coarse powdering. The product is processed using a cryogenic crusher at -20℃ to achieve a coarse powder particle size ≤2mm.

[0035] 3.3 Cell-level ultrafine pulverization. Used in conjunction with a cryogenic refrigeration unit, both the material and the refrigeration unit are cooled simultaneously. After feeding the material into the hopper and setting the refrigeration unit, wait until the set temperature reaches -20℃ before starting pulverization. After pulverization, vibrate for 40-60 seconds to collect all samples, obtaining ginseng powder.

[0036] Comparative Example 1 Unlike Example 3, an equal amount of unfermented ginseng was used instead of fermented ginseng. The unfermented ginseng was ginseng without the addition of the Mycorrhiza uralensis suspension (i.e., the ginseng slices obtained in step 2.2 of Example 2).

[0037] Comparative Example 2 The ginseng fermentation method provided in this comparative example is obtained through the following method: F1. Weigh 1000 parts of ginseng and add 260 parts of purified water for soaking. Sterilize at 121℃ for 20 minutes and cool to room temperature to obtain the first sterilized ginseng. The first-fermented ginseng is obtained by solid-state aerobic fermentation with probiotics after the initial sterilization. Specifically, this involves selecting one or more activated probiotic liquid inoculums in equal mass ratios and inoculating them into the first-sterilized ginseng at 7% of the total ginseng mass. Fermentation is then carried out at 45℃ for 20 hours to obtain the first-fermented ginseng. The ginseng after its first fermentation is subjected to probiotic solid-state anaerobic fermentation to obtain ginseng after its second fermentation. Specifically, this involves selecting one or two activated probiotic liquid inoculums in equal mass ratios and inoculating them into the ginseng after its first fermentation at 7% of the total ginseng mass. Fermentation is then carried out at 45℃ for 20 hours to obtain the ginseng after its second fermentation. After the second fermentation, the ginseng was placed in a microwave oven and microwaved for 5 minutes at a power of 800W. After sterilization, it was left to stand for 15 hours. After sterilization, it was sealed and cooled to obtain the second sterilized ginseng.

[0038] F2. Spray the ginseng obtained from the second sterilization in step F1 with sterilized 10% glucose water, then stir evenly, control the moisture content of the material to be 30%±5%, and sterilize at 121℃ for 20 minutes after stirring evenly to obtain the ginseng after the third sterilization.

[0039] F3. The *Gynostemma pentaphyllum* suspension prepared in 2.1 of Example 2 is evenly sprayed and inoculated onto the ginseng that has been sterilized for the third time in step F2. After inoculation, the ginseng is immediately sealed with plastic wrap and then punched with holes. It is then transferred to a constant temperature and humidity chamber for fermentation and drying to obtain ginseng after the third fermentation. The specific method of fermentation treatment is as follows: after inoculation and second sterilization, the ginseng is transferred to a constant temperature and humidity chamber for 20 days of fermentation, and the moisture content of the material is controlled at 30%±5% and the fermentation temperature is 28±5℃.

[0040] The specific method for the drying process is as follows: the fermented ginseng is placed in a drying oven at 100°C and dried for 6 hours until the moisture content is 6%.

[0041] In step F1, the preparation steps of the probiotic liquid inoculum include: adding 3g of glucose, 2g of soybean powder, and 0.2g of yeast extract to every 100ml of purified water to obtain a probiotic activation culture solution; sterilizing the probiotic activation culture solution at 121℃ for 20 minutes and cooling it for later use; inoculating one or more probiotics at 1% into the probiotic culture solution and activating them at a natural pH and a temperature of 40℃ for 48 hours to obtain the probiotic liquid inoculum.

[0042] The probiotic strains used in aerobic fermentation include Lactobacillus plantarum, Lactobacillus acidophilus, Lactobacillus rhamnosus, Lactobacillus casei, and Bacillus subtilis; the probiotic strains used in anaerobic fermentation include Bifidobacterium adolescentis, Bifidobacterium lactis, and Bacillus coagulans.

[0043] Example 4: Test of Golden Flower Ginseng Powder 4.1 Determination of the content of effective substances in ginseng.

[0044] According to the pharmacopoeia, the saponin content in the fermented ginseng (fermented for 8 days in Example 3), the unfermented ginseng in Comparative Example 1, and the fermented ginseng obtained in Comparative Example 2 were determined. The fructose, sucrose, and glucose were determined according to GB 5009.8-2016 Determination of fructose, glucose, sucrose, maltose and lactose in food, Method I. The results are shown in Table 1.

[0045] Table 1. Determination of Ginsenoside and Protein Content

[0046] like Figure 5 As shown, it can be seen that as time changes, the ginseng slices with added golden flower fungus in Example 3 (the conical flask on the right in the figure) continuously ferment and produce golden flower fungus, while no golden flower fungus is generated in Comparative Example 1 (the conical flask on the left in the figure), which did not add golden flower fungus.

[0047] As can be seen from Table 1, in Example 1 of the present invention, no sucrose water fermentation or culture medium was added to the material. Instead, glucose water solution was added to the ginseng slices, and then a suspension of Aureobasidium spores was added and mixed. During the fermentation process, some of the glycosides, polysaccharides, and monosaccharides in the ginseng were utilized for fermentation, and the content of ginsenosides was increased.

[0048] Compared to Comparative Example 1, the addition of *Gynostemma pentaphyllum* in Example 3 facilitated the conversion of ginsenosides in ginseng, transforming ginsenoside Rb1 into more readily absorbed rare ginsenosides Rg3 (S / R), Rh2, and Rg5, thereby significantly increasing the content and variety of rare ginsenosides. The decrease in both ginsenosides Rg1 and Re may be because the rate of Re conversion to Rg1 is lower than the rate of Re and / or Rg1 hydrolysis.

[0049] Compared to Example 3, Comparative Example 2 involves the addition of *Gynostemma pentaphyllum* (a type of ginseng) to ginseng after sequential solid-state aerobic and anaerobic fermentation with probiotics. The sequential solid-state aerobic and anaerobic fermentation of Comparative Example 2 follows the steps of Example 3 in the prior art—a method and application for increasing ginsenoside content (Chinese Patent Application No. 202310932714.5). Furthermore, the fermentation time of *Gynostemma pentaphyllum* in Comparative Example 2 is longer than both the fermentation time of *Gynostemma pentaphyllum* in Example 3 of the prior art (a method and application for increasing ginsenoside content) and the fermentation time of *Gynostemma pentaphyllum* in Example 3 of this invention. However, the content and types of rare ginsenosides in Comparative Example 2 are lower than those in Example 3. Figure 8 As shown, the conversion of ginsenoside Rb1 to Rh2 follows a stepwise deglycosylation process. The pathway for Rb1 to Rh2 is Rb1→Rd→Rg3(S / R)→Rh2, while Rg3→Rg5 (dehydration conversion). This indicates that the conversion of Rg3 to Rh2 requires the removal of glucose from the C3 position of Rg3. However, no Rh2 was detected in Comparative Example 2. This may be because residual metabolites after probiotic fermentation in Comparative Example 2 inhibited the removal of glucose from the C3 position of Rg3, making it difficult for Rg3 to convert to Rh2, and even affecting the conversion efficiency of Rg3 to Rg5. This demonstrates that the present invention, through the separate fermentation of ginseng by *Gynostemma pentaphyllum*, more effectively converts the dry ginsenoside Rb1 into the more easily absorbed rare ginsenosides Rg3(S / R), Rh2, and Rg5. Both rare ginsenosides Rh2 and Rg3 have anti-tumor and immunomodulatory effects. Rh2 is slightly more lipid-soluble than Rg3, and its molecular structure is closer to the aglycone, resulting in stronger cell membrane penetration. According to the research progress on the active components and mechanisms of action of ginseng in anti-tumor activity published by Ren Zezhong et al., compared with Rg3, rare ginsenoside Rh2 can also inhibit tumor epithelial-mesenchymal transition. Therefore, this invention can obtain more rare ginsenosides Rg3 (S / R), Rh2 and Rg5 by fermenting ginseng alone with Aureobasidium aureum, which has good application prospects.

[0050] In addition, the increased Rg1 content in Comparative Example 2 compared to Example 3 may be because the rate at which Re is converted to Rg1 after probiotic fermentation is higher than the rate at which Re and / or Rg1 are hydrolyzed.

[0051] 4.2 Nutrient Preservation The fermented ginseng from Example 3 (fermented for 8 days) and the unfermented ginseng from Comparative Example 1 were placed in a constant temperature and humidity chamber for 8 days. The moisture content of the materials was controlled at 30% ± 5%, and the fermentation temperature was 28 ± 5℃. According to the pharmacopoeia, the loss of saponins was tested, and the results are shown in Table 2. Table 2. Determination of ginsenoside loss after 8 days of storage.

[0052] As shown in Table 2, compared with unfermented ginseng, the content of ginsenosides in the fermented ginseng remained essentially unchanged after 8 days. This indicates that the nutritional components of fermented ginseng are more stable.

[0053] 4.3 Flavor analysis.

[0054] Identification was performed using solid-phase microextraction combined with gas chromatography-mass spectrometry (SPME-HS-GC-MS), such as... Figure 7 As shown, compared with unfermented ginseng slices (black line), the ginseng fermented with Mycorrhiza uralensis of the present invention has increased alcohols, aldehydes, esters, ketones, ethers, alkenes and acids, and has a unique aroma. This indicates that the introduction of Mycorrhiza uralensis enriches the product flavor and increases the relevant beneficial components.

[0055] 4.4 Taste and reproducibility.

[0056] Sensory laboratory experiments were conducted, with nine tea tasters participating in a blind sample test. The results showed no difference in appearance between the two teas made from fermented ginseng obtained through step 3.1 (slicing, fermentation, and drying) and the fermented ginseng obtained through step 3.3 (low-temperature ultrafine powder). However, the tea made from the fermented ginseng obtained through step 3.3 (low-temperature ultrafine powder) scored higher in taste. This demonstrates that fermenting ginseng slices and golden flower fungus together followed by low-temperature ultrafine powder processing improves the taste, resulting in a smooth, non-dry product that is more acceptable to consumers.

[0057] 4.5 Security.

[0058] The fermented ginseng in Example 3 was tested for aflatoxin B1, G1, G2, and B2 content, which met the food safety requirements of GB 2761-2017 National Food Safety Standard for Limits of Mycotoxins in Food, thus demonstrating its advantages of being safe and non-toxic.

[0059] In summary, it can be seen that the golden ginseng composition prepared in the embodiments of the present invention is fermented by inoculating ginseng slices with *Gynostemma pentaphyllum*. No sucrose water was added during the fermentation process; only appropriate glucose was added to the ginseng slices. Then, a suspension of *Gynostemma pentaphyllum* spores was mixed in. During fermentation, some of the glycosides, polysaccharides, and monosaccharides in the ginseng were utilized, resulting in an increased ginsenoside content in the product. Furthermore, the conversion of drying ginsenosides in ginseng was solved, transforming them into rarer ginsenosides that are more easily absorbed, thus increasing efficacy. Moreover, after being combined with *Gynostemma pentaphyllum*, the product has a rich flavor, a smooth texture, and is not dry, making it suitable for use in food, health food, etc.

[0060] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0061] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A method for promoting the conversion of ginsenosides into rare saponins, characterized in that, Includes the following steps: S1 Preparation of raw materials for *Golden Flower Fungus*: Extracting *Golden Flower Fungus* strains from Fu tea, culturing, screening, separating and purifying them to obtain *Golden Flower Fungus*; S2 Ginseng Solid-State Fermentation: The Golden Flower Mycorrhizae are inoculated onto ginseng slices for fermentation.

2. The method for promoting the conversion of ginsenosides into rare saponins according to claim 1, characterized in that, The Fu tea mentioned is compressed Fu tea that conforms to standard DB43 / T657.4-2021 Anhua Dark Tea Part 4: Fu Tea, with a quality rating of Super and a golden flower fungus content >20×10⁻⁶. 4 Bacteria count / g dry tea.

3. The method for promoting the conversion of ginsenosides into rare saponins according to claim 1, characterized in that, Step S1 specifically involves: weighing the Fu brick tea sample, adding it to 0.85% sterile physiological saline, shaking it at 180 r / min for 30-60 min in a constant temperature shaker at 28℃, diluting and spreading it on a PDA plate after shaking, then incubating it at 28℃, screening for colonies with good growth, and then separating and purifying it on PDA medium using the dilution plating method; wherein, Fu brick tea sample: 0.85% sterile physiological saline = 25-50g: 225-450mL.

4. The method for promoting the conversion of ginsenosides into rare saponins according to claim 1, characterized in that, Step S2 includes: S21 Select *Aureobasidium aureum* mycelium cultured on plates for 5-7 days and place it in sterile water, shake well to obtain a single-spore suspension of *Aureobasidium aureum*, the concentration of which is 1×10⁻⁶. 7 -10×10 7 CFU / mL; S22 Add 5-10% sterilized glucose solution to ginseng slices, control the moisture content of the material to 30%±5%, stir evenly and then sterilize. S23 Spray the single spore suspension of *Gynostemma pentaphyllum* onto the ginseng slices obtained in step S22 at an inoculation ratio of 10% to 20%, ferment at 28±5℃, control the material moisture content at 30%±5%, and culture for 8 to 10 days.

5. The method for promoting the conversion of ginsenosides into rare saponins according to claim 4, characterized in that, The ginseng slices are 1-3 mm thick and 10-20 mm long and 20 mm wide.

6. The method for promoting the conversion of ginsenosides into rare saponins according to any one of claims 1-5, characterized in that, It also includes step S3, pulverization: the fermented ginseng slices are dried at low temperature and then freeze-pulverized to obtain golden flower ginseng powder.

7. The method for promoting the conversion of ginsenosides into rare saponins according to claim 6, characterized in that, In step S3, the moisture content of the material after low-temperature drying is 5-8%.

8. The method for promoting the conversion of ginsenosides into rare saponins according to claim 6, characterized in that, During cryogenic pulverization, the product is first coarsely pulverized at -20℃ until the particle size is ≤2mm, and then cell-level ultrafine pulverization is performed.

9. The golden ginseng composition prepared by the method for promoting the conversion of dry ginsenosides into rare ginsenosides as described in any one of claims 1-8.

10. A product characterized in that, The product comprises the ginseng composition as described in claim 9, and is a food or health food.

Images