Molecular markers for ferulic acid content in wheat grains: QTL QFAC-3BS and their applications

Abstract

This invention discloses a molecular marker for the QTL QFAC-3BS of ferulic acid content in wheat grains and its application. This invention belongs to the field of molecular breeding, specifically relating to the molecular marker for the QTL QFAC-3BS of ferulic acid content in wheat grains and its application. The method for identifying or assisting in the identification of ferulic acid content in wheat grains according to this invention includes detecting the genotype of a SNP site in the genome of the wheat to be tested, and identifying or assisting in the identification of ferulic acid content in wheat grains based on the genotype. The SNP site is a site on wheat chromosome 3B, and its nucleotide type is A or G, located at nucleotide position 81 of sequence 1 in the sequence listing. The KASP marker and its specific primer set developed in this invention can be used to detect the genotype of the SNP site, achieving molecular marker-assisted screening for ferulic acid content in grains, which is of great significance for breeding wheat varieties with increased ferulic acid content in grains.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding, specifically relating to the molecular marker of ferulic acid content in wheat grains, QTL QFAC-3BS, and its application. Background Technology

[0002] Wheat is one of the world's most important food crops, and its quality traits not only affect processing suitability and product quality but also directly relate to its nutritional and health value. In recent years, with consumers paying increasing attention to the health effects of functional foods and whole grains, bioactive components in wheat grains related to dietary health have become an important direction for quality improvement. Among them, ferulic acid (FA), as one of the main components of phenolic acids in cereal cell walls, exists widely in bound form in polysaccharide structures such as arabinoxylan, and has potential physiological activities such as antioxidant activity, which is of great significance to both the nutritional quality and processing characteristics of cereals.

[0003] The ferulic acid content in wheat grains is typically quantified using a combination of chemical hydrolysis (e.g., alkaline hydrolysis / acidification) and chromatographic detection (HPLC / UPLC). This trait is influenced by both genetic and environmental factors, resulting in significant measurement costs and workload, and making large-scale, high-throughput screening difficult in conventional breeding populations. Therefore, constructing molecular markers closely linked to ferulic acid content and using them for marker-assisted selection (MAS) is of great value for accelerating the screening of high-ferulic acid wheat materials and improving breeding efficiency.

[0004] With the development of wheat genomics and molecular marker technology, stable genetic loci associated with target traits can be identified based on QTL mapping or GWAS analysis, and high-throughput markers suitable for breeding can be further developed. Among them, KASP (Kompetitive Allele-Specific PCR) markers have advantages such as simple operation, low cost, high throughput, and good reproducibility, and have been widely used in the improvement of wheat quality and nutritional traits. Developing KASP markers closely linked to the QTL QFAC-3BS of ferulic acid content in wheat grains and clarifying the correspondence between their genotype and phenotype will provide a reliable tool for breeding high-ferulic acid wheat. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to identify or assist in the identification of molecular markers and detection methods for ferulic acid content in wheat grains, and to apply them to molecular marker-assisted breeding of wheat with high ferulic acid content.

[0006] To address the above technical problems, this invention first provides a method for identifying or assisting in the identification of ferulic acid content in wheat grains. This method includes detecting the genotype of the SNP site in the genome of the wheat to be tested, and identifying or assisting in the identification of ferulic acid content in wheat grains based on the genotype. The SNP site is a site on wheat chromosome 3B, and its nucleotide type is A or G, specifically the 81st nucleotide of sequence 1 in the sequence listing. The genotype is AA or GG, where AA is homozygous for SNP A, and GG is homozygous for SNP G.

[0007] Using the IWGSC_RefSeq_v1.0 sequence of the common wheat variety *Central China Spring* as the reference genome, the SNP site was located at 31295895 bp on wheat chromosome 3B. This SNP site was named AX-109539037.

[0008] As one implementation scheme, the method for identifying or assisting in the identification of ferulic acid content in wheat grains may include the following steps:

[0009] (1) Using the genomic DNA of the wheat to be tested as a template, KASP molecular marker detection was performed using a primer composition; the primer composition consisted of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-39 of sequence 2 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-39 of sequence 3 in the sequence listing; Primer C is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence listing; (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP in the wheat to be tested; (3) The ferulic acid content of the wheat grains was identified based on the genotype results: The ferulic acid content of the wheat grains of the wheat with the SNP genotype AA was significantly higher than that of the wheat with the SNP genotype GG.

[0010] This invention also provides the application of a substance for detecting KASP polymorphisms or genotypes in the wheat genome in any of the following: (1) To identify or assist in the identification of ferulic acid content in wheat grains; (2) Wheat breeding; (3) Prepare products for identification or auxiliary identification of ferulic acid content in wheat grains; (4) Preparation of wheat breeding products; The SNP site is a site on wheat chromosome 3B, and its nucleotide type is A or G. It is the 81st nucleotide of sequence 4 in the sequence listing. The ferulic acid content in the grains of the wheat tested with the genotype AA of the SNP is higher than that in the wheat tested with the genotype GG of the SNP.

[0011] This invention also provides a method for wheat breeding.

[0012] The wheat breeding method provided by the present invention includes detecting the genotype of the SNP locus mentioned above in the wheat genome, selecting wheat with the genotype AA of the SNP as the parent for breeding, wherein AA is the homozygous type of the SNP being A.

[0013] As an implementation method, wheat breeding methods may include the following steps: (1) Using the genomic DNA of the wheat to be tested as a template, the above primer set was used to detect KASP molecular markers; (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP site in the wheat to be tested; (3) Select AA genotype wheat for breeding wheat with high grain ferulic acid content.

[0014] In the above method, the primer dissolution and preparation method can be as follows: First, dilute the three primers to 100 μM with ddH2O, and then prepare the primer working solution as follows: 12 μL of primer A, 12 μL of primer B, 30 μL of primer C, and 46 μL of ddH2O. This solution is used as the KASP-labeled primer working solution and stored at -20 ℃ for later use.

[0015] In the above method, the KASP reaction system can be: 2.0 μl KASP 2× Master Mix (LGC, catalog number: 13448166), 0.048 μl KASP primer working solution, 1.952 μl template DNA (50 ng / μl), and the reaction system can be made up to 5.0 μL with sterile ultrapure water.

[0016] In the above method, KASP labeling can be performed on a regular PCR amplification instrument.

[0017] In the above method, the reaction procedure for KASP labeling can be: 94℃ for 15 min; 94℃ for 20 s, 63-55℃ for 1 min (decreasing by 1℃ per cycle), 10 cycles; 94℃ for 20 s, 55℃ for 60 s, 32 cycles; extension at 72℃ for 3 min, storage at 4℃.

[0018] The above method for determining the genotype of the SNP in the wheat to be tested can be as follows: After the PCR reaction is completed, the fluorescence value is read by scanning with FAM and HEX beams of an enzyme-linked immunosorbent assay (ELISA) reader (the FAM fluorescent tag sequence is read at an excitation wavelength of 485 nm and an emission wavelength of 520 nm, and the HEX fluorescent tag sequence is read at an excitation wavelength of 528 nm and an emission wavelength of 560 nm). The genotype of the SNP locus in the wheat to be tested is determined based on the fluorescence signal color. The specific determination principles are as follows: 1) If the wheat to be tested shows a blue fluorescent signal based on the AX-109539037 SNP site, then the genotype of the wheat to be tested based on the AX-109539037 SNP site is AA homozygous; 2) If the wheat to be tested shows a red fluorescent signal based on the AX-109539037 SNP site, then the genotype of the wheat to be tested based on the AX-109539037 SNP site is GG homozygous; 3) If the wheat to be tested shows a green fluorescent signal based on the AX-109539037 SNP site, then the genotype of the wheat to be tested based on the AX-109539037 SNP site is AG heterozygous.

[0019] The application of the above methods in wheat breeding also falls within the scope of protection of this invention.

[0020] This invention also provides products for detecting polymorphisms or genotypes of SNP sites in the wheat genome.

[0021] The product provided by this invention for detecting polymorphisms or genotypes of SNP sites in the wheat genome contains any of the aforementioned substances for detecting polymorphisms or genotypes of SNP sites in the wheat genome. C1) Products that detect single nucleotide polymorphisms or genotypes related to ferulic acid content in wheat grains; C2) Products used for identification or auxiliary identification of ferulic acid content in wheat grains; C3) Products used in wheat breeding.

[0022] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0023] Optionally, the substance is D1), D2), or D3). D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0024] Optionally, the amplification may be PCR amplification. The primer composition consists of primer A, primer B, and primer C.

[0025] The kit described in D3 may also include KASP 2× Master Mix.

[0026] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).

[0027] In one specific embodiment, the primer composition may be a primer composition consisting of single-stranded DNA whose nucleotide sequence is position 22-39 of sequence 2 in the sequence listing, single-stranded DNA whose nucleotide sequence is position 22-39 of sequence 3 in the sequence listing, and single-stranded DNA whose nucleotide sequence is sequence 4 in the sequence listing. The primer composition may also be a primer set consisting of single-stranded DNA shown in sequence 2, single-stranded DNA shown in sequence 3 in the sequence listing, and single-stranded DNA shown in sequence 4 in the sequence listing.

[0028] Sequence 2 in the sequence listing consists of 39 nucleotides, with nucleotides 1-21 being the FAM adapter sequence (as a marker) and nucleotides 22-39 being the specific sequence; Sequence 3 in the sequence listing consists of 39 nucleotides, with nucleotides 1-21 being the HEX adapter sequence (as a marker) and nucleotides 22-39 being the specific sequence.

[0029] The present invention also provides a DNA molecule, the nucleotide sequence of which is shown in Sequence 1 of the sequence listing.

[0030] The applications of the aforementioned DNA molecules also fall within the scope of protection of this invention. Specifically, the applications are those found in any of the following: (1) To identify or assist in the identification of ferulic acid content in wheat grains; (2) Wheat breeding; (3) Prepare products for identification or auxiliary identification of ferulic acid content in wheat grains; (4) Prepare wheat breeding products.

[0031] Optionally, in the above applications, the DNA molecule serves as a detection target.

[0032] The substance that detects the SNP site polymorphism and genotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers associated with ferulic acid content in wheat grains) to prepare a product for identifying wheat varieties with ferulic acid content in wheat grains.

[0033] In this article, the breeding objectives may include developing wheat varieties with high ferulic acid content in the grains.

[0034] This invention detected a stable association locus, named QFAC-3BS, near chromosome 31.2 Mb in wheat using natural population GWAS, which was significantly correlated with grain ferulic acid content and repeatedly detected in multiple environments. Its closely linked SNP marker is AX-109539037, explaining 5.29–8.44% of phenotypic variation. Based on this SNP marker, a KASP marker and its specific primer set were developed, which can be used to detect the genotype of this locus, thereby achieving marker-assisted screening for grain ferulic acid content. This invention is of great significance for breeding wheat varieties with increased grain ferulic acid content. Attached Figure Description

[0035] Figure 1 Genotyping results of 207 wheat varieties using the KASP marker KASP-FAC-3BS. Blue represents the AA genotype (FAM primer), corresponding to high ferulic acid content in grains; red represents the GG genotype (HEX primer), corresponding to low ferulic acid content in grains; green represents heterozygotes (AG); and pink represents the control water (NTC). Detailed Implementation

[0036] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0038] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0039] The natural population in the following examples comprises 207 wheat varieties / high-generation inbred lines used for phenotypic determination and association analysis of ferulic acid content in grains, as described in: Liu S, Wang C, Gou J, et al. Genome-wide association study of ferulic acid content using 90K and 660K SNP chips in wheat. Journal of Cereal Science, 2022, 106: 103498. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0040] The following examples used statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 was considered satisfactory. () indicates a significant difference, P < 0.01. () indicates a highly significant difference, P < 0.001. () indicates a highly significant difference.

[0041] Example: Discovery of QTLs for ferulic acid content in wheat grains in natural populations and the acquisition and application of KASP markers. I. Acquisition of Phenotypic Data on Ferulic Acid Content in Wheat Grains This study used 207 superior wheat varieties and high-generation lines from the southern part of the Huang-Huai wheat region as experimental materials. Wheat was planted in Zibo, Shandong Province, and Shijiazhuang, Hebei Province, for two consecutive growing seasons (2022-2023 and 2023-2024), respectively. A randomized complete block design with two replicates was adopted, with row length of 2 m, row width of 0.25 m, and 60 grains per row. Throughout the wheat growth process, field management followed local conventional cultivation techniques.

[0042] After timely harvesting, the grains were naturally sun-dried and stored. Impurities and damaged grains were removed to prepare whole powder. Approximately 0.5 g of sample was taken and 9 mL of 2 M NaOH solution (containing 20% ​​anhydrous ethanol) was added. The mixture was then hydrolyzed in a water bath for 3 h under light-protected conditions. Subsequently, 6 M HCl was added to adjust the pH to 1–2. The hydrolysate was extracted three times with 15 mL of ethyl acetate each time, and the organic phases were combined. The combined organic phases were evaporated to dryness by rotary evaporation, and then dissolved in 3 mL of HPLC-grade methanol. The supernatant was filtered through a 0.22 μm PTFE filter. Analyzing was performed using a Waters ultra-high performance liquid chromatography-photodiode array detection system (UPLC-PDA, Waters, Milford, MA, USA), equipped with an ACQUITY UPLC BEH C18 column (2.1 mm × 50 mm). The mobile phase was a methanol / water / acetic acid mixture, the flow rate was 0.4 mL / min, the column temperature was 40℃, and the detection wavelength was 320 nm. A standard curve was plotted using ferulic acid standards for quantification, with units expressed as μg / g flour. Each sample was measured at least twice in parallel, and the average value was taken as the ferulic acid content in the grains.

[0043] Genomic DNA was extracted from young leaves of 207 varieties using the CTAB method. DNA concentration was determined using a NanoDrop 2000c spectrophotometer, and the DNA samples were adjusted to a standard concentration of 50 ng / μl. DNA quality was then assessed using 0.8% agarose gel electrophoresis. DNA samples meeting quality standards were used for SNP genotyping. SNP analysis was performed using a wheat 660K SNP chip.

[0044] II. Genotype Treatment The 660K SNP chips of 207 wheat varieties were analyzed by Beijing Compson Agricultural Technology Co., Ltd. SNPs with a minimum allele frequency below 5% and a deletion rate above 10% were removed, leaving 117,035 high-quality SNPs for subsequent analysis.

[0045] III. GWAS Analysis GWAS analysis was performed using TASSEL 5, with the significance threshold set to -log10(P) = 3.0 (i.e., ...). P ≤0.001). A relatively stable QTL was located on wheat chromosome 3B and named QFAC-3BSIt is located at approximately 31.2 Mb on chromosome 3B; its closely linked SNP marker is... AX-109539037, This explains 5.29-8.44% of the phenotypic variation (Table 1). SNP sites AX- 109539037 Located at 31.2 Mb in the wheat reference genome (chromosome 3B) Chinese Spring RefSeq v1.0 (reference genome URL: https: / / urgi.versailles.inra.fr / blast_iwgsc / ). The nucleotide type of the SNP is A or G, and it is the 81st nucleotide of sequence 1 in the sequence listing. The genotype of the SNP is AA or GG, where AA is the homozygous type of the SNP as A, and GG is the homozygous type of the SNP as G. In sequence 1 of the sequence listing, 'r' represents A or G.

[0046] Significantly associated SNPs AX-109539037 Convert to KASP tags KASP-FAC-3BS This allows for molecular marker-assisted screening of ferulic acid content in wheat grains.

[0047] Table 1. Locations identified by GWAS analysis of natural populations QFAC-3BS

[0048] IV. Design and Application of KASP Primers 1. Design of KASP primers Based on SNP site marking AX-109539037 The KASP-tagged primer sequence designed for the inverse complementary strand is as follows: Primer A: 5'- GAAGGTGACCAAGTTCATGCT agcggcaacttcgaggaT-3' (SEQ ID No:2, the underlined part is the specific fluorescent tag sequence FAM); Primer B: 5'- GAAGGTCGGAGTCAACGGATT agcggcaacttcgaggaC-3' (SEQ ID No:3, the underlined part is the specific fluorescent tag sequence HEX); Primer C: 5'-cAagcatcgcctgaatcgA-3' (SEQ ID No:4).

[0049] 2. Establishment of the KASP detection method The KASP-labeled PCR amplification system was as follows: 2.0 μl KASP 2x Master Mix (LGC, catalog number: 13448166), 0.048 μl KASP primers (3 primers mixed, total concentration 50 μM, with a molar ratio of two upstream primers and one downstream primer of 2:2:5), and 1.952 μl template DNA (50 ng / μl). Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000TM Thermal Cycler) with the following program: 94℃ for 15 min; 94℃ for 20 s, 63-55℃ for 1 min (decreasing by 1℃ per cycle), 10 cycles; 94℃ for 20 s, 55℃ for 60 s, 32 cycles; extension at 72℃ for 3 min; storage at 4℃.

[0050] The PCR amplification products were placed in an automated focusing fluorescence multi-functional microplate reader (PHERAstarplus SNP, BMGLABTECH) to read the final fluorescence data, and then the data was imported into Klustercaller v3.4 (LGC, Hoddesdon, UK) for genotyping.

[0051] against KASP-FAC-3BS Markers, SNP sites AX-109539037 The specific principles for determining genotype are as follows: 1) If the fluorescence signal data of the amplified product is close to the X-axis (FAM fluorescence signal) after analysis by the genotyping software KlusterCaller, it means that the genotype of that locus is AA homozygous. 2) If the fluorescence signal data of the amplified product is close to the Y-axis (HEX fluorescence signal) after analysis by the genotyping software KlusterCaller, it means that the genotype of that locus is GG homozygous. 3) If the fluorescence signal data of the amplified product is located in the middle of the X-axis and Y-axis (with both FAM and HEX signals) after analysis by the genotyping software KlusterCaller, it means that the genotype of this locus is AG heterozygous.

[0052] The results are shown in Table 2: Of the 207 wheat varieties, 55 varieties showed the superior genotype AA (blue), with a ferulic acid content of 839.8 μg / g; 152 varieties showed the GG genotype (red), with a ferulic acid content of 785.9 μg / g. Statistical tests showed... KASP-FAC-3BS The gene effects showed significant differences (P<0.001). (Table 3).

[0053] In conclusion, when breeding wheat varieties with high ferulic acid content in grains, SNP sites can be selected. AX- 109539037Wheat with genotype AA is used as a parent in breeding to accelerate the selection of high-quality varieties.

[0054] Table 2. Genotypes and ferulic acid content detection results of 207 wheat varieties.

[0055] Table 3. Among 207 wheat varieties AX-109539037 Statistical analysis of genotypes and ferulic acid content in grains at loci

[0056] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for identifying or assisting in the identification of ferulic acid content in wheat grains, characterized in that: This includes detecting the genotype of SNP sites in the genome of the wheat to be tested, and identifying or assisting in the identification of ferulic acid content in wheat grains based on the genotype. The SNP site is a site on wheat chromosome 3B, and its nucleotide type is A or G, which is the 81st nucleotide of sequence 1 in the sequence listing.

2. Application of substances for detecting SNP polymorphisms or genotypes in the wheat genome in any of the following: (1) To identify or assist in the identification of ferulic acid content in wheat grains; (2) Wheat breeding; (3) Prepare products for identification or auxiliary identification of ferulic acid content in wheat grains; (4) Preparation of wheat breeding products; The SNP site is a site on wheat chromosome 3B, and its nucleotide type is A or G, which is the 81st nucleotide of sequence 1 in the sequence listing.

3. The method according to claim 1 or the application according to claim 2, characterized in that: The genotype of the SNP locus is AA or GG, where AA is the homozygous type of the SNP being A, and GG is the homozygous type of the SNP being G; the ferulic acid content in the grains of the wheat tested with the genotype AA of the SNP is higher than that in the wheat tested with the genotype GG of the SNP.

4. A method for wheat breeding, characterized by: The method includes detecting the genotype of the SNP in claim 1 in the wheat genome, selecting wheat with the genotype AA of the SNP as a parent for breeding, wherein AA is a homozygous type of the SNP being A.

5. The application of the method according to claim 1 or 4 in wheat breeding.

6. The product, characterized in that: The product contains the substance described in claim 1, and the product is any one of the following: C1) Products that detect single nucleotide polymorphisms or genotypes related to ferulic acid content in wheat grains; C2) Products used for identification or auxiliary identification of ferulic acid content in wheat grains; C3) Products used in wheat breeding.

7. The application according to claim 2 or the product according to claim 6, characterized in that: The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The application or product according to claim 7, characterized in that: The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-39 of sequence 2 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-39 of sequence 3 in the sequence listing; The primer C nucleotide sequence is the single-stranded DNA molecule of sequence 4 in the sequence listing.

9. A DNA molecule, characterized by: The nucleotide sequence of the DNA molecule is sequence 1 in the sequence listing.

10. The use of the DNA molecule of claim 9 in any of the following: (1) To identify or assist in the identification of ferulic acid content in wheat grains; (2) Wheat breeding; (3) Prepare products for identification or auxiliary identification of ferulic acid content in wheat grains; (4) Prepare wheat breeding products.

Images