Recombinant escherichia coli for producing l-tryptophan and application thereof
By metabolically engineering Escherichia coli W3110, overexpressing the trpBA gene, and combining UV and DES mutagenesis screening with tryptophan tolerance training, a recombinant Escherichia coli hhTRp005 with high yield and high conversion rate was bred, solving the problems of low acid production and low conversion rate, and realizing efficient L-tryptophan production.
Patent Information
- Application Number
- CN202411747043.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-02
- Publication Date
- 2026-06-02
AI Technical Summary
In the existing technology, the mainstream E. coli engineered bacteria that produce tryptophan in the domestic market have problems with low acid production and sugar-acid conversion rate, which limits the market competitiveness of tryptophan in my country.
By modifying Escherichia coli W3110 through metabolic engineering, overexpressing the trpBA gene, and supplementing it with UV and DES mutagenesis screening and tryptophan tolerance training, a recombinant Escherichia coli hhTRp005 with high yield and high conversion rate was bred.
The yield of L-tryptophan reached 58 g/L, and the sugar-acid conversion rate reached 32%, showing good prospects for industrial application.
Smart Images

Figure CN122128191A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a recombinant Escherichia coli that produces L-tryptophan and its applications. Background Technology
[0002] L-Tryptophan (L-TRP) plays a vital role in the growth, development, and metabolism of humans and animals, and is known as the second essential amino acid. It has wide applications in medicine, food, and animal feed. In medicine, L-Tryptophan can synthesize hormones such as serotonin, as well as physiologically active substances such as pigments, alkaloids, coenzymes, and plant hormones, thus preventing and treating pellagra. As an aromatic amino acid, L-Tryptophan has the characteristic of deriving other biologically active substances. It is a precursor to neurotransmitters and hormones, participating in the regulation of neurophysiological activities in animals. In the UK, L-Tryptophan is listed as an antidepressant. Disorders of L-Tryptophan metabolism may cause diabetes and neurological disorders; therefore, amino acid injections or compound amino acid preparations made primarily of L-Tryptophan are commonly used in medicine to treat diabetes, neurological disorders, and niacin deficiency. In the food and animal feed industries, L-Tryptophan can be used as a nutritional supplement for humans, a nutritional supplement for pregnant women, a special formula for infants, and an antioxidant. In addition, the use of L-tryptophan fortified foods and as a feed additive plays an important role in improving the utilization rate of plant protein. As a feed additive, L-tryptophan can promote animal feed intake, reduce stress response, improve animal sleep, increase antibodies in fetuses and young animals, increase milk production in dairy animals, and reduce the amount of high-quality protein in the diet, thereby saving feed costs.
[0003] In traditional industry, L-tryptophan is mainly produced through chemical synthesis, biotransformation, and enzymatic conversion. Currently, microbial fermentation has become the primary method for industrial L-tryptophan production due to its low cost and environmental friendliness. Selecting high-yield, high-efficiency, and stable strains is crucial for improving fermentation efficiency. Traditional strain selection primarily employs natural screening and mutagenesis screening methods, obtaining producing strains from nature or artificially mutagenesizing existing strains to obtain target strains. This traditional method is inefficient and requires significant manpower and resources. With the development of gene modification technology, metabolic engineering is widely used in the modification of industrial strains. This mainly utilizes DNA recombination, CRISPR / Cas9-mediated gene editing, and other technologies to rationally design and modify cellular metabolic pathways to improve product synthesis capabilities. *Escherichia coli* possesses characteristics such as a clear genetic background, convenient gene manipulation, rapid growth and reproduction, and ease of scale-up, making it an excellent starting strain in the field of microbial fermentation. Currently, the mainstream engineered *E. coli* strains producing tryptophan in the domestic market suffer from low acid production and sugar-acid conversion rates (around 20%), significantly limiting the market competitiveness of tryptophan in my country. Summary of the Invention
[0004] To address the shortcomings of the existing technologies, this invention, from the perspective of metabolic engineering, rationally designs metabolic pathways, reasonably modifies related genes to improve tryptophan synthesis capacity, and supplements this with ultraviolet and DES mutagenesis screening and tryptophan tolerance domestication to breed recombinant Escherichia coli with high yield and conversion rate of L-tryptophan.
[0005] In a first aspect, the present invention provides a recombinant Escherichia coli that produces L-tryptophan, classified as Escherichia coli, strain number hhTRp005, which was deposited at the China Center for Type Culture Collection (CCTCC) on March 18, 2024, with accession number CCTCC NO:M2024517.
[0006] Furthermore, the recombinant Escherichia coli uses Escherichia coli W3110 as the starting strain and overexpresses the structural gene trpBA in the tryptophan operon.
[0007] Furthermore, using Escherichia coli W3110 as the starting strain, the trpBA gene was overexpressed at the yjiV pseudogene site.
[0008] Furthermore, a strong promoter was used to regulate the overexpression of the trpBA gene.
[0009] Furthermore, the strong promoter is a trc promoter, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0010] Furthermore, the trpBA gene is derived from Escherichia coli W3110, and its nucleotide sequence is shown in SEQ ID NO.2, and its amino acid sequence is shown in SEQ ID NO.3.
[0011] Furthermore, the method for introducing the trpBA gene into the starting strain includes, but is not limited to, genetic engineering techniques familiar to those skilled in the art, such as introducing the starting strain through homologous recombination, expression vectors, or gene editing.
[0012] Specifically, the trpBA gene was introduced into E. coli W3110 using CRISPR / Cas9 gene editing technology, and the integration of the trpBA gene into the yjiV pseudogene site was controlled by the trc promoter.
[0013] A second aspect of the invention provides the use of the L-tryptophan-producing recombinant Escherichia coli in at least one of the following:
[0014] A) Production of L-tryptophan;
[0015] B) Increase L-tryptophan production and / or sugar-acid conversion rate.
[0016] In one embodiment of the present invention, the L-tryptophan yield is 58 g / L and the sugar-acid conversion rate reaches 32%.
[0017] A third aspect of the present invention provides a method for producing L-tryptophan, comprising: inoculating the L-tryptophan-producing recombinant Escherichia coli into a fermentation medium and culturing it with shaking and aeration.
[0018] Furthermore, during the fermentation process, dissolved oxygen is controlled at 30%-50%.
[0019] Further, the fermentation medium comprises the following components: 10-15 g / L glucose, 0.1-0.2 g / L indole, 0.1-1.0 g / L K₂HPO₄, 0.1-1.0 g / L KH₂PO₄, 0.1-0.2 g / L MgSO₄·7H₂O, 2-6 mg / L FeSO₄·7H₂O, 2-6 mg / L MnSO₄, pH 6.8-7.2.
[0020] Furthermore, the dissolved oxygen control method is as follows: when the glucose in the fermentation medium is depleted, dissolved oxygen is replenished in a linked manner, and the replenished material is glucose.
[0021] Furthermore, during the cultivation process, the ventilation rate is 1-2 vvm, and the stirring speed is 300-900 prm.
[0022] Compared with the prior art, the present invention has the following beneficial technical effects:
[0023] This invention optimizes the metabolic flux related to tryptophan synthesis in Escherichia coli W3110 by overexpressing the trpBA gene, thereby increasing tryptophan production. With the assistance of UV and DES mutagenesis screening and tryptophan tolerance training, a genetically stable recombinant Escherichia coli producing L-tryptophan with high tryptophan production and sugar-acid conversion rate was bred. Through 5L tank fermentation, the L-tryptophan production can reach 58g / L with a conversion rate of 32%, showing good prospects for industrial application. Attached Figure Description
[0024] Figure 1 The image shows the fermentation results of Escherichia coli hhTRp5 in Example 6. Detailed Implementation
[0025] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available.
[0027] 1. Information on the culture media, reagents, and biological materials used in the following examples is as follows:
[0028] LB liquid medium: yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L;
[0029] LB agar: yeast extract 5g / L, peptone 10g / L, sodium chloride 10g / L, agar 20g / L.
[0030] Shake-flask screening medium: glucose 10 g / L, ammonium sulfate 0.4 g / L, yeast extract 0.5 g / L, corn steep liquor 2 g / L, indole 0.1 g / L, K2HPO4 2.0 g / L, KH2PO4 0.5 g / L, MgSO4·7H2O 0.5 g / L, FeSO4·7H2O 8 mg / L, MnSO4 8 mg / L, pH 7.2.
[0031] Product acclimatization culture medium: L-tryptophan 3g / L, glucose 15g / L, ammonium sulfate 0.4g / L, yeast extract 0.5g / L, corn steep liquor 2g / L, indole 0.1g / L, K2HPO4 2.0g / L, KH2PO4 0.5g / L, MgSO4·7H2O 0.5g / L, FeSO4·7H2O 8mg / L, MnSO4 8mg / L, pH 7.2.
[0032] Product acclimatization plate: L-tryptophan 3g / L, glucose 15g / L, ammonium sulfate 0.4g / L, yeast extract 0.5g / L, corn steep liquor 2g / L, indole 0.1g / L, K2HPO4 2.0g / L, KH2PO4 0.5g / L, MgSO4·7H2O 0.5g / L, FeSO4·7H2O 8mg / L, MnSO4 8mg / L, agar 20g / L, pH 7.2.
[0033] The fermentation medium consisted of: glucose 10 g / L, indole 0.1 g / L, K2HPO4 0.5 g / L, KH2PO4 0.5 g / L, MgSO4·7H2O 0.2 g / L, FeSO4·7H2O 4 mg / L, MnSO4 4 mg / L, and pH 7.2.
[0034] Escherichia coli 3110, purchased from BioBio Biotechnology, catalog number BIO-82057.
[0035] 2×Phanta Flash Master Mix, purchased from Vazyme, product number: P510.
[0036] 2. The primers used in the following examples are shown in Table 1.
[0037] Table 1: Primers used in this invention
[0038] Serial Number sequence name Sequence information Sequence 1 yjiV-sg AAAAGGGCAAACTAGTCCAG Sequence 2 PAMyjiV-F TAATACTAGTAAAAGGGCAAACTAGTCCAGGTTTTAGAGCTAGAAATAGC Sequence 3 PAMyjiV-R GCTCTAAAACCTGGACTAGTTTGCCCTTTTACTAGTATTATACCTAGGAC Sequence 4 yjiV-Up-F CCGAGTCGGTGCTTTTTTTGAATTCTGTGAAGGGATGTCAGGACG Sequence 5 yjiV-Up-R GAGCCGGATGATTAATTGTCAAATTACAGAATGCAACTTCGTATAC Sequence 6 yjiV-Dn-F CGAATTACCGGCGTTCACTATA Sequence 7 yjiV-Dn-R CAGGGTAATAGATCTAAGCTTTCACCTCCACCAGCACATCCG Sequence 8 trpBA-F TTTCACACAGGAAACAGACCATGACAACATTACTTAACCCCTATTTTG Sequence 9 trpBA-R TAGTGAACCGCCGGTAATTCGAACTGGCGGCTGTGGGAT Sequence 10 trpBA-VF GCTGGTTTTGATGGCCAATC Sequence 11 trpBA-VR GCTTGTGTACCGTCAATTTAGGTC
[0039] 3. The detection methods involved in the following embodiments:
[0040] (1) Glucose concentration determination: Centrifuge the fermentation broth at 12000 rpm for 5 min and take the supernatant. Dilute the supernatant to an appropriate ratio and use an M-100 biosensor analyzer to detect the glucose concentration in the fermentation broth.
[0041] (2) L-Tryptophan Concentration Determination: The L-Tryptophan content in the fermentation broth was determined by high performance liquid chromatography (HPLC). The detection method was as follows:
[0042] S1. Prepare a 1 g / L L-tryptophan standard solution, and dilute it to 0.1, 0.2, 0.3, 0.4, and 0.5 g / L. Detect the solutions using high-performance liquid chromatography (HPLC) to obtain the peak time and peak area corresponding to different concentrations of L-tryptophan. Plot a standard curve with the concentration of L-tryptophan solution on the x-axis and the peak area on the y-axis to obtain a linear regression equation. The peak time of the L-tryptophan standard (purchased from Aladdin, CAS number: 73-22-3) was approximately 11.9 min.
[0043] S2. Centrifuge the fermentation broth at 12000 rpm for 5 min and collect the supernatant. Dilute the supernatant to an appropriate ratio and filter it through a 0.22 μm filter membrane. Collect the filtrate. Detect the filtrate using HPLC. Substitute the obtained peak area into the linear regression equation. Multiply the obtained L-tryptophan concentration by the dilution factor to obtain the L-tryptophan concentration in the fermentation broth.
[0044] The HPLC detection conditions were as follows: instrument: Agilent HPLC 1260-VWD; column: Agilent TC-C18 column, 250*4.6mm, 5μm; mobile phase: 0.03% KH2PO4: pure methanol (v / v) = 9:1; column temperature: 39℃; flow rate: 1mL / min; UV detector, wavelength 276nm; injection volume: 20μL.
[0045] (3) Conversion rate = (L-tryptophan concentration in the lower fermentation broth * volume of the lower fermentation broth / total glucose consumption) * 100%
[0046] (4) The gene editing method used in this invention is based on the literature ([1] Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing[J]. Metabolic engineering, 2015(31-):31.DOI:10.1016 / j.ymben.2015.06.006.).
[0047] (5) The present invention selects high-yielding strains of L-tryptophan using the following method:
[0048] ① Constructing high-tryptophan-producing genetically engineered bacteria: Using wild-type Escherichia coli 3110 as the starting strain, the tryptophan synthesis pathway was strengthened, specifically including: integrating the trpBA gene at the pseudogene site yjiV and strengthening transcription with the Ptrc promoter; and screening for high-transformation-rate tryptophan-producing genetically engineered bacteria by shake-flask fermentation.
[0049] ②Ultraviolet mutagenesis + DES mutagenesis to select dominant mutant strains that produce tryptophan.
[0050] ③ Domestication of product tolerance, and selection of dominant strains that produce high levels of tryptophan.
[0051] ④ Strain re-screening + scale-up culture verification, selection of superior strains for institutional preservation.
[0052] Example 1: Construction of genetically engineered bacteria producing L-tryptophan
[0053] The tryptophan operon is an important operon, one of the elements used to encode tryptophan production. The structural genes of the tryptophan operon are arranged sequentially as trpEDCBA, where the trpBA gene encodes two subunits of tryptophan synthase, TrpB and TrpA. These two subunits combine to form a fully functional enzyme, tryptophan synthase, which plays a crucial role in the final step of the tryptophan biosynthesis pathway in organisms, catalyzing the reaction of indole-3-sugar phosphate and serine to produce tryptophan. Therefore, to confer or enhance L-tryptophan production capacity, genetic engineering techniques were used to modify *E. coli*, including overexpressing the trpBA gene in *E. coli* 3110.
[0054] In this embodiment, *E. coli* 3110 was used as the starting bacterium, and the strong promoter Ptrc was used to regulate trpBA overexpression at the pseudogene site yjiV. The strong promoter Ptrc was cloned from plasmid pTrc99a, and its nucleotide sequence is shown in SEQ ID NO. 1 of the sequence listing. The trpBA gene was derived from *E. coli* W3110 (the chassis itself), and its nucleotide sequence is shown in SEQ ID NO. 2 of the sequence listing. The specific operation method is as follows:
[0055] (1) The gRNA of the yjiV gene was designed and ligated into the plasmid pGRB for gene editing. The effective sg sequence (yjiV-sg) is shown in Sequence 1 of Table 1. Amplification was performed using Vazyme 2×Phanta Flash Master Mix under the following conditions: 98℃ for 5 min; 98℃ for 10 s; 57℃ for 25 s; 72℃ for 5 s, 30 cycles; 72℃ for 5 min; and stored at 4℃. The amplification primers used were PAMyjiV-F and PAMyjiV-R.
[0056] (2) Using the Escherichia coli W3110 genome as a template, the upstream homologous arm, downstream homologous arm, and trpBA gene fragment (containing Ptrc) were amplified using primer pairs yjiV-Up-F / yjiV-Up-R, yjiV-Dn-F / yjiV-Dn-R, and trpBA-F / trpBA-R, respectively. Amplification was performed using Vazyme 2×Phanta Flash Master Mix under the following conditions: 98℃ for 5 min; 98℃ for 10 s; 57℃ for 25 s; 72℃ for 5 s, 30 cycles; 72℃ for 5 min; and stored at 4℃.
[0057] (3) Use The HiFi DNA Assembly Master Mix was used to ligate the upstream homologous arm, downstream homologous arm, and trpBA gene fragment (containing Ptrc) with the pGRB vector (containing gRNA). The resulting recombinant vector was transformed into E. coli Top10 competent cells. The transformed recombinant E. coli were plated on LB plates containing spectinomycin hydrochloride (50 mg / mL) and incubated upside down at 37°C for 12-16 h. Single colonies were then selected, and plasmids were extracted from correctly sequenced transformants and transformed into E. coli 3110 to obtain recombinant E. coli TRP, namely E. coli 3110, yjiV::Ptrc-trpBA. The primers used to verify the completion of the above gene editing were trpBA-VF and trpBA-VR.
[0058] (4) The positive clones that had successfully undergone gene editing were inoculated into 10 mL of LB liquid medium, and 10 μL of IPTG was added and incubated overnight at 42°C. 10 μL of the culture was streaked onto antibiotic-free LB plates and incubated overnight at 30°C. Single colonies were then picked from the antibiotic-free LB plates and spotted onto LB plates containing kanamycin (50 mg / mL) and spectinomycin hydrochloride (50 mg / mL), respectively. No single colonies grew on either type of plate, indicating that the Pcas plasmid and pGRB plasmid had been completely eliminated. Finally, a plasmid-free recombinant Escherichia coli TRP-producing bacterium overexpressing trpBA was obtained.
[0059] Example 2: Selection of dominant chassis strains producing L-tryptophan
[0060] The L-tryptophan-producing chassis strain TRP was plated onto LB agar plates and cultured at 35°C for 16 h. Six single colonies with good biological morphology were selected and inoculated into shake-flask selection medium and cultured with shaking at 34°C for 16 h. The resulting fermentation broth was centrifuged, and the supernatant was collected. The L-tryptophan content in the fermentation broth was detected by HPLC, the conversion rate was calculated, and the high-conversion-rate genetically engineered strain TRP-4 producing L-tryptophan was selected.
[0061] Example 3: UV mutagenesis + DES mutagenesis screening
[0062] The dominant L-tryptophan-producing strain TRP-4 was inoculated into LB liquid medium and cultured with shaking at 35°C and 200 rpm for 16 h to induce the colonies into the logarithmic growth phase. After reaching the logarithmic growth phase, the bacterial suspension was diluted to 10⁻⁶. 3 A gradient of bacterial counts / mL was created and spread onto LB agar plates. The plates were first irradiated with UV light for 20 seconds at a distance of 30 cm, then the UV light was turned off. The plates were then wrapped and frozen at -35°C for 2 hours, followed by incubation at 34°C in the dark for 46 hours. The best-growing colonies were selected and subcultured for five generations to determine L-tryptophan production and genetic stability. The UV-mutated bacterial solution was then mixed with 1% (v / v) DES and diluted to 10⁻⁶. 3 The bacterial culture was carried out at a gradient of 1000 / mL with shaking at 32℃ for a period of time to eliminate the physiological delay phenomenon. At 40 min, 2% NaS2O3 was added to terminate the reaction. The culture was then spread onto LB plates and incubated in a 34℃ incubator under dark conditions for 48 h. The best-growing colonies were selected for subculturing, and a total of 5 generations were carried out. The genetically stable strains were inoculated into selection medium and cultured in shake flasks. The L-tryptophan production was then detected, and the dominant strain with high conversion rate, TRPM-2, was selected.
[0063] The screening medium used in this embodiment is the same as the shake flask screening medium used in Example 2.
[0064] Example 4: Product tolerance acclimatization
[0065] The dominant mutant TRPM-2 was inoculated into the product acclimatization medium for product tolerance acclimatization and cultured at 35°C for 24 h. It was then transferred 10 times at an inoculation rate of 1%. The inoculation was then spread onto the product acclimatization plate and cultured at 35°C for 16 h. Single colonies were picked and inoculated into the screening medium (the same as the shake flask screening medium used in Example 2) and cultured at 35°C for 24 h. Five strains with high bacterial concentrations were selected as qualified acclimatization strains and kept for re-screening.
[0066] Example 5: Secondary screening of bacterial strains
[0067] Escherichia coli W3110, genetically engineered bacteria TRP-4, mutant bacteria TRPM-2, and the five product-tolerant strains screened in Example 4 were inoculated into the rescreening medium and cultured in shake flasks at 35°C for 24 hours.
[0068] The rescreening medium used in this example is the same as the shake flask screening medium used in Example 2.
[0069] The fermentation broth was centrifuged, and the supernatant was used to detect the L-tryptophan content by HPLC. The dominant L-tryptophan-producing strain with high yield and high conversion rate, namely Escherichia coli hhTRp005, was selected (see Table 2).
[0070] Table 2: Shake-flask fermentation results of the starting strain, genetically engineered strain, mutant strain, and product-acclimated strain.
[0071] strain <![CDATA[OD 600 ]]> L-Tryptophan production (g / L) Conversion rate (%) Escherichia coli W3110 12.15 0.05 0.56 TRP-4 genetically engineered bacteria 5.45 1.33 13.45 TRPM-2 (mutant bacteria) 7.24 2.61 26.55 Escherichia coli hhTRp005 15.46 3.06 30.2
[0072] As shown in Table 2, the tryptophan yield and conversion rate of the selected Escherichia coli hhTRp005 were significantly improved by overexpressing trpBA in Escherichia coli W3110, supplemented by UV and DES mutagenesis and tryptophan tolerance training.
[0073] Example 6: Scale-up culture in a 5L tank
[0074] Escherichia coli hhTRp5 was inoculated into shake flask seed culture medium (the shake flask seed culture medium formula is the same as the shake flask screening medium used in Example 2) and cultured at 35°C for 16 h; the seed culture was transferred to a 5L fermenter containing 2L of fermentation medium at an inoculation rate of 5% (v / v) and fermented under the following conditions: aeration rate of 1 vvm, culture temperature of 35°C, and stirring speed of 500 rpm for 48 h; during fermentation, the pH of the fermentation broth was controlled at 6.9, dissolved oxygen was controlled at 30%, and residual sugar concentration in the fermentation broth was controlled at 2% using ammonia water.
[0075] During fermentation, dissolved oxygen is controlled as follows: when the initial sugar (glucose) in the fermentation medium is depleted, dissolved oxygen is replenished in a linked manner. Specifically, when dissolved oxygen rises rapidly, glucose (concentration of 60%) is added. The addition rate is 2 seconds of glucose solution every 20 seconds of fermentation cycle when dissolved oxygen is greater than 30%.
[0076] After 48 hours of fermentation, HPLC analysis showed that the L-tryptophan content in the fermentation broth was 58 g / L, and the conversion rate was 32% (e.g., Figure 1 (As shown).
[0077] The high-L-tryptophan-producing Escherichia coli hhTRp005 was deposited at the China Center for Type Culture Collection (CCTCC), classified and named as Escherichia coli, strain number: hhTRp005, accession number: CCTCC NO: M2024517, accession date: March 18, 2024, address: Wuhan University, Wuhan, Hubei, China.
[0078] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. A recombinant Escherichia coli producing L-tryptophan, classified as Escherichia coli, strain number hhTRp005, preservation number CCTCC NO:M2024517.
2. The recombinant Escherichia coli according to claim 1, characterized in that, The recombinant Escherichia coli overexpressed the trpBA gene of the tryptophan operon.
3. The recombinant Escherichia coli according to claim 2, characterized in that, Using Escherichia coli W3110 as the starting strain, the trpBA gene was overexpressed at the yjiV pseudogene locus.
4. The recombinant Escherichia coli according to claim 3, characterized in that, Utilizing a strong promoter to regulate trpBA gene overexpression.
5. The recombinant Escherichia coli according to claim 4, characterized in that, The strong promoter is the trc promoter.
6. The use of the recombinant Escherichia coli according to claim 1 in items A) and / or B) below: A) Production of L-tryptophan; B) Increase L-tryptophan production and / or sugar-acid conversion rate.
7. A method for producing L-tryptophan, the method comprising: The recombinant Escherichia coli producing L-tryptophan as described in claim 1 was inoculated into a fermentation medium and cultured with shaking and aeration.
8. The method according to claim 7, characterized in that, During fermentation, dissolved oxygen is controlled at 30%-50%.
9. The method according to claim 8, characterized in that, The dissolved oxygen control method is as follows: when the initial sugar in the fermentation medium is depleted, dissolved oxygen is replenished in a linked manner; the preferred feed is glucose, and the more preferred feeding method is fed-batch feeding.
10. The method of claim 9, characterized in that, During fermentation, the ventilation rate is 0.5-2 vvm, and the stirring speed is 300-900 prm.