A sodium caseinate-based pickering emulsion and a preparation method and application thereof
Pickering emulsion, prepared using flagellin from Salmonella Typhimurium and sodium caseinate, solves the problems of insufficient emulsion stability and biocompatibility in existing technologies, achieving an emulsion with small particle size and high stability, which can effectively induce an immune response and is suitable for vaccine adjuvants.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-13
- Publication Date
- 2026-06-02
Smart Images

Figure CN122124229A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of vaccine adjuvant technology, specifically relating to a sodium caseinate-based pickering emulsion, its preparation method, and its application. Background Technology
[0002] Pickering emulsions use solid particles to stabilize the interface between the aqueous and oil phases, thereby maintaining emulsion stability. They are characterized by good safety, convenient preparation, and high stability, and are widely used in various industries. However, their application in the pharmaceutical field is still in the research stage.
[0003] Salmonella typhimurium flagellin is the main structural protein constituting the flagella of Salmonella typhimurium. Its most prominent characteristic is its potent immunostimulatory activity. Sodium caseinate is a safe and edible protein derivative made from casein in milk through sodium hydroxide treatment. It can efficiently bind oil and water to form stable emulsions and is widely used in foods such as coffee creamer, ice cream, and processed cheese. Currently, no Pickering emulsions have been found prepared using Salmonella typhimurium flagellin and sodium caseinate as raw materials.
[0004] Therefore, how to use Salmonella typhimurium flagellin and sodium caseinate as raw materials to prepare Pickering emulsion has become an important issue that urgently needs to be addressed. Summary of the Invention
[0005] Therefore, the purpose of this invention is to provide a sodium caseinate-based Pickering emulsion, its preparation method, and its application. The Pickering emulsion is prepared using Salmonella typhimurium flagellin and sodium caseinate as raw materials. The prepared Pickering emulsion has the characteristics of small particle size, good biocompatibility, and high stability, and can induce a high immune response in the body.
[0006] To achieve the above objectives, the present invention provides the following technical solution:
[0007] In a first aspect, the present invention provides a sodium caseinate-based pickering emulsion, wherein a mixed solution of Salmonella typhimurium flagellin and sodium caseinate in a mass ratio of 1:8 is used as the aqueous phase, sodium caseinate is used as solid particles, and squalene is used as the oil phase.
[0008] Based on the above technical solution, the concentration of the flagellin of Salmonella typhimurium is further set to 500 µg / mL.
[0009] Based on the above technical solution, the pH of the Pickering emulsion is further defined as 8.
[0010] Secondly, the present invention provides a method for preparing the above-mentioned sodium caseinate-based Pickering emulsion, comprising the following steps: S1, Construct the recombinant expression vector of the flagellated protein of Salmonella Typhimurium; S2, based on the recombinant expression vector, express and purify the flagellated protein of Salmonella Typhimurium; S3, the purified Salmonella typhimurium flagellin and sodium caseinate were mixed at a mass ratio of 1:8 to obtain a mixed solution; S4, the squalene and the mixed solution are homogenized at a volume ratio of 3:2 to obtain the Pickering emulsion.
[0011] Based on the above technical solution, step S1 further includes the following steps: S101, the FljB gene of Salmonella Typhimurium was specifically amplified by PCR technology; S102 was separated by agarose gel electrophoresis and then purified by column purification. S103, selected the pET-30a prokaryotic expression vector, and utilized... Bamh Ⅰ / Xho I. Linearization treatment was completed at the double enzyme restriction sites; S104, through T4 DNA ligase-mediated directional ligation of the FljB gene and the vector; S105, the recombinant plasmid was introduced into BL21-DE3 competent cells via heat shock; S106 was screened for positive clones on LB agar plates containing kanamycin, and colony PCR was performed using T7 universal primers for identification. Bamh Ⅰ / Xho I. Perform double enzyme digestion identification.
[0012] Based on the above technical solution, step S2 further includes the following steps: S201, the recombinant expression vector was cultured for 5 h under the conditions of 37 ℃ and 200 r / min shaking culture; S202, soluble recombinant protein was purified using AKTA system nickel column affinity chromatography; S203, the obtained protein was verified as the target protein by Western blot.
[0013] Based on the above technical solution, the homogenization conditions are further specified as 16,000 rpm and 2 min.
[0014] Thirdly, the present invention provides the application of the above-mentioned sodium caseinate-based pickering emulsion in the preparation of vaccine adjuvants.
[0015] Fourthly, the present invention provides the application of the above-mentioned sodium caseinate-based pickering emulsion in the preparation of vaccines.
[0016] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention is the first to propose using Salmonella typhimurium flagellin and sodium caseinate as raw materials to formulate Pickering emulsion. The prepared Pickering emulsion has the characteristics of small particle size, good biocompatibility and high stability, and can induce a high immune response in the body.
[0017] 2. This invention is the first to propose the application of Pickering emulsion, formulated using Salmonella typhimurium flagellin and sodium caseinate as raw materials, in the preparation of vaccine adjuvants.
[0018] 3. The Pickering emulsion prepared by this invention has a simple preparation process, requiring only two steps: mixing and homogenization, and can effectively load the model antigen OVA. This emulsion exhibits good cellular safety and promotes the endocytosis of exogenous antigens by macrophages. The emulsion can induce the body to produce high levels of antibody titers, with antibody titers reaching more than 120,000 times. Attached Figure Description
[0019] To more clearly illustrate the embodiments of the present invention, the accompanying drawings involved in the embodiments will be briefly described below.
[0020] Figure 1 The following diagrams show the construction results of the recombinant expression vector for the flagellated protein FljB gene of Salmonella Typhimurium in Example 1 of this invention: A is the PCR result of FljB gene amplification, B is the colony PCR verification electrophoresis diagram of the pET30a-FljB recombinant expression vector, and C is the enzyme digestion electrophoresis diagram of the pET30a-FljB recombinant expression vector. Figure 2 The following are the protein results of Salmonella Typhimurium flagellate protein FljB in Example 1 of the present invention: A is the induced expression result, B is the purified protein, and C is the immunoblotting result. Figure 3 Figures showing the optimized preparation conditions of the sodium caseinate-based Pickering emulsion prepared in Example 1 of this invention are as follows: A is the prepared sodium caseinate-based Pickering emulsion; B is the particle size and PDI results of the Pickering emulsion under different particle concentrations; C is the particle size and PDI results of the Pickering emulsion under different homogenization times; D is the particle size and PDI results of the Pickering emulsion under different homogenization revolutions; E is the particle size and PDI results of the Pickering emulsion under different pH conditions. Figure 4 Figures showing the results of the verification of the type and stability of the sodium caseinate-based pickering emulsion in Example 2 of the present invention: A is the emulsion type analysis diagram, and B is the emulsion stability analysis diagram; Figure 5 Figure 1 shows the results of microstructure observation and rheological property analysis of sodium caseinate-based Pickering emulsion in Example 3 of this invention: A is the observation result of the microstructure of the emulsion, B is the viscosity analysis diagram, and C is the stress frequency scan analysis diagram. Figure 6 This is a graph showing the results of antigen loading efficiency analysis of sodium caseinate-based pickering emulsion in Example 4 of the present invention; Figure 7 This is a graph showing the cytotoxicity test results of sodium caseinate-based pickering emulsion in Example 5 of the present invention; Figure 8 This is a graph showing the effect of sodium caseinate-based pickering emulsion on the phagocytic antigen activity of macrophages in Example 6 of the present invention. Figure 9 This is a magnified image of the inflammatory response at the injection site of mice in the sodium caseinate-based pickering emulsion experimental group of Example 7 of the present invention, taken 200 times, 2 days and 7 days after immunization. Figure 10 This is a pathological section of the major organs of mice in the experimental group of sodium caseinate-based pickering emulsion in Example 8 of the present invention; Figure 11 This is a graph showing the serum OVA-specific antibody titer results of sodium caseinate-based Pickering emulsion in Example 9 of the present invention. Figure 12 This is a flow cytometry result of T lymphocyte subset detection in the spleen of mice in the experimental group of sodium caseinate-based Piccrete emulsion in Example 9 of this invention. Figure 13 The following diagrams illustrate the inoculation process and results of Example 10 of the present invention: A is a flowchart of the inoculation process for the mouse tumor model treatment group, B is a curve of tumor volume growth in the mouse tumor model treatment group, and C is a diagram of the growth of surface tumor volume in the mouse tumor model treatment group. Detailed Implementation
[0021] This invention provides the application of the above-mentioned sodium caseinate-based pickering emulsion as a vaccine adjuvant.
[0022] The present invention will be described in detail below with reference to embodiments. However, the embodiments of the present invention are not limited thereto. Obviously, the embodiments described below are only some embodiments of the present invention. For those skilled in the art, other similar embodiments can be obtained without creative effort and all fall within the protection scope of the present invention. The following mM refers to mmol / L, and sodium caseinate is abbreviated as SCN.
[0023] Example 1 This embodiment provides a preparation process for a sodium caseinate-based Pickering emulsion, as follows.
[0024] S1, constructing Salmonella enteritidis subsp. (Salmonella) Salmonella enteritidis ) Enteritis serotype Salmonella typhimurium ( S.typhimurium(Salmonella enteritidis subspecies enteritidis serotype (Salmonella typhimurium) organism Salmonella enteritidis subspecies enteritidis serotype bacteria; Phylum Pseudomonas; Class Pseudomonas; Gammaproteobacteria; Order Enterobacteriaceae; Family Enterobacteriaceae; Salmonella.) Recombinant expression vector for flagellin: S101, the FljB gene (U17177.1, 1521 bp, base sequence as shown in SEQ ID NO: 1) of *Salmonella typhimurium* (ATCC14280), purchased from Shanghai Lu Microbial Technology Co., Ltd. and preserved in our laboratory, was specifically amplified by PCR. The PCR results of the *Salmonella typhimurium* flagellin FljB gene are as follows: Figure 1 As shown in Figure A.
[0025] S102 was separated by agarose gel electrophoresis and then purified by column purification.
[0026] S103, using the pET-30a prokaryotic expression vector (purchased from Shenyang Xingke Zhonghe Biotechnology Co., Ltd.), and utilizing... Bamh Ⅰ / Xho I. Linearization was completed at the double enzyme cleavage sites.
[0027] S104 was used to achieve the directional ligation of the FljB gene and the vector via T4 DNA ligase (purchased from Shenyang Xingke Zhonghe Biotechnology Co., Ltd.) (mediation conditions: 16 ℃, 16 h).
[0028] S105, the recombinant plasmid, was introduced into BL21-DE3 competent cells via heat shock. BL21-DE3 competent cells were purchased from Beijing TransGen Biotech Co., Ltd.
[0029] S106 was screened for positive clones on LB agar plates containing kanamycin (100 mg / mL). Colony PCR identification was performed using T7 universal primers (purchased from Shenyang Xingke Zhonghe Biotechnology Co., Ltd.). The identification results are as follows: Figure 1 As shown in B, the results indicate that the colonies are the target bacterial groups.
[0030] S107, positive clones were screened on LB agar plates containing kanamycin (100 mg / mL), using... Bamh Ⅰ / Xho I. Perform double enzyme digestion identification, and the identification results are as follows: Figure 1 As shown in Figure C, the results indicate that the FljB gene has been successfully constructed into the pET-30a vector.
[0031] Positive clones were amplified to the logarithmic growth phase (OD 600 = 0.6-0.8) in LB liquid medium, and then expression was tested using both IPTG induction (final concentration 1 mM) and self-induction medium. After induction, the bacterial cells were sonicated (on ice bath), and the supernatant and inclusion body components were separated by centrifugation. Figure 2 A. The inclusion body component showed a specific band at 56 kDa by SDS-PAGE electrophoresis, which was highly consistent with the theoretical molecular weight (56.61 kDa).
[0032] S2, based on the recombinant expression vector, was used to express and purify the flagellin of Salmonella Typhimurium (amino acid sequence as shown in SEQ ID NO: 2).
[0033] S201 was inoculated with 1L of LB medium (1% tryptone, 1% sodium chloride, 0.5% yeast extract) and cultured at 37 °C with shaking at 200 r / min for 5 h. At this point, the expression level of soluble protein reached its peak. Large-scale culture was then carried out based on the optimized conditions.
[0034] Among them, the 37 ℃ and 200 r / min shaking culture conditions are the preferred conditions obtained after expression condition screening.
[0035] S202, soluble recombinant protein was purified using AKTA system nickel column affinity chromatography.
[0036] The entire purification process was strictly maintained at a low temperature of 4°C. Figure 2 As shown in B, the eluted fraction, after being concentrated by ultrafiltration, was exhibited by SDS-PAGE electrophoresis, showing a single specific band at the expected molecular weight position.
[0037] S203, the obtained protein was verified to be the target protein by Western blot experiment.
[0038] The eluted fraction was concentrated by ultrafiltration and then validated by Western blot: Immunoblotting was performed using HRP-labeled anti-His monoclonal antibody (1:5000), as shown below. Figure 2 As shown in Figure C, a specific band appears at the expected molecular weight position, confirming that the obtained protein is the target protein.
[0039] S3, the purified Salmonella typhimurium flagellin was mixed with sodium caseinate at a mass ratio of 1:8 to obtain a mixed solution: The concentration of FljB protein was set to 500 µg / mL, and the resulting mixed solution was the aqueous phase for preparing the emulsion.
[0040] S4, squalene and the mixed solution were homogenized at a volume ratio of 3:2 to obtain a Pickering emulsion: The emulsion was obtained under the following conditions: homogenization at 16,000 rpm, processing time of 2 min, and pH of 8.
[0041] In this emulsion, squalene is used as the oil phase and sodium caseinate is used as the solid particles.
[0042] like Figure 3 As shown in Figure A, it is the prepared sodium caseinate-based Pickering emulsion, abbreviated as PE.
[0043] The preparation and stability of Pickering emulsions are easily affected by various factors such as particle concentration, pH, treatment time, and treatment power. Therefore, different preparation conditions are set to optimize the Pickering emulsion. 1. Particle Concentration Optimization: Particle solutions with the same volume fraction were prepared. The FljB protein concentration in the emulsion was set to 500 µg / mL. Different FljB:SCN ratios were set at 1:1, 1:2, 1:4, 1:8, and 1:16. Squalene oil phase was added at an oil-water ratio of 3:2. Homogenization was performed at 16,000 rpm for 2 min. As the particle concentration increased, the emulsion droplet size gradually decreased. At a FljB protein concentration of 500 µg / mL, emulsion formation was difficult at a FljB:SCN ratio of 1:2. Stable emulsions could be formed at ratios of 1:4, 1:8, and 1:16. Furthermore, the emulsion particle size increased with increasing SCN concentration, decreasing at a ratio of 1:16. Figure 3 As shown in B.
[0044] 2. Processing Time Optimization: Particle suspensions with the same volume fraction and concentration were prepared. Squalene oil phase was added at an oil-to-water ratio of 3:2, and homogenization times were set to 1 min, 2 min, 3 min, and 4 min, respectively. Within a certain range, the emulsion droplet size decreased with increasing time, and the particle size change was as follows: Figure 3 As shown in C, it is also important to note the changes in PDI, which is an important parameter for assessing emulsion stability.
[0045] 3. Processing speed optimization: Particle suspensions with the same volume fraction and concentration were prepared. Squalene oil phase was added at an oil-to-water ratio of 3:2. Homogenization speeds were set to 12,000 rpm, 14,000 rpm, 16,000 rpm, and 20,000 rpm. The time was set to 2 min. Figure 3 D, within a certain range, the emulsion droplet size decreases with increasing homogenization rotation speed, decreasing from 986.6 nm to 719.2 nm.
[0046] 4. pH Optimization: Prepare particle suspensions with the same volume fraction and concentration, and adjust the pH to 5, 6, 7, 8, and 9. Prepare emulsions by adding squalene oil phase at an oil-to-water ratio of 3:2. Homogenize at 16,000 rpm for 2 minutes. Figure 3 E. The emulsion performs best at pH 8, with uniform dispersion and a PDI of 0.2, which is the most suitable pH for emulsion preparation.
[0047] The above experiments demonstrate that an emulsion with smaller particle size and stronger stability can be obtained when the mass ratio of FljB / SCN is 1:8, the rpm is 16,000, the treatment time is 120 s, and the pH is 8.
[0048] SEQ ID NO: 1: atggcacaag taatcaacac taacagtctg tcgctgctga cccagaataa cctgaacaaatcccagtccg cactgggcac cgctatcgag cgtctgtctt ctggtctgcg tatcaacagc gcgaaagacgatgcggcagg tcaggcgatt gctaaccgtt tcaccgcgaa catcaaaggt ctgactcagg cttcccgtaacgctaacgac ggtatctcca ttgcgcagac cactgaaggc gcgctgaacg aaatcaacaa caacctgcagcgtgtgcgtg aactggcggt tcagtctgct aacagcacca actcccagtc tgacctcgac tccatccaggctgaaatcac ccagcgcctg aacgaaatcg accgtgtatc cggccagact cagttcaacg gcgtgaaagtcctggcgcag gacaacaccc tgaccatcca ggttggcgcc aacgacggtg aaactatcga tatcgatctgaagcagatca actctcagac cctgggtctg gactcactga acgtgcagaa agcgtatgat gtgaaagatacagcagtaac aacgaaagct tatgccaata atggtactac actggatgta tcgggtcttg atgatgcagctattaaagcg gctacgggtg gtacgaatgg tacggcttct gtaaccggtg gtgcggttaa atttgacgcagataataaca agtactttgt tactattggt ggctttactg gtgctgatgc cgccaaaaat ggcgattatgaagttaacgt tgctactgac ggtacagtaa cccttgcggc tggcgcaact aaaaccacaa tgcctgctggtgcgacaact aaaacagaag tacaggagtt aaaagataca ccggcagttg tttcagcaga tgctaaaaatgccttaattg ctggcggcgttgacgctacc gatgctaatg gcgctgagtt ggtcaaaatg tcttataccgataaaaatgg taagacaatt gaaggcggtt atgcgcttaa agctggcgat aagtattacg ccgcagattacgatgaagcg acaggagcaa ttaaagctaa aaccacaagt tatactgctg ctgacggcac taccaaaacagcggctaacc aactgggtgg cgtagacggt aaaaccgaag tcgttactat cgacggtaaa acctacaatgccagcaaagc cgctggtcat gatttcaaag cacaaccaga gctggcggaa gcagccgcta aaaccaccgaaaacccgctg cagaaaattg atgccgcgct ggcgcaggtg gatgcgctgc gctctgatct gggtgcggtacaaaaccgtt tcaactctgc tatcaccaac ctgggcaata ccgtaaacaa cctgtctgaa gcgcgtagccgtatcgaaga ttccgactac gcgaccgaag tttccaacat gtctcgcgcg cagattctgc agcaggccggtacttccgtt ctggcgcagg ctaaccaggt cccgcagaac gtgctgtctc tgttacgtta a tgacgctacc gatgctaatg gcgctgagtt ggtcaaaatg tcttataccgataaaaatgg taagacaatt gaaggcggtt atgcgcttaa agctggcgat aagtattacg ccgcagattacgatgaagcg acaggagcaa ttaaagctaa aaccacaagt tatactgctg ctgacggcac taccaaaacagcggctaacc aactgggtgg cgtagacggt aaaaccgaag tcgttactat cgacggtaaa acctacaatgccagcaaagc cgctggtcat gatttcaaag cacaaccaga gctggcggaa gcagccgcta aaaccaccgaaaacccgctg cagaaaattg atgccgcgct ggcgcaggtg gatgcgctgc gctctgatct gggtgcggtacaaaaccgtt tcaactctgc tatcaccaac ctgggcaata ccgtaaacaa cctgtctgaa gcgcgtagccgtatcgaaga ttccgactac gcgaccgaag tttccaacat gtctcgcgcg cagattctgc agcaggccggtacttccgtt ctggcgcagg ctaaccaggt cccgcagaac gtgctgtctc tgttacgtta a (Length 1521) SEQ ID NO: 2: 1 maqvintnsl slltqnnlnk sqsalgtaie rlssglrins akddaagqai anrftanikg 1 maqvintnsl slltqnnlnk sqsalgtaie rlssglrins akddaagqai anrftanikg 61 ltqasrnand gisiaqtteg alneinnnlq rvrelavqsa nstnsqsdld siqaeitqrl 61 ltqasrnand gisiaqtteg alneinnnlq rvrelavqsa nstnsqsdld siqaeitqrl 121 neidrvsgqt qfngvkvlaq dntltiqvga ndgetididl kqinsqtlgl dslnvqkayd 121 neidrvsgqt qfngvkvlaq dntltiqvga ndgetididl kqinsqtlgl dslnvqkayd 181 vkdtavttka yanngttldv sglddaaika atggtngtas vtggavkfda dnnkyfvtig 241 gftgadaakn gdyevnvatd gtvtlaagat kttmpagatt ktevqelkdt pavvsadakn 301 aliaggvdat dangaelvkm sytdkngkti eggyalkagd kyyaadydea tgaikaktts 361 ytaadgttkt aanqlggvdg ktevvtidgk tynaskaagh dfkaqpelae aaakttenpl 421 qkidaalaqv dalrsdlgav qnrfnsaitn lgntvnnlse arsriedsdy atevsnmsra 481 qilqqagtsv laqanqvpqn vlsllr Example 2 This embodiment verifies the type and stability of the sodium caseinate-based pickerling emulsion prepared in Example 1.
[0049] The prepared sodium caseinate-based Pickering emulsion was added to the aqueous and oil phases, respectively, and the results were as follows: Figure 4 As shown in Figure A, the sodium caseinate-based Pickering emulsion is insoluble in the aqueous phase but readily dispersed in the oil phase, thus confirming it as a water-in-oil emulsion.
[0050] Nine portions of the sodium caseinate-based Pickering emulsion were separated and stored at 4°C, 25°C, or 37°C for 45 days, 50 days, or 60 days, respectively.
[0051] The results are as follows Figure 4 As shown in Figure B, the sodium caseinate-based Pickering emulsion exhibits excellent stability and can be stored for extended periods at various temperatures. After 60 days at 4°C, the emulsion remains uniformly cloudy, demonstrating good stability. After 45 days at 25°C, a small amount of stratification appears on the upper layer of the emulsion, but it is not visually noticeable. After 45 days at 37°C, the emulsion remains uniformly cloudy without any stratification.
[0052] Example 3 This embodiment verifies the microstructure and rheological properties of the sodium caseinate-based Pickering emulsion prepared in Example 1.
[0053] The interfacial structure of the emulsion was observed using laser confocal microscopy, and the sample was stained with Nile Red (0.1%) fluorescent dye. The stained sample was placed on a slide of the laser confocal microscope. Squalene was stained with Nile Red, and Nile Red was excited at 488 nm. Figure 5 As shown in Figure A, the continuous squalane phase labeled with oil-soluble Nile Red dye exhibits a characteristic red fluorescence signal, while the dispersed phase droplets maintain a regular spherical structure. Based on the oil-water two-phase distribution characteristics and droplet morphology parameters, it can be clearly determined that this emulsion belongs to a W / O (water-in-oil) system.
[0054] In rheological property testing, the emulsion exhibited a significant decreasing trend in apparent viscosity with increasing logarithmic shear rate. Figure 5 (BC), this pseudoplastic fluid behavior conforms to the characteristics of a non-Newtonian fluid. Furthermore, the dynamic stress scan diagram of the Pickering emulsion shows that the storage modulus (G') of the Pickering emulsion is higher than the loss modulus (G''), and the higher the particle concentration, the higher both the storage modulus (G') and the loss modulus (G'').
[0055] Example 4 This embodiment verifies the antigen loading efficiency of the sodium caseinate-based pickering emulsion prepared in Example 1.
[0056] Ovalbumin (OVA) was selected as the model antigen. 100 μg of OVA was added to 1 mL of freshly prepared Pickering emulsion, and the mixture was incubated overnight at 4 °C using a vertical suspension apparatus. Unbound antigens were separated using ultrafiltration. To eliminate antigen loss due to non-specific adsorption of the membrane material during ultrafiltration, a blank antigen control system was prepared using the same ultrafiltration process. Quantitative detection was performed using the BCA method, with absorbance measured at 562 nm using a microplate reader. By comparing the antigen concentration difference between the experimental and control groups, a membrane adsorption correction model was constructed to accurately calculate the actual antigen load. Figure 6 As shown, the encapsulation efficiency of the sodium caseinate-based Pickering emulsion system for ovalbumin (OVA) reached 91.5%.
[0057] Example 5 This embodiment verifies the cell safety of the sodium caseinate-based pickering emulsion prepared in Example 1.
[0058] This study used the CCK-8 colorimetric method to systematically evaluate the cytotoxic effects of experimental materials (PE). Based on the positive correlation between mitochondrial dehydrogenase activity and the colorimetric intensity of formazan dye, cell proliferation status was indirectly characterized through colorimetric quantification, thereby accurately quantifying the inhibitory effect of the test substance on cell viability. The specific experimental protocol was implemented according to the following standardized procedure: (1) Cell pretreatment: RAW 264.7 mononuclear macrophages (purchased from Shenyang Xingke Zhonghe Biotechnology Co., Ltd.) were cultured until fully adherent. After digestion with 0.25% trypsin, a single-cell suspension was prepared, and the cell density was adjusted to 5×10⁶ cells using an automated cell counter. 5 cells / mL.
[0059] (2) Cell seeding and drug administration: Experimental and control groups were partitioned within a 96-well plate using an electronic pipette, with 50 μL of cell suspension precisely seeded in each well. The experimental groups were supplemented with 50 μL / well of complete culture medium containing gradient concentrations of the test substance, while the control groups received an equal volume of blank culture medium. To eliminate edge effects, the outer wells were uniformly filled with 200 μL of PBS buffer as evaporation compensation.
[0060] (3) Cell incubation: The culture plate was transferred to a constant temperature incubator (37 ℃, 5% CO2) for 24 h of continuous incubation to ensure that the cells and the test substance interact fully.
[0061] (4) Addition of test reagent: 10 μL of CCK-8 colorimetric reagent is precisely injected into each well using reverse addition technique. The pipette tip is kept submerged in the liquid throughout the operation to strictly avoid the formation of air bubbles, so as to eliminate the interference of optical path difference on absorbance detection.
[0062] (5) Color development and detection: After incubation for another 3 h, the optical density (OD value) was measured at a characteristic wavelength of 450 nm using a SpectraMax M5 multifunctional enzyme-linked immunosorbent assay (ELISA) reader. The cytotoxic effect was quantitatively characterized by cell viability (Vc). Cell viability was negatively correlated with cytotoxicity; that is, a higher Vc value indicated lower cytotoxicity of the test substance.
[0063] like Figure 7 As shown, within a concentration range of 100 μg / mL, the survival rate of RAW 264.7 cells treated with sodium caseinate-based Pickering emulsion remained at 83%, indicating good cell safety.
[0064] Example 6 This embodiment verifies the effect of the sodium caseinate-based pickering emulsion prepared in Example 1 on the phagocytic activity of macrophages against antigens.
[0065] First, bovine serum albumin (BSA) was labeled using FITC. After dissolving BSA in carbonate buffer (CBS), FITC dye dissolved in dimethyl sulfoxide (DMSO) was added to the BSA solution with continuous stirring. The mixture was stirred overnight at 4 °C, and then dialyzed against the labeled BSA solution with phosphate-buffered saline (PBS) for 72 h. The reaction mixture was then removed from the dialysis bag and centrifuged. The supernatant was collected as the ready-to-label BSA solution and stored at -20 °C for later use.
[0066] DC 2.4 cells in the logarithmic growth phase were injected with 1.0 × 10⁻⁶ cells. 6 Cells / well were seeded in 12-well plates and cultured overnight in a cell culture incubator at 37 °C and 5% CO2. Then, according to the experimental design, BSA vaccine adjuvant labeled with FITC dye was added, and the cells were cultured for another 5 h in a cell culture incubator.
[0067] Cells were then washed with cold PBS to terminate endocytosis. After centrifugation at 800 × g for 10 min, cells were collected into 1.5 mL centrifuge tubes, resuspended in PBS, and antigen uptake was detected by flow cytometry.
[0068] Simultaneously, cells from each experimental group were aspirated and placed on glass slides. After drying in a clean bench, the cells were rinsed twice with PBS buffer, followed by fixation with 4% paraformaldehyde for 20 min. The cells were then rinsed twice more with PBS, stained with Dapi staining solution at room temperature in the dark, and incubated for 3 min. Finally, the staining was terminated by rinsing three more times with PBS, and the slides were mounted with anti-fluorescence quenching mounting medium and observed using a laser confocal fluorescence microscope.
[0069] like Figure 8 As shown, isolated BSA is rarely endocytosed by macrophages, and flow cytometry results also show low intracellular fluorescence intensity. Flow cytometry analysis of the PE group showed high intracellular fluorescence intensity, and strong green fluorescence was observed both intracellularly and on the cell surface using laser confocal microscopy. This indicates that PE can promote the phagocytosis of antigens by macrophages.
[0070] Example 7 This embodiment verifies the tissue compatibility of the sodium caseinate-based Pickering emulsion prepared in Example 1.
[0071] Using PBS (phosphate-buffered saline, 0.01 M phosphate solution) as the control group and the commercially available oil adjuvant ISA206 as the reference group, 100 μL of Pickering emulsion (PE) and ISA206 were injected into the medial thigh muscles of mice. At each time point, the corresponding groups of experimental animals were sacrificed, and the quadriceps femoris muscle tissue blocks from the injection site were separated and immediately fixed in 4% tissue fixative. Subsequently, H&E staining was performed, and the degree of inflammatory cell infiltration was assessed under a microscope, focusing on typical inflammatory response features such as neutrophil aggregation and tissue edema. Figure 9 As shown, both the PE+OVA group and the ISA 206+OVA group produced inflammatory responses, but the PE group showed better tissue repair than the ISA 206 group in terms of the resolution of the inflammatory response, confirming its good tissue compatibility.
[0072] Example 8 This embodiment verifies the biocompatibility of the sodium caseinate-based Pickering emulsion prepared in Example 1.
[0073] Using PBS as the control group and the commercially available oil adjuvant ISA206 as the reference group, 100 μL of Pickering emulsion (PE) and ISA206 were injected intramuscularly into the medial thigh of mice on days 0 and 14, respectively. Pathological changes in the tissues and organs of the mice in each group were observed. The experimental results confirmed that, as Figure 10 As shown, no inflammatory cell infiltration or abnormal tissue structure was observed in the heart, liver, spleen, and other important organs of the experimental group mice, indicating that the Pickering emulsion system has excellent biocompatibility.
[0074] Example 9 This embodiment verifies the humoral immune effect of the sodium caseinate-based pickering emulsion prepared in Example 1.
[0075] In terms of immune effect assessment, a multidimensional experimental approach was used to reveal the immune activation mechanism of PE. First, BSA was labeled with FITC. After dissolving BSA in carbonate buffer (CBS), 2 mg of BSA protein was dissolved in 1 mL of CBS buffer (pH 9.3). Then, 0.2 mg of fluorescent isothiocyanate (FITC) was dissolved in 1 mL of DMSO. The FITC solution was slowly added to the protein solution while continuously stirring. After stirring overnight at 4 °C, the labeled BSA solution was dialyzed against phosphate-buffered saline (PBS) for 72 h. The reaction mixture was then removed from the dialysis bag and centrifuged. The supernatant was collected as the labelable BSA solution and stored at -20 °C for later use. DC 2.4 cells in logarithmic growth phase (purchased from Shenyang Xingke Zhonghe Biotechnology Co., Ltd.) were incubated at 1.0 × 10⁶ cells / year.6 Cells were seeded per well in 12-well plates and cultured overnight at 37 °C with 5% CO2. Then, according to the experimental design, PBS (blank group), BSA labeled with Fitc dye (free BSA group), and BSA vaccine adjuvant labeled with Fitc dye (PE group) were added, and the cells were cultured for another 5 h. Cells were then washed with ice-cold PBS to terminate endocytosis. After centrifugation at 800 g for 10 min, cells were collected into 1.5 mL centrifuge tubes, resuspended in PBS, and antigen uptake was detected using flow cytometry. Flow cytometry analysis showed that the antigen endocytosis efficiency of RAW 264.7 macrophages in the PE group (loaded with bovine serum albumin (BSA) was significantly higher than that in the free BSA group.
[0076] For humoral immunity, BALB / c mice (6-8 weeks old, female) were randomly divided into groups of 6. After purchase, they were housed in a clean room to acclimatize for 3-5 days, with sufficient food and water provided daily, before the immunization experiment. Immunization was performed via intramuscular injection into the leg, with 100 µL injected into the hind leg of each mouse on days 0 and 14 (50 µL in each leg), as shown in Table 1.
[0077] Table 1 is the group evaluation table for animal experiments: FljB in the table refers to FljB protein.
[0078]
[0079] For immunized mice, blood was collected from the orbital vein on days 21, 28, and 35, and the serum was separated to determine the titer of OVA-specific antibodies. Figure 11 As shown, ELISA test data showed that the serum IgG titers in the PE+OVA group were the same as those in the ISA 206+OVA group at 21, 28 and 35 days, indicating that PE has a good humoral immune effect.
[0080] Cellular immunoassay revealed the regulatory effect of PE agents on T lymphocyte subsets. For example... Figure 12 As shown, flow cytometry analysis revealed that, compared to the PBS group, mice inoculated with PE loaded with OVA showed a significant increase in CD3+, CD4+, and CD8+ T lymphocytes, preliminarily indicating that PE can stimulate humoral and cellular immunity. This suggests that PE primarily enhances immune function by regulating the CD4+ T lymphocyte population.
[0081] Example 10 This embodiment simulates a challenge experiment to evaluate the effect of adjuvants. The specific process is as follows.
[0082] A therapeutic tumor challenge model was established by first inoculating the tumor cells and then immunizing the mice. Twenty 5-7 week old C57BL / 6 mice were selected and divided into four groups: PBS group, PBS+OVA group, ISA 206+OVA group, and PE+OVA group. E.G7-OVA (CTCC-001-0136) lymphoma cells were inoculated into the midline of the left rib and forelimb of the mice at a dose of 1×10⁻⁶. 6 Each tumor was individually measured, and its length and width were then measured daily using calipers. The data were recorded, and the tumor size was calculated using the following formula: Tumor volume (mm) 3 )= When the tumor grows to 75 mm 3 Then the mice were vaccinated, such as Figure 13 As shown in (A), the inoculation method was intramuscular injection into the inner thigh of mice, with an inoculation volume of 20 μg OVA antigen per mouse and a dose of 100 μL per mouse. Tumor volume was continuously recorded after inoculation, and tumor growth data were collected to plot a tumor growth curve. The tumor volume reached 2000 mm². 3 The mice were then marked as dead. An autopsy was performed, the mice were euthanized by dislocation of the neck, the skin was cut along the shape of the tumor, and the skin and tumor were removed together using ophthalmic scissors and forceps. The skin was then thoroughly cleaned, rinsed with saline, and representative tumors from each group were arranged from largest to smallest and placed on a ruler for photographic recording.
[0083] like Figure 13 As shown in (B) and (C), the results indicate that the treatment group can significantly inhibit tumor growth (P < 0.01) and improve the survival rate of mice.
[0084] In summary, this invention leverages the excellent immune adjuvant effect of flagellin and combines it with the good biocompatibility and sustained-release properties of pickering. Flagellin FljB and sodium caseinate are used as solid particles to stabilize pickering emulsions, and a stable pickering emulsion is formulated. The feasibility of flagellin adjuvants is studied through physicochemical property testing, cell and animal experiments, etc. This provides a good reference for exploring the adjuvant effects of flagellin and also provides a theoretical basis for further development of flagellin adjuvant products.
[0085] This invention successfully prepared a stable FljB-Cas Pickering emulsion from nanoparticles using a homogenization method, and various indicators were tested. Finally, animal experiments verified that the prepared emulsion could induce high levels of humoral and cellular immunity, while exhibiting good biocompatibility and injection safety, confirming that the emulsion prepared using flagellin and sodium caseinate can serve as a candidate adjuvant for vaccines.
[0086] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A sodium caseinate-based Pickering emulsion, characterized in that, A mixed solution of Salmonella typhimurium flagellin and sodium caseinate in a mass ratio of 1:8 was used as the aqueous phase, sodium caseinate was used as solid particles, and squalene was used as the oil phase.
2. The sodium caseinate-based Pickering emulsion according to claim 1, characterized in that, The concentration of flagellin in the Salmonella Typhimurium was set at 500 µg / mL.
3. The sodium caseinate-based Pickering emulsion according to claim 1, characterized in that, The pH of the Pickering emulsion is 8.
4. A method for preparing a sodium caseinate-based Pickering emulsion as described in any one of claims 1 to 3, characterized in that, Includes the following steps: S1, Construct the recombinant expression vector of the flagellated protein of Salmonella Typhimurium; S2, based on the recombinant expression vector, express and purify the flagellated protein of Salmonella Typhimurium; S3, the purified Salmonella typhimurium flagellin and sodium caseinate were mixed at a mass ratio of 1:8 to obtain a mixed solution; S4, the squalene and the mixed solution are homogenized at a volume ratio of 3:2 to obtain the Pickering emulsion.
5. The method for preparing a sodium caseinate-based Pickering emulsion according to claim 4, characterized in that, S1 includes the following steps: S101, the FljB gene of Salmonella Typhimurium was specifically amplified by PCR technology; S102 was separated by agarose gel electrophoresis and then purified by column purification. S103, selected the pET-30a prokaryotic expression vector, and utilized... Bamh Ⅰ / Xho I. Linearization treatment was completed at the double enzyme restriction sites; S104, through T4 DNA ligase-mediated directional ligation of the FljB gene and the vector; S105, the recombinant plasmid was introduced into BL21-DE3 competent cells via heat shock; S106 was screened for positive clones on LB agar plates containing kanamycin, and colony PCR was performed using T7 universal primers for identification. Bamh Ⅰ / Xho I. Perform double enzyme digestion identification.
6. The method for preparing a sodium caseinate-based Pickering emulsion according to claim 4, characterized in that, S2 includes the following steps: S201, the recombinant expression vector was cultured for 5 h under the conditions of 37 ℃ and 200 r / min shaking culture; S202, soluble recombinant protein was purified using AKTA system nickel column affinity chromatography; S203, the obtained protein was verified as the target protein by Western blot.
7. A method for preparing a sodium caseinate-based Pickering emulsion according to claim 4, characterized in that, The homogenization conditions were 16,000 rpm for 2 minutes.
8. The use of a sodium caseinate-based pickering emulsion as described in any one of claims 1 to 3 in the preparation of vaccine adjuvants.
9. The use of a sodium caseinate-based pickering emulsion as described in any one of claims 1 to 3 in the preparation of vaccines.