A KASP molecular marker associated with soybean alkali tolerance and its application
By developing the KASP molecular marker and specific primer set for the Chr20_25667984 locus in the soybean genome, and combining it with real-time PCR technology, the problems of low identification efficiency and large environmental interference in soybean alkali-tolerant breeding were solved, enabling rapid and accurate genotyping and efficient breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NORTHEAST INST OF GEOGRAPHY & AGRIECOLOGY C A S
- Filing Date
- 2026-01-30
- Publication Date
- 2026-06-02
Smart Images

Figure CN122128451A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular breeding technology, specifically relating to a KASP molecular marker related to soybean alkali tolerance and its application. Background Technology
[0002] Soybeans, as one of the world's five major crops, are a core source of plant protein and edible oil for humankind, holding an irreplaceable position in global agricultural production and food security systems. However, globally, the area of salinized land has reached 800 million hectares, covering more than 100 countries. Approximately 20% of arable land is suffering from salinity stress, and driven by factors such as environmental change and improper irrigation, the trend of salinization is expanding, severely restricting the expansion of soybean planting areas and yield increases.
[0003] Alkaline stress, a major type of saline-alkali stress, is caused by alkaline salts such as sodium bicarbonate and sodium carbonate. It not only significantly increases soil pH but also disrupts the ion balance and pH homeostasis of plant cells, interfering with key physiological processes such as root development, photosynthesis, and metabolism. Ultimately, it leads to seedling wilting, growth stagnation, and even death in soybeans, becoming a core abiotic stress factor limiting soybean resilience and yield stability. Developing new alkaline-tolerant soybean varieties is the fundamental way to adapt to saline-alkali farmland and ensure the safety of soybean production.
[0004] Traditional soybean alkali tolerance breeding relies on phenotypic identification. However, soybean alkali tolerance is a complex quantitative trait regulated by multiple genes, and phenotypic expression is easily affected by environmental factors such as soil texture, climate conditions, and the timing of stress treatments. This approach suffers from drawbacks such as long identification cycles, poor reproducibility, and low selection efficiency, making it difficult to meet the needs of large-scale breeding. Molecular marker-assisted breeding (MAS) technology achieves target trait screening by directly analyzing genotypes. It is not limited by environmental conditions, can significantly shorten the breeding cycle, and improve selection accuracy, providing a breakthrough technical pathway for alkali-tolerant soybean breeding.
[0005] Genome-wide association studies (GWAS), with its advantages of high resolution and high precision, have become a core tool for elucidating the genetic basis of complex traits and have been widely used in the discovery of genetic loci for stress resistance traits such as salt tolerance, drought tolerance, and cold tolerance in soybeans. However, compared with other abiotic stresses, research on the genetic mechanisms of soybean alkali tolerance is still relatively lagging behind. The reported quantitative trait loci (QTLs) and functional markers related to alkali tolerance are extremely scarce, making it difficult to support efficient molecular breeding practices. Summary of the Invention
[0006] In view of this, this invention develops a KASP molecular marker related to soybean alkali tolerance based on the SNP site at Chr20_25667984 in the soybean genome and provides specific primers, kits and related applications for detecting this molecular marker. This enables rapid and accurate determination of soybean alkali tolerance genotypes, effectively solving the problems of low efficiency and poor accuracy in alkali tolerance identification in traditional breeding, and providing key technical support for the breeding of new alkali-tolerant soybean varieties.
[0007] To achieve the above objectives, the present invention is implemented through the following solution:
[0008] This invention provides a KASP molecular marker associated with soybean alkali tolerance, wherein the KASP molecular marker targets the SNP at the Chr20_25667984 site in the soybean genome;
[0009] The SNP site contains a TC base mutation.
[0010] This invention found that this SNP site is significantly associated with the alkali tolerance trait of soybeans. Among them, the TT genotype soybean material has significantly better alkali tolerance than the CC genotype material. The alkali tolerance level of soybeans can be directly predicted through the genotype of this site.
[0011] The present invention also provides a set of primers for detecting the above-mentioned KASP molecular markers, wherein the primers include:
[0012] The upstream specific primer 1, whose nucleotide sequence is shown in SEQ ID NO. 1, includes a first fluorescent tag;
[0013] The upstream specific primer 2, whose nucleotide sequence is shown in SEQ ID NO. 2, includes a second fluorescent tag;
[0014] The nucleotide sequence is shown in SEQ ID NO. 3. A downstream universal primer;
[0015] In the actual operation of this invention, the first fluorescent tag is a FAM fluorescent tag, and the second fluorescent tag is a HEX fluorescent tag; the fluorescent tag is located at the 5' end of the primer;
[0016] SEQ ID NO.1:
[0017] GAAGGTGACCAAGTTCATGCTGCTTCTTTGAGGAGAAGATATAT;
[0018] SEQ ID NO.2:
[0019] GAAGGTCGGAGTCAACGGATTGCTTCTTTGAGGAGAAGATATAC;
[0020] SEQ ID NO.3:
[0021] TTGTAAGTGAACACCTCGGCGAT.
[0022] This invention also provides a method for identifying soybean alkali-tolerant genotypes, the method comprising the following steps:
[0023] (1) Genomic DNA extraction: Genomic DNA was extracted from the soybean material to be identified using the conventional CTAB method or a commercial DNA extraction kit to ensure that the DNA purity and concentration met the requirements for PCR reaction (OD). 260 / OD 280 (The concentration is approximately 50 ng / μL, ranging from 1.8 to 2.0).
[0024] (2) KASP-PCR amplification: Using the extracted genomic DNA as a template, amplification was performed using the above-mentioned specific primer set and kit;
[0025] The reaction procedure for KASP-PCR amplification is as follows:
[0026] Pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing and extension at 61~55℃ for 60 s, decreasing by 0.6℃ for each cycle, for a total of 10 cycles; denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, for a total of 30 cycles;
[0027] The KASP-PCR amplification reaction system, in 20 μL volume, includes: 10 μL 2×KASP Master Mix, 0.3 μL primer mixture (the final concentrations of upstream specific primer 1, upstream specific primer 2, and downstream universal primer are 0.15 μmol / L, 0.15 μmol / L, and 0.3 μmol / L, respectively), and 2 μL genomic DNA at a concentration of 50 ng / μL, with the remainder made up with sterile water;
[0028] (3) Use a real-time PCR instrument to detect the fluorescence signal of the amplification results, and determine the genotype of the soybean sample based on the fluorescence type;
[0029] The identification method is as follows:
[0030] When only the fluorescence signal of the first fluorescent tag is detected, the genotype is determined to be TT, which means that the soybean material has strong alkali resistance.
[0031] When only the fluorescence signal of the second fluorescent tag is detected, the genotype is determined to be CC, that is, the soybean material has weak alkali resistance;
[0032] When dual fluorescent signals of the first and second fluorescent tags are detected simultaneously, the genotype is determined to be TC heterozygous.
[0033] This invention provides a kit for detecting the above-mentioned KASP molecular marker, the kit comprising the above-mentioned primers;
[0034] In the actual operation of the present invention, the kit also includes reagents such as PCR buffer, dNTPs, hot-start Taq enzyme, and fluorescent probe mixture required for KASP reaction;
[0035] The kit provided by this invention can be directly used for KASP-PCR amplification reaction, simplifying the experimental operation process and meeting the needs of large-scale detection.
[0036] The present invention also provides the application of the above-mentioned KASP molecular marker, the above-mentioned primer, the identification method of any one of the above-mentioned items, or the above-mentioned kit in soybean breeding.
[0037] The present invention also provides the application of the above-mentioned KASP molecular marker, the above-mentioned primer, the identification method of any one of the above-mentioned items, or the above-mentioned kit in the identification of alkali tolerance traits in soybeans.
[0038] The present invention also provides the application of the above-mentioned KASP molecular marker, the above-mentioned primer, the identification method of any one of the above-mentioned items, or the above-mentioned kit in molecular marker-assisted breeding of soybean alkali tolerance.
[0039] The KASP molecular marker, along with related specific primer sets and kits provided by this invention, can be widely used for identifying soybean alkali tolerance and for marker-assisted breeding of soybean alkali tolerance. In specific applications, genomic DNA is extracted from soybean materials, and KASP-PCR amplification is performed using the aforementioned specific primer sets. Genotype is determined based on the type of fluorescence signal, thereby rapidly predicting the alkali tolerance of soybean materials and enabling early screening and targeted breeding of alkali-tolerant soybean materials.
[0040] Compared with existing technologies, the present invention has the following advantages:
[0041] 1. High specificity and accuracy: This marker directly targets functional variation sites related to soybean alkali tolerance, which can accurately distinguish different alkali tolerance genotypes, avoid environmental interference and subjective bias in phenotypic identification, and the identification results are stable and reliable.
[0042] 2. High efficiency and high throughput: Based on KASP technology, the process from DNA extraction to genotype determination can be completed within one day, and it supports high-throughput detection in 96-well or 384-well plates, which is suitable for large-scale breeding material screening needs.
[0043] 3. Simple operation and controllable cost: The KASP reaction does not require an electrophoretic separation step, and the fluorescence signal can be read directly, simplifying the experimental procedure; the primer design is highly targeted, and the reagent consumption is low, significantly reducing the detection cost.
[0044] 4. Wide range of applications: Alkali tolerance screening can be completed during the soybean seedling stage, significantly shortening the breeding cycle; it is also applicable to multiple scenarios such as alkali tolerance evaluation of germplasm resources and early generation selection in hybrid breeding, providing full-process technical support for the breeding of new alkali-tolerant soybean varieties.
[0045] The KASP molecular marker based on the Chr20_25667984 locus, along with its specific primer set, detection method, and applications, provided in this invention precisely addresses the core pain points in soybean alkali-tolerant breeding: "lack of genetic markers, low identification efficiency, and significant environmental interference." This molecular marker has been validated through 326 natural soybean populations and rigorous alkaline stress experiments. It enables rapid and accurate determination of alkali-tolerant genotypes using allele-specific fluorescent PCR technology, allowing for the screening of alkali-tolerant individuals without the need for long-term field stress assessment. It not only possesses the technical advantages of high specificity, high stability, and high throughput, but also fills the application gap of efficient molecular markers for soybean alkali tolerance traits. It provides a key tool for the precise breeding of alkali-tolerant soybean varieties, rapid evaluation of germplasm resources suitable for saline-alkali land, and molecular marker-assisted breeding. It has clear innovation, outstanding practicality, and broad industrial application value, and is of great significance for promoting agricultural development in saline-alkali land and increasing soybean production capacity. Attached Figure Description
[0046] Figure 1 Manhattan plot of genome-wide association analysis (GWAS) for chlorophyll content (CC) in the AT / CK group (the ratio of phenotypic ratio between alkaline stress treatment and control);
[0047] The horizontal axis represents the chromosome numbers 1-20 of soybeans, and the vertical axis represents the -log of the correlation test p-value. 10 (P) value (the higher the value, the stronger the association between the SNP site and the alkali tolerance trait).
[0048] The horizontal dashed line in the figure represents the significance threshold line (−log). 10 (P)>6.67), the specific locus on chromosome 20 that is significantly above the threshold line is the target SNP locus Chr20_25667984 (T / C mutation), which directly proves that this locus is highly significantly associated with the alkali tolerance trait of soybean, and is the core genetic basis for the development of KASP molecular markers in this invention;
[0049] Figure 2 Quantile-quantile (QQ) plot for GWAS analysis of chlorophyll content (CC) trait in AT / CK groups;
[0050] The horizontal axis represents the theoretically expected −log 10 (P) value, with the vertical axis representing the actual observed -log 10 (P) value;
[0051] Most points in the figure are distributed along the diagonal, indicating that interference factors such as population stratification were effectively controlled during the analysis. The points in the upper right corner that deviate from the diagonal correspond to SNP sites that are significantly associated with soybean alkali tolerance (including the target site Chr20_25667984), which verifies the reliability of the GWAS analysis results, eliminates the possibility that the association signal is caused by random error, and further supports the scientific validity of the association between the target site and the alkali tolerance trait.
[0052] Figure 3 This study showcases the flanking conserved sequence, nucleotide variation type (T / C), and specific primer binding position of the target SNP site Chr20_25667984.
[0053] The upstream specific primer 1 (FAM marker) is designed for the T allele, the upstream specific primer 2 (HEX marker) is designed for the C allele, and the downstream universal primer combines with the conserved sequence downstream of the SNP site. The three work together to achieve specific amplification of the genotype at the target site, which intuitively demonstrates the targeting and rationality of the primer design of this invention. Detailed Implementation
[0054] This invention aims to provide a KASP molecular marker that is significantly correlated with soybean oil content and its applications. The technical solution of this invention is described in detail below with reference to the accompanying drawings, primer sequences, and specific embodiments.
[0055] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions.
[0056] Example 1
[0057] Development of KASP molecular markers related to soybean alkali tolerance
[0058] This study investigated 326 soybean cultivars from different ecological regions in China. Using the Illumina HiSeq sequencing platform and MS medium, GWAS analysis was employed to identify functional SNPs related to soybean alkali tolerance and to develop a KASP molecular marker targeting the Chr20_25667984 locus. During the experiment, soybean seedlings were subjected to 7 days of alkaline stress treatment with a 150 mM mixed alkaline solution (NaHCO3:Na2CO3 = 5:1, pH 9.0 ± 0.1), while the control group received standard MS medium (pH 7.0 ± 0.1). Subsequently, eight alkali tolerance-related traits, including seedling fresh weight, dry weight, and chlorophyll content, were measured, and the AT / CK ratio was calculated. Genomic DNA was extracted and whole-genome resequencing was performed, resulting in the identification of 3,311,166 high-quality SNPs. Significantly associated SNPs were screened using GWAS analysis of seven models, and QTLs were located based on LD decay distance (±71.6kb). Ultimately, the Chr20_25667984 site (T / C mutation) was determined to be significantly associated with alkali tolerance. Figure 1 , Figure 2 ).
[0059] Design a specific primer set for this target SNP:
[0060] SEQ ID NO.1:
[0061] GAAGGTGACCAAGTTCATGCTGCTTCTTTGAGGAGAAGATATAT;
[0062] SEQ ID NO.2:
[0063] GAAGGTCGGAGTCAACGGATTGCTTCTTTGAGGAGAAGATATAC;
[0064] SEQ ID NO.3:
[0065] TTGTAAGTGAACACCTCGGCGAT.
[0066] PCR amplification and fluorescence signal detection were performed, and the results showed that the successfully developed KASP molecular marker could accurately distinguish between the three genotypes TT, TC and CC. Moreover, the alkali tolerance traits of soybeans with the TT genotype, such as chlorophyll content and biomass, were significantly better than those of other genotypes, indicating that the marker is strongly associated with the alkali tolerance of soybeans.
[0067] Example 2
[0068] Application of KASP molecular markers in screening alkali tolerance in 318 soybean germplasms
[0069] This embodiment aims to verify the effectiveness of the KASP molecular marker developed based on the Chr20_25667984 locus in screening for alkali tolerance in large-scale soybean germplasm resources. The experiment selected 318 soybean germplasm resources from major soybean ecological regions including Northeast China, the Huang-Huai-Hai Plain, and the Yangtze River Basin. Genomic DNA was extracted from fresh leaves at the seedling stage of all germplasm resources using a modified CTAB method, and the concentration was adjusted to 50 ng / μL (ensuring OD). 260 / OD 280 The alkali tolerance was 1.8~2.0. KASP-PCR amplification was performed using the specific primer sets shown in SEQ ID NO.1~SEQ ID NO.3 (the reaction system and procedure were the same as in Example 1). Three technical replicates were set up for each germplasm, and blank control and positive control were set up simultaneously. The genotype was determined by reading the fluorescence signal using a real-time PCR instrument. At the same time, 318 germplasm samples were subjected to 7 days of stress treatment with 150mM mixed alkaline solution (NaHCO3:Na2CO3=5:1, pH9.0±0.1) (the control group was standard MS medium, pH7.0±0.1). The a_SPAD value of the first trifoliate leaf of the seedling, measured by the SPAD-502Plus chlorophyll meter, was used as the alkali tolerance evaluation index.
[0070] The results showed that 306 of the 318 germplasm accessions were homozygous for TT and 12 were homozygous for CC. No heterozygous CT was detected. The average a_SPAD value of the TT genotype accessions (14.9) was significantly higher than that of the CC genotype (11.7) (Table 1). This indicates that the KASP molecular marker is simple to operate and has stable results. It can efficiently meet the needs of rapid evaluation of alkali tolerance in large-scale soybean germplasm resources and provides a reliable tool for innovation and breeding of alkali-tolerant soybean germplasm.
[0071] Table 1. Statistical results of alkali tolerance phenotype data (a_SPAD value) of soybean germplasm of different genotypes.
[0072] genotype Number of germplasm samples (portions) Average a_SPAD value Phenotypic differences (difference from TT genotype) T / T 306 14.9 - C / C 12 11.7 -3.2
[0073] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. A KASP molecular marker associated with soybean alkali tolerance, characterized in that, The KASP molecular marker targets the SNP at the Chr20_25667984 site in the soybean genome; The SNP site contains a TC base mutation.
2. A set of primers for detecting the KASP molecular marker of claim 1, characterized in that, The primers include: The upstream specific primer 1, whose nucleotide sequence is shown in SEQ ID NO. 1, includes a first fluorescent tag; The upstream specific primer 2, whose nucleotide sequence is shown in SEQ ID NO. 2, includes a second fluorescent tag; The nucleotide sequence is shown in SEQ ID NO.
3. A downstream universal primer.
3. A method for identifying soybean alkali-tolerant genotypes, characterized in that, The identification method includes the following steps: (1) Extract genomic DNA from the soybean sample to be tested; (2) Using genomic DNA as a template, KASP-PCR amplification was performed using the primers described in claim 2 to obtain the amplification results; (3) Use a real-time PCR instrument to detect the fluorescence signal of the amplification results, and determine the genotype of the soybean sample based on the fluorescence type.
4. The identification method according to claim 3, characterized in that, The reaction procedure for KASP-PCR amplification in step (2) is as follows: Pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing and extension at 61~55℃ for 60 s, decreasing by 0.6℃ per cycle, for a total of 10 cycles; denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, for a total of 30 cycles.
5. The identification method according to claim 3, characterized in that, The KASP-PCR amplification reaction system described in step (2) consists of 10 μL of 2×KASP Master Mix, 0.3 μL of primer mixture, and 2 μL of genomic DNA at a concentration of 50 ng / μL, with the remainder made up with sterile water.
6. The identification method according to claim 3, characterized in that, The identification method described in step (3) is as follows: When only the fluorescence signal of the first fluorescent tag is detected, the genotype is determined to be TT, which means that the soybean material has strong alkali resistance. When only the fluorescence signal of the second fluorescent tag is detected, the genotype is determined to be CC, that is, the soybean material has weak alkali resistance; When dual fluorescent signals of the first and second fluorescent tags are detected simultaneously, the genotype is determined to be TC heterozygous.
7. A kit for detecting the KASP molecular marker of claim 1, characterized in that, The kit includes the primers as described in claim 2.
8. The application of the KASP molecular marker of claim 1, the primer of claim 2, the identification method of any one of claims 3 to 6, or the kit of claim 7 in soybean breeding.
9. The application of the KASP molecular marker of claim 1, the primer of claim 2, the identification method of any one of claims 3 to 6, or the kit of claim 7 in identifying the alkali tolerance trait of soybean.
10. The application of the KASP molecular marker of claim 1, the primer of claim 2, the identification method of any one of claims 3 to 6, or the kit of claim 7 in marker-assisted breeding of alkali-tolerant soybean.