A small non-coding RNA molecular marker of exosomal tissue and its application

Abstract

This invention discloses an exosomal small non-coding RNA molecular marker and its application, belonging to the field of tumor liquid biopsy and molecular diagnostics. The exosomal small non-coding RNA molecular marker is tRNA-GlyGCC-5; the nucleotide sequence of tRNA-GlyGCC-5 is shown in SEQ ID NO:1. The sRESE in this invention is a novel small non-coding RNA sequence, which is the first discovery by the inventors and has significant implications for the study of esophageal cancer markers and disease progression mechanisms. The tumor diagnostic kit provided by this invention, including the exosomal small non-coding RNA molecular marker, is a non-invasive, highly sensitive, and highly specific liquid diagnostic monitoring kit suitable for general screening or general diagnosis.

Description

Technical Field

[0001] This invention belongs to the field of tumor liquid biopsy and molecular diagnostics, specifically relating to an exosomal small non-coding RNA molecular marker and its application. Background Technology

[0003] Currently, the diagnosis of esophageal cancer relies on imaging and histopathology. Imaging can only detect tumors of sufficiently large size, while histopathology requires esophagoscopy or surgery to obtain tumor tissue from the patient. Both methods have several limitations, such as poor sensitivity, invasive procedures leading to poor patient compliance, high costs, low efficiency, and inability to conduct large-scale screening or general surveys. Furthermore, their effectiveness is limited by factors such as the physician's skill level and the patient's physical condition, making them unsuitable for early screening. Therefore, early diagnosis of esophageal cancer requires highly sensitive, non-invasive or minimally invasive diagnostic techniques based on tumor-specific biomarkers.

[0004] Existing tumor biomarkers include various types such as DNA, RNA, proteins, and non-coding RNAs. Based on their expression, biomarkers can be categorized into gene mutations, amplifications, and overexpression. In recent years, several small non-coding RNAs have been discovered as tumor biomarkers, such as miRNAs, piRNAs, snoRNAs, small non-coding RNAs, tsRNAs, and some unnamed non-coding RNAs. These different types of small non-coding RNAs participate in various biological regulatory processes within cells and can also participate in intercellular communication and regulation. Studies have shown that during tumorigenesis, the expression levels of various types of small RNAs in cells change to varying degrees, participating in tumor progression or serving as products of tumor development. tsRNAs are a class of small RNAs produced from transfer RNAs (tRNAs). Increasing research indicates that tsRNA expression is regulated temporally and spatially and plays an important role in many biological processes. tsRNAs are readily produced by RNases such as angiogenin, RNY1, and Dicer under stress conditions such as amino acid deficiency, oxidative stress, and hypoxia. Because factors such as nutrient deficiency and hypoxia in the tumor microenvironment easily drive the production of tsRNA, tsRNA is a potential tumor-specific target. Currently, there are no studies using tsRNA as a biomarker in esophageal cancer.

[0005] Currently, the main sources of biomarkers for liquid biopsy include circulating tumor cells (CTCs), circulating tumor DNA (ctDNA), and exosomes. CTCs and ctDNA are primarily derived from blood and have been studied for some time, but each has its limitations. CTCs are circulating tumor cells released into the peripheral blood from solid tumors, while ctDNA is DNA released into the peripheral blood from tumor cells. Although both have certain advantages, both methods for detecting gene mutations have defects and bottlenecks. ctDNA is more at the front end, mainly used for early cancer screening, personalized medicine guidance, and drug resistance analysis by detecting mutations and DNA methylation. However, its concentration in plasma is limited (10-20 ng / mL), and effective enrichment remains the most critical step and challenge in related analyses. CTC is more at the back end, mainly used for real-time cancer monitoring and prognosis assessment, but it also has many problems. For example, current detection methods can only find a small number of tumor cells, failing to guide personalized medicine; moreover, circulating tumor cells have many subtypes, and current detection methods can only detect a few, resulting in a high false negative rate and high testing costs.

[0006] Compared to CTCs and ctDNA, exosomes, as an emerging carrier of liquid biopsy biopsy markers, are playing an increasingly important role in disease diagnosis. Exosomes can be secreted and released by almost all types of cells in the body, including B cells, T cells, dendritic cells, mast cells, endothelial cells, fibroblasts, mesenchymal stem cells, and tumor cells. They are present in various body fluids such as blood, saliva, urine, ascites, cerebrospinal fluid, and breast milk, and contain diverse contents such as proteins, nucleic acids, and metabolites, which are closely related to the occurrence and progression of various diseases.

[0007] Saliva is an important component of liquid diagnostics and has received increasing attention in recent years, playing a significant role in the early diagnosis of diseases. Salivary glands have a rich blood supply, and saliva is considered a terminal product of blood circulation, containing many molecules found in blood. Saliva is often referred to as an ultrafiltrate of blood, being purer than blood itself, having removed many of its structural components. Compared to other fluids, saliva is easier to handle, less prone to coagulation, and eliminates the influence of anticoagulation on test results. Furthermore, saliva collection is non-invasive, painless and comfortable for subjects, reproducible, safe, and inexpensive. In addition, blood has a complex composition, diverse origins, and varied information, which can lead to nonspecificity and interference from hydrodynamics during analysis. The large number of cells in blood with half-lives ranging from seconds to weeks or even months can also affect analytical results, while saliva does not have these problems. In conclusion, saliva has significant advantages over other body fluids as a source of biopsy biopsy markers.

[0008] Although liquid biopsy is developing, it still needs improvement. Two key areas are the types of fluids used and the specific indicators to be tested. Choosing the appropriate body fluid is crucial for the clinical efficacy of liquid biopsy. Currently, most liquid biopsies use blood as the testing subject; however, blood has a complex cellular composition, and some cell-free DNA and exosomes in blood originate from blood cells (such as platelets), which can significantly affect the test results. Furthermore, suitable indicators are also important factors in improving the sensitivity and specificity of liquid biopsies. These indicators must first be easy to preserve, highly stable, and not easily degraded by enzymes or external factors; secondly, they must be disease-specific, accurately reflecting the progression of disease within the body.

[0009] In summary, existing technologies often have the following drawbacks: 1) Current clinical detection methods, primarily ctDNA and CTC, are limited in their ability to diagnose malignant tumors early due to their limitations; 2) Current liquid biopsy methods, which use blood as the sample, are invasive in addition to coagulation issues, causing discomfort to patients and leading to poor patient compliance, which is not conducive to continuous monitoring; 3) Current detection methods lack sufficient sensitivity and specificity; 4) Sample collection is inconvenient and difficult to store; 5) The procedures require a high level of skill from the physician. Currently, there is no technology that can effectively solve these problems.

[0010] Currently, there are no reports of using exosomal small non-coding RNA molecular markers for the diagnosis of esophageal cancer. Summary of the Invention

[0011] In view of the shortcomings and deficiencies of the existing technology, the purpose of this invention is to provide an exosomal small non-coding RNA molecular marker.

[0012] Another object of the present invention is to provide the application of the above-mentioned exosomal small non-coding RNA molecular markers.

[0013] The objective of this invention is achieved through the following technical solution: An exosomal small noncoding RNA molecular marker, wherein the marker is at least one of tRNA-GlyGCC-5 and sRESE; The nucleotide sequence of the tRNA-GlyGCC-5 is as follows: GCATGGGTGGTTCAGTGGTAGAATTT (SEQ ID NO: 1); The nucleotide sequence of the sRESE is as follows: GCATGATCTGAGTTCCTGTTTCTTCTG (SEQ ID NO: 2).

[0014] The exosomes are preferably salivary exosomes.

[0015] The application of the exosomal small non-coding RNA molecular markers in the preparation of tumor diagnostic products.

[0016] The tumor is a malignant tumor; preferably esophageal cancer; the esophageal cancer preferably includes esophageal squamous cell carcinoma.

[0017] The tumor diagnostic products preferably include tumor diagnostic kits.

[0018] A tumor diagnostic kit, the kit comprising the above-mentioned exosomal small non-coding RNA molecular markers.

[0019] The tumor diagnostic kit also includes exosomal RNA extraction components, exosomal small non-coding RNA reverse transcription components, and exosomal real-time quantitative components.

[0020] The exosomal RNA extraction components preferably include an exosomal RNA extraction solution, an exosomal RNA purification solution, an exosomal RNA precipitation solution, an exosomal RNA washing solution, and an exosomal RNA enrichment solution.

[0021] The exosomal small non-coding RNA reverse transcription component preferably includes 5× miRNA reverse transcription buffer, miRNARTase mixture, miRNA polyA polymerase, DEPC water, and total RNA.

[0022] The kit also includes primers for amplifying the above-mentioned exosomal small non-coding RNA molecular markers; The primers used for tRNA-GlyGCC-5 are: Forward primer: GTGGTTCAGTGGTAGAATTTA; Reverse primer: Universal reverse primer; The primers used for sRESE are: Forward primer: CTGAGTTCCTGTTTCTTCTGA; Reverse primer: Universal reverse primer.

[0023] The present invention has the following advantages over the prior art: (1) The inventors unexpectedly discovered that tRNA-GlyGCC-5 and sRESE are significantly upregulated in esophageal cancer and have high consistency with tissues, and verified this using Q-PCR on a large sample. Therefore, the tRNA-GlyGCC-5 and sRESE provided by this invention have a rigorous scientific basis and good scientific significance, ensuring the scientific validity and universality of tRNA-GlyGCC-5 and sRESE as esophageal cancer biomarkers and in diagnostic kits. Furthermore, the combined use of tRNA-GlyGCC-5 and sRESE as biomarkers improves the sensitivity and specificity of detection. In addition, sRESE in this invention is a novel small non-coding RNA sequence, which was discovered for the first time by the inventors and is of great significance for the study of esophageal cancer biomarkers and disease progression mechanisms.

[0024] (2) The tumor diagnostic kit containing exosomal small non-coding RNA molecular markers provided by the present invention is a non-invasive, highly sensitive, highly specific liquid diagnostic monitoring kit suitable for general screening or screening.

[0025] (3) By detecting the expression of small non-coding RNA derived from tumor-derived exosomes, a highly stable and quantitatively accurate reagent kit and system for esophageal cancer diagnosis using biological samples such as body fluids is provided. Due to its minimally invasive nature, ease of detection, and suitability for repeated sampling, it helps to reflect the dynamic disease status of esophageal cancer patients in real time, and helps clinicians to quickly grasp the patient's condition and thus formulate more individualized treatment measures in a timely manner.

[0026] (4) The present invention has developed a tumor diagnostic kit that detects the expression levels of tRNA-GlyGCC-5 and sRESE in exosomes. These molecular markers can be used alone or in combination for the diagnosis and prognosis prediction of esophageal cancer. It has the characteristics of good stability, high repeatability, simple acquisition, and superior sensitivity and specificity compared to the prior art, thus solving the problem of the lack of a clear diagnostic and prognostic marker for esophageal cancer.

[0027] (5) The molecular markers in this invention have higher predictive efficiency (sensitivity, specificity and AUC) for esophageal cancer than existing molecular markers (HOTAIR marker, YKL-40+SCCA marker, IL-8 marker, miR-155 marker).

[0028] (6) This invention uses saliva as a specimen and leverages the superior diagnostic efficacy of saliva compared to blood and other bodily fluids to provide a liquid biopsy method based on exosomes. This method overcomes the shortcomings of traditional biopsies. Compared to currently used CTCs and ctDNA, the exosome detection of small non-coding RNAs in this invention is more reflective of tumor status. The small non-coding RNAs in this invention are more stable than ctDNA and better reflect the intrinsic biological information of tumor cells. Furthermore, detection is convenient; multiple markers can be detected in a single sample, allowing for quantification and standardized testing. Additionally, this invention utilizes a set of small non-coding RNAs identified through high-throughput screening, which can be combined to more comprehensively and accurately reflect subtle changes in tumor cells. Moreover, this invention effectively avoids the loss and degradation caused by directly detecting naked DNA and RNA using exosome-derived small non-coding RNAs. Attached Figure Description

[0029] Figure 1 This is a structural prediction diagram of tRNA derived from tRNA-GlyGCC-5.

[0030] Figure 2 The image shows the results of PCR verification of the small non-coding RNA in Example 1; the sample numbers are: 200 saliva samples from esophageal cancer patients and 120 saliva control samples from normal individuals. *** indicates statistical difference p<0.001.

[0031] Figure 3 This figure shows the expression levels of tRNA-GlyGCC-5 and sRESE in esophageal squamous cell carcinoma cell lines relative to normal human esophageal squamous epithelial cells in Example 1.

[0032] Figure 4 The figure shows the results of the correlation analysis between tRNA-GlyGCC-5 and sRESE in tissues and their corresponding salivary exosomes.

[0033] Figure 5 The graph shows the results of ROC curve analysis of the sensitivity and specificity of tRNA-GlyGCC-5 and sRESE, two small non-coding RNAs, used as biomarkers in Example 1.

[0034] Figure 6 This is a graph showing the survival analysis results of the two small non-coding RNAs, tRNA-GlyGCC-5 and sRESE, in Example 1. Detailed Implementation

[0035] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0036] Unless otherwise specified, all reagents used in the examples are commercially available.

[0037] 1. Collection, preservation, and transportation of saliva (1) Collection: At 8-10 am, the non-irritating drip method was used to collect whole saliva from subjects who met the following conditions in a quiet and comfortable environment: 1) fasting and no strenuous exercise; 2) instructing subjects to use about 20-60 mL of mouthwash to remove food residue in the mouth, spit out the remaining liquid, lower their head slightly, sit quietly and wait for the saliva to flow out naturally, collect their non-irritating whole saliva in a collection dish, preferably enough to cover the culture dish, about 250-900 µL, and then quickly aliquot it into sterile storage tubes.

[0038] (2) Preservation: The collected saliva can be stored for a long time at -80℃ after centrifugation in the preservation tube.

[0039] (3) Transportation: If transportation is required, it can be placed in a transport box for transportation to ensure that subsequent experiments are not affected by various microorganisms or enzymes in saliva.

[0040] Over the years, the inventor has collected a large number of saliva samples from cancer patients and healthy individuals for exosome testing from multiple hospitals in China (all samples were collected, preserved, and transported according to the above standards). All patients were followed up every three months, and their survival status and recurrence were recorded in detail, establishing complete case follow-up data.

[0041] 2. Extraction, preservation, and transportation of salivary exosomes (1) Extraction of salivary exosomes: Take an equal volume of 500µL of saliva obtained in step 1 (saliva that has not been centrifuged), centrifuge at 300g for 10min, transfer the supernatant to a new centrifuge tube, centrifuge at 2000g for 10min, transfer the supernatant to a new centrifuge tube, centrifuge at 5000g for 20min, and use a pipette to transfer the supernatant obtained by centrifugation to a new 1.5 mL EP tube to obtain about 450-470µL of clear supernatant; add exosome precipitation reagent at a volume ratio of clear supernatant:exosome precipitation reagent = 250:63, mix well, incubate at 4℃ overnight, centrifuge at 1500g at 4℃ for 30min, centrifuge at 3000g for 5min, discard the supernatant, collect the precipitate, and resuspend the precipitate with an appropriate amount of 1×exosome suspension to obtain exosome resuspension.

[0042] The number of exosomes was analyzed using Nanosight, and the results are shown in the table below: Table 1:

[0043] (2) Preservation and transportation of salivary exosomes The obtained exosomes can be stored for a long time in a -80°C freezer in storage tubes, and the RNA, DNA, proteins, etc. contained therein can be preserved relatively stably.

[0044] 3. RNA extraction from salivary exosomes Add 250–500 µL of exosomal RNA extraction buffer to the exosome resuspension obtained in step 2 above. After repeated pipetting, lyse at room temperature for 7–14 min. After mixing thoroughly, add the corresponding miRNA external reference cel-miR-39 for subsequent analysis and standardization. Add 60 µL of exosomal RNA purification buffer, vortex thoroughly, incubate at room temperature for 4–14 min, centrifuge at 10000–13000 g for 4–14 min, transfer the upper aqueous phase to another new tube, add an equal volume of exosomal RNA precipitation buffer, invert and mix thoroughly, incubate at room temperature for 4–14 min, or precipitate at -20℃, centrifuge at 10000–13000 g for 4–14 min, discard the supernatant, add 250–500 µL of pre-cooled exosomal RNA washing buffer at -20℃ to wash the precipitate, vortex to mix thoroughly, centrifuge at 12000 g / 5 min, discard the ethanol liquid, and allow the precipitate to air dry completely in a clean bench. The precipitate was dissolved in exosomal RNA enrichment solution, and its purity and concentration were detected using a NanoDorp2000 UV spectrophotometer. The RNA was sealed with sealing film and stored at -80 degrees Celsius.

[0045] The components of the above reagents are shown in Table 2 below: Table 2:

[0046] The concentration of RNA in salivary exosomes was detected and analyzed using a NanoDorp2000 UV spectrophotometer, as shown in the table below: Table 3:

[0047] The inventors extracted total RNA from collected salivary exosomes following the steps described above. Based on the total RNA concentration, an appropriate volume of RNA was sent for high-throughput whole transcriptome sequencing. The experiment involved saliva samples from 10 esophageal cancer patients and 10 healthy volunteers in Guangdong Province. Age, sex, and smoking status were strictly controlled between the two groups. The whole transcriptome sequencing was performed by Beijing Novogene Technology Co., Ltd.

[0048] The results of whole transcriptome sequencing screening of small non-coding RNAs in salivary exosomes are shown in Table 4 below. tRNA-GlyGCC-5 and sRESE were expressed at higher levels in cancer than in normal individuals.

[0049] Table 4:

[0050] 4. Structural prediction of tRNA-GlyGCC-5 By comparing data using the BLAST function on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), we found that tRNA-GlyGCC-5 is a small RNA derived from tRNA-GlyGCC. Using the tRNAdb database (http: / / trna.bioinf.uni-leipzig.de / DataOutput / Search), we predicted the secondary structure of tRNA-GlyGCC and visualized the information by inputting it into the ViennaRNA Web Services website (http: / / rna.tbi.univie.ac.at / forna / ). Figure 1 As shown in the figure, tRNA-GlyGCC-5 originates from the 5' end of tRNA-GlyGCC.

[0051] 5. Reverse transcription of small non-coding RNAs in salivary exosomes Small non-coding RNA was reverse transcribed into cDNA using a tailing method, employing a commercially available kit: Guangzhou Funeng Gene Co., Ltd.'s All-in-One kit. TM miRNA qRT-PCR Detection (QP015, QP016) should be performed according to the instructions, as follows: Table 5:

[0052] After mixing all the components in Table 5 evenly, centrifuge briefly and place in a PCR instrument at 37℃ for 1 hour and 85℃ for 5 minutes. Store the resulting cDNA product at -80℃ for later use.

[0053] 6. Q-PCR validation of tRNA-GlyGCC-5 and sRESE in the diagnosis of esophageal cancer. The cDNA obtained from reverse transcription of small non-coding RNA was detected using the SYBR Green method or a probe method, employing a commercially available, mature kit: Guangzhou Funeng Gene Co., Ltd.'s All-in-One kit. TM For miRNA qRT-PCR Detection (QP015, QP016), follow the instructions to prepare a 20µL Real-Time PCR reaction system in the following proportions: Table 6:

[0054] Real-time quantitative PCR was performed using the Bio-rad CFX Connect fluorescence quantitative PCR instrument, and relative quantification was performed using the 2-ΔCT method.

[0055] The reaction conditions for real-time quantitative PCR detection are as follows: pre-denaturation stage: 95℃ for 10 min; amplification cycle stage: 95℃ for 10 s, 60℃ for 20 s, 72℃ for 10 s, for 40 cycles.

[0056] Primers used: tRNA-GlyGCC-5 Forward primer: GTGGTTCAGTGGTAGAATTTA Reverse primer: Universal reverse primer; sRESE Forward primer: CTGAGTTCCTGTTTCTTCTGA Reverse primer: Universal reverse primer.

[0057] 7. Experiment The inventors selected saliva samples from 200 esophageal cancer patients and 120 healthy individuals in Guangdong Province (all volunteers who had signed informed consent forms). The small non-coding RNAs screened were verified by PCR using the method described above, and relative quantification was performed using the 2-ΔCT method.

[0058] The results are as follows Figure 2 As shown, the expression of tRNA-GlyGCC-5 and sRESE in the salivary exosomes of esophageal cancer patients was significantly higher than that in normal individuals.

[0059] The expression levels of tRNA-GlyGCC-5 and sRESE in human esophageal squamous cell carcinoma HKESC-1 cells, KYSE140 cells, KYSE510 cells, and TE1 cells (all purchased from ATCC) relative to normal human esophageal squamous epithelial cells NE2 (disclosed in Lin Y et al., Evaluation of Salivary Exosomal Chimeric GOLM1-NAA35 RNA as a Potential Biomarker in Esophageal Carcinoma, Clinical Cancer Research, 2019, 25(10):3035-3045) and NE3 (disclosed in Wang L et al., Metformin induces human esophagealcarcinoma cell pyroptosis by targeting the miR-497 / PELP1 axis. Cancer Letters, 2019, 450:22-31) are as follows: Figure 3 As shown.

[0060] Depend on Figure 3It is evident that the expression of tRNA-GlyGCC-5 and sRESE differs significantly between esophageal squamous cell carcinoma cells and normal human esophageal squamous epithelial cells. The higher expression of tRNA-GlyGCC-5 and sRESE in esophageal cancer cell lines suggests that they may play a role in the development and progression of esophageal cancer cells.

[0061] The correlation analysis results of tRNA-GlyGCC-5 and sRESE in tumor tissue of esophageal squamous cell carcinoma patients with their corresponding salivary exosomes are as follows: Figure 4 As shown.

[0062] from Figure 4 It can be seen that tRNA-GlyGCC-5 and sRESE in salivary exosomes have good consistency with tumor tissue and can reflect the expression level of the tissue.

[0063] ROC curve analysis of the expression levels of tRNA-GlyGCC-5 and sRESE in the saliva of 200 esophageal cancer patients and 120 healthy individuals in Guangdong Province showed the following effects when these two small non-coding RNAs were used alone or in combination as biomarkers to distinguish between esophageal cancer patients and healthy individuals: tRNA-GlyGCC-5: AUC was 0.878, diagnostic sensitivity was 75.50%, and specificity was 92.50%. sRESE: AUC was 0.871, diagnostic sensitivity was 74.50%, and specificity was 90.83%; The combined effect of the two methods resulted in an AUC of 0.933, a diagnostic sensitivity of 90.50%, and a specificity of 94.20% (e.g., ...). Figure 5 (As shown). (Note: When using both methods together, it is necessary to first detect the expression level of each small non-coding RNA, and then apply the logistic regression formula.) Co-expression value = 111.01 × (tRNA-GlyGCC-5 expression value) + 27.198 × (sRESO expression value) - 4.029 (Calculate the co-expression value and use the co-expression value for ROC curve analysis) Therefore, the small non-coding RNAs in the selected exosomes can be used to diagnose esophageal cancer effectively.

[0064] In addition, using SPSS 19.0 software, a risk score was obtained by combining the expression values ​​of two small non-coding RNAs, tRNA-GlyGCC-5 and sRESE, through binary logistic regression. The median of this risk score was used as the cutoff point to divide patients into high-risk and low-risk groups. Survival analysis was performed on patients in the high-risk and low-risk groups using the Kaplan-Meier method. The results are as follows: Figure 6 As shown.

[0065] Depend on Figure 6 It is known that the combination of two small non-coding RNAs, tRNA-GlyGCC-5 and sRESE, can effectively predict the prognosis of esophageal cancer patients.

[0066] In addition, we compared the diagnostic efficacy of the biomarkers of this invention (tRNA-GlyGCC-5 and sRESE combined as biomarkers) for esophageal cancer with known biomarkers, as shown in Table 7.

[0067] Table 7:

[0068] The HOTAIR biomarker has been disclosed in Wang W et al. Serum HOTAIR as a novel diagnostic biomarker for esophageal squamous cell carcinoma. Mol Cancer. 2017. DOI:10.1186 / s12943-017-0643-6; The YKL-40+SCCA biomarker has been disclosed in Zheng X et al. Establishment of using serum YKL-40 and SCCA in combination for the diagnosis of patients with esophagealsquamous cell carcinoma. BMC Cancer. 2014. DOI:10.1186 / 1471-2407-14-490; The IL-8 biomarker has been disclosed in Huang Z et al. Serum interleukin-8 as a potential diagnostic biomarker in esophageal squamous cell carcinoma. Cancer Biomark. 2020. DOI: 10.3233 / CBM-201687; The miR-155 biomarker has been published in Zheng Y et al. MicroRNA-155 acts as a diagnostic and prognostic biomarker for oesophageal squamous cell carcinoma. Artif CellsNanomed Biotechnol. 2020. DOI: 10.1080 / 21691401.2020.1773479; As can be seen from Table 7, the exosomal small non-coding RNA molecular markers of the present invention (tRNA-GlyGCC-5 and sRESE combined as markers) have better diagnostic efficiency for esophageal cancer than other known markers.

[0069] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A small non-coding RNA molecular marker for exosomal expression, characterized in that, The biomarker is tRNA-GlyGCC-5; The nucleotide sequence of the tRNA-GlyGCC-5 is shown in SEQ ID NO:

1.

2. The exosomal small non-coding RNA molecular marker according to claim 1, characterized in that, The exosomes mentioned are salivary exosomes.

3. The use of the reagent for detecting the exosomal small non-coding RNA molecular markers according to any one of claims 1 to 2 in the preparation of esophageal cancer diagnostic products.

4. The application according to claim 3, characterized in that, The esophageal cancer mentioned includes esophageal squamous cell carcinoma.

5. The application according to claim 3, characterized in that, The esophageal cancer diagnostic products include esophageal cancer diagnostic kits.

6. The application according to claim 5, characterized in that, The kit includes primers for amplifying the exosomal small non-coding RNA molecular markers according to any one of claims 1-2: Forward primer: GTGGTTCAGTGGTAGAATTTA; Reverse primer: Universal reverse primer.

7. The application according to claim 5, characterized in that, The tumor diagnostic kit also includes exosomal RNA extraction components, exosomal small non-coding RNA reverse transcription components, and exosomal real-time quantitative components; The exosomal RNA extraction components include exosomal RNA extraction solution, exosomal RNA removal solution, exosomal RNA precipitation solution, exosomal RNA washing solution, and exosomal RNA enrichment solution; The exosomal small non-coding RNA reverse transcription component includes 5× miRNA reverse transcription buffer, miRNA RTase mixture, miRNA polyA polymerase, DEPC water, and total RNA.

Images