Non-antibiotic selective labeling for filamentous fungi

By knocking out the arginine permease gene CAN1 in Trichoderma reesei and using L-canavanine as a selective marker, the problems of undesirable use of antibiotic markers and ineffective copy accumulation of URA markers were solved, enabling efficient selection of fungal strains and production of target proteins.

CN122138973APending Publication Date: 2026-06-02IFP ENERGIES NOUVELLES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202480068068.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-10-06
Filing Date
2024-10-04
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

In existing technologies, antibiotic markers have undesirable use problems in fungal strain selection, and auxotrophic markers (URA) lead to the accumulation of invalid gene copies. Therefore, a new non-antibiotic-selective marker is needed to select transformed strains carrying the target genetic marker.

Method used

Using L-canavanine as a selective marker, resistant strains were selected by knocking out the arginine permease gene CAN1 or its variants in filamentous fungi such as Trichoderma reesei, allowing the strains to grow in a medium containing L-canavanine.

Benefits of technology

This method enables the efficient selection and cultivation of fungal strains without the use of antibiotic markers, avoiding the accumulation of invalid gene copies and maintaining the growth of the strains and the production capacity of target proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

This invention relates to filamentous fungal strains belonging to the phylum Ascomycota, excluding fungi belonging to the class Yeastae, wherein the gene encoding arginine permease ( CAN1 The strain or its variants or orthologs have been knocked out. This invention also relates to various uses of the strain, and genetic modification methods that allow for obtaining strains according to the invention. This invention also relates to the use of L-canavanine as a selective marker for transformants, wherein the gene encoding arginine permease (… CAN1 (or its variants or orthologs have been knocked out.)
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to filamentous fungal strains belonging to the phylum Ascomycota, excluding fungi belonging to the class Saccharomycetes, wherein the gene encoding arginine permease ( CAN1 In particular, gene ID18487637 (TRI 67806) or its variants or orthologs have been knocked out. The invention also relates to various uses of this strain, and genetic modification methods for obtaining strains according to the invention. The invention further relates to the use of L-canavanine as a selective marker for transformants, wherein the gene CAN1 encoding arginine permease or its variants or orthologs have been knocked out. Background Technology

[0002] Currently, strains of filamentous fungi, such as Trichoderma reesei ( Trichoderma reesei ), and is increasingly being used to produce target proteins.

[0003] The development of industrial fungal strains requires the use of selective markers to select transformed strains carrying target genetic markers. Transformed strains are typically selected using marker genes such as antibiotic resistance genes. However, the use of such antibiotic markers is sometimes prohibited or undesirable.

[0004] With dominant markers amdS Similarly, auxotrophic markers can be used. URA These methods replace antibiotic markers for screening transformed fungal strains. However, they have drawbacks: [The text abruptly shifts to a different topic] URA Genes used as selective markers are retrievable, but this leads to the accumulation of invalid gene copies, and the markers... amdS In practice, it is not recyclable.

[0005] Therefore, new non-antibiotic selective markers are needed.

[0006] L-Canavaniline (a guanidinoyloxy group analog of L-arginine) is a non-proteinogenic amino acid synthesized by vascular plants. It was first isolated from canavaniline in 1932 (Kitagawa et al.) and has enabled a better understanding of the biological effects and mechanisms of action of non-proteinogenic amino acids that act as proteinogenic amino acid analogs. Arginyl-tRNA synthetases in many species that do not contain L-canavaniline utilize it and incorporate it into nascent polypeptide chains. The production of proteins containing L-canavaniline disrupts key reactions in RNA and DNA metabolism and protein synthesis. L-canavaniline also affects the regulation and catalysis of arginine metabolism and alters essential biochemical reactions. It is a potent arginine antimetabolite in many species. These harmful properties of L-canavaniline make it a highly toxic secondary plant component, potentially acting as an allelochemical to inhibit the feeding activity of herbivorous insects and other herbivores.

[0007] As early as 1946, L-canavanine was successfully used as an antimetabolite to limit bacterial growth (Volcani et al.), and then in 1948 it was used to limit fungal growth (Horowitz and SRB, 1948). Its first application in *Saccharomyces cerevisiae* was reported in 1954 (SRB, 1955). Studying yeast helps to understand the mechanism of action of L-canavanine (Grenson et al.). L-canavanine is introduced from the culture medium into cells via arginine permease, and its gene is named... CAN1 Upon entering the cytoplasm, L-canavanine is incorporated into nascent proteins, rendering them nonfunctional and leading to cell death. Mutating and knocking out permease prevents L-canavanine from entering the cell, thus confers resistance. In 1979, this was achieved by knocking out... CAN1 The gene, first used L-canavanine as a selective marker in yeast (Broach et al.). 1986, CAN1 The complete nucleic acid sequence of the gene (Broach et al.; Ahmad and Bussey) has been published.

[0008] CAN1 The gene has been used as a selective marker in yeast (Broach et al.; Wong et al.), but never in other fungi, let alone in those belonging to the Trichoderma genus ( Trichoderma In fungi.

[0009] Therefore, this invention is based on the inventors' results, who have demonstrated that L-canavanine can be used as a selective marker for fungal strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), wherein gene ID 18487637 ( CAN1The gene encoding the protein shown in SEQ ID NO: 2 or its variants or orthologs, or the gene encoding the protein shown in SEQ ID NO: 2 or its variants or orthologs, has been knocked out. SUMMARY Therefore, this invention relates to fungal strains belonging to the Ascomycota phylum, excluding fungi belonging to the Yeast class, wherein: -Gene ID 18487637 ( CAN1 ), or its variants or orthologs have been knocked out, or - The gene encoding the protein shown in SEQ ID NO: 2 or a variant or ortholog of it has been knocked out.

[0011] The present invention also relates to a method for genetically modifying fungal strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class) according to the present invention, comprising the step of knocking out the following: -Gene ID 18487637 ( CAN1 ), or its variants or orthologs, or - A gene encoding the protein shown in SEQ ID NO: 2 or a variant or ortholog of the protein thereof.

[0012] This invention also relates to the use of L-canavanine as a selective marker for fungal strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), wherein: -Gene ID 18487637 ( CAN1 ), or its variants or orthologs have been knocked out, or - The gene encoding the protein shown in SEQ ID NO: 2 or a variant or ortholog of it has been knocked out.

[0013] The present invention also relates to a method for selecting fungal strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), wherein: -Gene ID 18487637 ( CAN1 ), or its variants or orthologs have been knocked out, or - The gene encoding the protein shown in SEQ ID NO: 2 or a variant or ortholog of it has been knocked out. It includes: -(i) Contact the strain with a medium containing L-canavanine, and - (ii) If the strain can grow in the culture medium, then select the strain.

[0014] The present invention also relates to a method for producing fungal biomass, comprising the steps of: culturing a fungal strain belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class) in a culture medium containing a suitable substrate, wherein: -Gene ID 18487637 ( CAN1 ), or its variants or orthologs have been knocked out, or - The gene encoding the protein shown in SEQ ID NO: 2 or a variant or ortholog of it has been knocked out.

[0015] The present invention also relates to a method for producing a target protein, particularly an enzyme, comprising the steps of: culturing a fungal strain belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class) in a culture medium containing a suitable substrate, wherein: -Gene ID 18487637 ( CAN1 ), or its variants or orthologs have been knocked out, or - The gene encoding the protein shown in SEQ ID NO: 2 or a variant or ortholog of it has been knocked out.

[0016] The present invention further relates to a method for producing bio-based products from cellulose or lignocellulose substrates, comprising the steps of: producing a cellulase by using a fungal strain belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), wherein: -Gene ID 18487637 ( CAN1 ), or its variants or orthologs have been knocked out, or - The gene encoding the protein shown in SEQ ID NO: 2 or a variant or ortholog of it has been knocked out.

[0017] The present invention also relates to a method for producing a sugar-containing juice or sugar from a cellulose or lignocellulose substrate, comprising the steps of: producing a cellulase by using a fungal strain belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), wherein: -Gene ID 18487637 ( CAN1 ), or its variants or orthologs have been knocked out, or - The gene encoding the protein shown in SEQ ID NO: 2 or a variant or ortholog of it has been knocked out.

[0018] The present invention also relates to a method for producing biofuels from cellulose or lignocellulose substrates, comprising the steps of: producing a cellulase by using a fungal strain belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), wherein: -Gene ID 18487637 ( CAN1), or its variants or orthologs have been knocked out, or - The gene encoding the protein shown in SEQ ID NO: 2 or a variant or ortholog of it has been knocked out.

[0019] This invention also relates to various uses of strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class) according to the invention, wherein gene ID 18487637 ( CAN1 ), or variants or orthologs thereof, or genes encoding the protein shown in SEQ ID NO: 2, or variants or orthologs thereof, have been knocked out for use in: biomass production, production of target proteins, hydrolysis of cellulose or lignocellulose into glucose, production of bio-based products from cellulose or lignocellulose substrates, or production of sugar-containing juices or sugars from cellulose or lignocellulose substrates, or production of biofuels from cellulose or lignocellulose substrates. DETAILED DESCRIPTION Therefore, in a first aspect, the present invention relates to fungal strains belonging to the Ascomycota phylum, excluding fungi belonging to the Yeast class, wherein (a) gene ID 18487637 ( CAN1 (a) or a variant or ortholog of the gene, or (b) the gene encoding the protein shown in SEQ ID NO: 2, or a variant or ortholog of the protein therein, has been knocked out. Therefore, in the strain according to the invention, gene ID 18487637 ( CAN1 ), or its variants or orthologs, or genes encoding the protein shown by SEQ ID NO: 2, or its variants or orthologs, have never been expressed or are no longer functional. This also means that in the strain according to the invention, gene ID 18487637 ( CAN1 ), or its variants or orthologs, or genes encoding the protein shown in SEQ ID NO: 2, or its variants or orthologs, are knocked out. Therefore, this invention relates to variant fungal strains wherein (a) gene ID 18487637 ( CAN1 (a) The gene encoding the protein shown in SEQ ID NO: 2 or its variants or orthologs has been knocked out, or (b) The gene encoding the protein shown in SEQ ID NO: 2 or its variants or orthologs has been knocked out. In other words, this means, for example, that in the strain according to the invention, the gene corresponding to gene ID 18487637 is not produced. CAN1 ), or a protein of its variants or orthologs, or the protein shown in SEQ ID NO: 2, or a variant or ortholog of its protein. Alternatively, it can produce a protein corresponding to gene ID 18487637 ( CAN1The protein, or a variant thereof or ortholog thereof, or the protein represented by SEQ ID NO:2, or a variant thereof or ortholog thereof, but which is not functional. Therefore, the strain according to the invention is a strain with arginine permease deficiency.

[0021] According to the present invention, the term "variant strain" should be understood to refer to a strain that has undergone genetic modification compared to the parent strain. Therefore, according to the present invention, the term "parent strain" refers to a strain from which the variant strain originates or is derived, and wherein gene ID 18487637 ( CAN1 The protein encoded by SEQ ID NO: 2 or its variants or orthologs were not knocked out, or the gene encoding the protein represented by SEQ ID NO: 2 or its variants or orthologs was not knocked out. Therefore, the strain according to the invention corresponds to a variant strain derived from the parent strain, which is capable of growing in a basic medium containing L-canavanine, while the parent strain cannot grow in a basic medium containing L-canavanine.

[0022] According to the present invention, the term "functional gene" is specifically understood to mean a gene that allows the production of functional proteins.

[0023] According to the present invention, the term "functional protein" specifically refers to a protein that is active. For example, for a protein derived from gene ID18487637 ( CAN1 ), or variants or orthologs thereof, or proteins encoded by genes encoding the protein shown in SEQ ID NO: 2 or variants thereof or orthologs thereof, which is arginine permease activity.

[0024] According to the present invention, the fungal strain refers to a fungus belonging to the phylum Ascomycota, excluding fungi belonging to the class Yeastae. In one embodiment, the fungal strain according to the present invention refers to a fungus belonging to the phylum Ascomycota, excluding fungi belonging to the class Yeastae or class Aspergillus. In another embodiment, the fungal strain according to the present invention refers to a fungus belonging to the phylum Ascomycota, excluding fungi belonging to the class Yeastae, class Aspergillus, or order Sordariales. Preferably, it belongs to the order Hypocreales, particularly the genus Trichoderma. Trichoderma ), especially Trichoderma reesei ( Trichoderma reesei ) strains.

[0025] When the fungus belongs to the Trichoderma reesei species, according to the present invention, the parental strain of Trichoderma reesei can be strain QM6a (accession number ATCC 13631), or a strain derived from the natural isolate QM6a (especially obtained through random or directed mutagenesis), such as strain Rut-C30 (accession number ATCC 56765), strain NG14 (accession number ATCC 56767), or strain QM1414 (accession number ATCC 26921). Typically, strains according to the present invention can be selected in a culture medium containing L-canavanine, while maintaining their ability to produce the target protein.

[0026] The gene annotated as gene ID 18487637 in the *Trichoderma reesei* reference genome. CAN1 The gene (TRIREDRAFT_67806 or TRI 67806) encodes a protein belonging to the arginine permease family. These permeases allow the introduction of L-canavanine into cells. In this case, L-canavanine is then incorporated into the synthesized proteins, rendering them nonfunctional and leading to cell death. In the strains of this invention, L-canavanine cannot be incorporated, and therefore cell death is not induced.

[0027] According to the present invention, gene ID 18487637 ( CAN1 The gene ID is shown in SEQ ID NO: 1, but may also correspond to a variant or ortholog of the gene. Preferably, gene ID 18487637 ( CAN1 (Solely shown by SEQ ID NO: 1)

[0028] According to this invention, "gene variant or orthologous gene" should be understood as a gene that also encodes a protein belonging to the arginine permease family. Gene ID 18487637 ( CAN1 Variant or gene ID 18487637 CAN1 The orthologous gene of ) is preferably represented by a sequence having at least 80% percentage identity with the gene of SEQ ID NO: 1. Therefore, gene ID 18487637 ( CAN1 Variant or gene ID 18487637 CAN1 The orthologous gene of ) corresponds to the gene derived from the sequence shown in SEQ ID NO: 1. More specifically, gene ID 18487637 ( CAN1 Variants of ) or ID18487637 ( CAN1 The orthologous gene of ) is shown as a sequence having at least 90%, particularly at least 95%, preferably at least 98% or 99% percentage identity with the gene of SEQ ID NO: 1.

[0029] According to the present invention, the protein of SEQ ID NO: 2 corresponds to arginine permease. Therefore, the term "variant protein or orthologous protein" refers to a protein that also possesses this arginine permease activity. Therefore, preferably, the variant protein of the protein shown in SEQ ID NO: 2 or the orthologous protein of the protein shown in SEQ ID NO: 2 corresponds to a protein having at least 80%, particularly at least 90%, more particularly at least 95%, 98%, or 99% percentage identity with said SEQ ID NO: 2.

[0030] Gene ID 18487637 CAN1 ) is shown by SEQ ID NO: 1, and by gene ID 18487637 ( CAN1 The protein encoded by SEQ ID NO: 2 is shown. Therefore, gene ID 18487637 ( CAN1 Variant or gene ID 18487637 CAN1 The orthologous gene of SEQ ID NO: 2 may encode the protein of SEQ ID NO: 2 or a protein having at least 80%, particularly at least 90%, more particularly at least 95%, 98% or 99% percentage identity with said SEQ ID NO: 2.

[0031] According to the present invention, the term "at least 80%" refers to all values ​​between 80% and 100%, particularly values ​​of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%. Those skilled in the art know how to calculate the percentage of identity between two sequences. For example, according to the present invention, the percentage identity of a given sequence compared to SEQ ID NO: 1 or SEQ ID NO: 2 is understood as the percentage identity compared to the full length of the sequence. Therefore, this percentage corresponds to the number of identical nucleotides / residues between the given sequence and SEQ ID NO: 1 or 2 divided by the number of nucleotides or residues in the longer sequence of the two sequences.

[0032] Therefore, in one embodiment, in the strain according to the invention, the knocked-out gene ID 18487637 ( CAN1 The gene that corresponds to the gene shown in SEQ ID NO: 1 or has at least 80%, particularly at least 90%, more particularly at least 95% percentage identity with the gene in SEQ ID NO: 1. In an even more preferred embodiment, in the strain according to the invention, the knocked-out gene ID 18487637 ( CAN1This corresponds to the gene shown in SEQ ID NO: 1. In the latter embodiment, the strain of the present invention therefore contains the deletion of the gene encoding the protein shown in SEQ ID NO: 2.

[0033] According to one embodiment, the strain of the present invention therefore corresponds to the following strain, wherein: -Gene ID 18487637 as shown in SEQ ID NO: 1 ( CAN1 (or a gene that has at least 80% percentage identity with the gene in SEQ ID NO: 1 has been knocked out, or) - The gene encoding the protein shown in SEQ ID NO: 2 or a protein having at least 80% percentage identity with the protein in SEQ ID NO: 2 has been knocked out.

[0034] According to a preferred embodiment, the present invention relates to filamentous fungal strains belonging to the order Hypocreales, particularly the genus Trichoderma, and more particularly Trichoderma reesei, wherein: -Gene ID 18487637 as shown in SEQ ID NO: 1 ( CAN1 (or a gene that has at least 80% percentage identity with the gene in SEQ ID NO: 1 has been knocked out, or) - The gene encoding the protein shown in SEQ ID NO: 2 or a protein having at least 80% percentage identity with the protein in SEQ ID NO: 2 has been knocked out.

[0035] According to the present invention, gene ID 18487637 ( CAN1 The gene encoding the protein shown in SEQ ID NO: 2, or its variants or orthologs, or the gene encoding a variant or ortholog of the protein shown in SEQ ID NO: 2, has been knocked out. Any gene knockout technique can be used to obtain the strain according to the invention. As a non-limiting example, knockout can be achieved by PCR-based mutagenesis, oligonucleotide-directed mutagenesis, RNA interference, using a wide range of nucleases or zinc finger nucleases, TALEN (transcription activator-like effector nuclease), or CRISPR / Cas technology, etc. Preferably, gene ID 18487637 (… CAN1 Knockout of a gene encoding the protein shown in SEQ ID NO: 2 or a variant or ortholog of the protein, or a variant or ortholog of the protein, is performed by genome editing. This genome editing can be performed with or without a repair template.

[0036] According to one implementation plan, the gene knockout is gene ID 18487637 ( CAN1), or its variants or orthologs, or the deletion of all or part of the gene encoding the protein shown in SEQ ID NO: 2 or its variants or orthologs. Preferably, the knockout is gene ID 18487637 shown in SEQ ID NO: 1 ( CAN1 The deletion of all or part of the gene encoding the protein shown in SEQ ID NO: 2, or the deletion of all or part of the gene encoding the protein shown in SEQ ID NO: 2.

[0037] In a second aspect, the present invention also relates to a method for genetically modifying fungal strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), comprising knocking out gene ID 18487637 ( CAN1 The steps of generating a gene encoding the protein shown in SEQ ID NO: 2 or a variant or ortholog of the protein, or a variant or ortholog of the protein, are described. Therefore, the method for genetic modification according to the invention makes it possible to obtain strains selectable in a medium containing concanavalin A compared to the parent fungal strain.

[0038] Therefore, according to one embodiment, the present invention relates to a method for genetically modifying fungal strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), comprising the step of knocking out the following: -Gene ID 18487637 as shown in SEQ ID NO: 1 ( CAN1 ), or a gene that has at least 80% percentage identity with the gene in SEQ ID NO: 1, or - A gene encoding the protein shown in SEQ ID NO: 2 or a protein having at least 80% percentage identity with the protein in SEQ ID NO: 2.

[0039] In a third aspect, the invention also relates to the use of L-canavanine as a selective marker for fungal strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class) according to the invention, wherein gene ID 18487637 ( CAN1 The gene encoding the protein shown in SEQ ID NO: 2 or its variants or orthologs has been knocked out.

[0040] Therefore, according to one embodiment, the present invention relates to the use of L-canavanine as a selective marker for fungal strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), wherein: -Gene ID 18487637 as shown in SEQ ID NO: 1 ( CAN1 (or a gene that has at least 80% percentage identity with the gene in SEQ ID NO: 1 has been knocked out, or) - The gene encoding the protein shown in SEQ ID NO: 2 or a protein having at least 80% percentage identity with the protein in SEQ ID NO: 2 has been knocked out.

[0041] Preferably, the present invention relates to L-canavanine as gene ID 18487637 ( CAN1 (or the use of selective markers for strains whose genes encoding the protein shown in SEQ ID NO: 2 have been knocked out.)

[0042] According to the present invention, L-canavanine refers to a non-proteinogenic amino acid with the semi-structural formula: (NH2)2C=NO-CH2-CH2-CH(NH2)-COOH, or the chemical formula shown below: [Chemical Formula 1] This also applies to its salt form, L-canavanine.

[0043] The term "selective marker" is understood in this article to mean that L-canavanine is allowed to be genetically modified relative to the absence of incorporation (in this case, the knockout gene ID 18487637). CAN1 Those strains that have incorporated genetic modifications, including strains of the protein shown in SEQ ID NO: 2 or its variants or orthologs, or those encoding the protein shown in SEQ ID NO: 2 or its variants or orthologs.

[0044] Preferably, L-canavanine is present in the culture medium of the fungal strain. Preferably, the culture medium is free of arginine, and optionally also free of alanine, aspartic acid, and / or glutamic acid. Therefore, the culture medium may be free of arginine, alanine, aspartic acid, and / or glutamic acid. According to a preferred embodiment, L-canavanine is present in a basic culture medium of the fungal strain, particularly a basic culture medium free of arginine, and optionally also free of alanine, aspartic acid, and / or glutamic acid. According to another preferred embodiment, L-canavanine is present in a synthetic culture medium of a fungal strain that is free of arginine, and optionally also free of alanine, aspartic acid, and / or glutamic acid.

[0045] According to the present invention, "basic culture medium" should be understood as a culture medium containing only the elements required for the growth of fungal strains, and "synthetic culture medium" should be understood as a culture medium in which the amount and mass of each element present in the culture medium are clearly defined. Synthetic culture media may contain elements not required for microbial growth. These basic and synthetic culture media are the opposite of "enriched culture media," which not only contain the elements required for the growth of fungal strains but also in which the amount and mass of the elements are not clearly defined. Basic culture media for *Trichoderma* are described, for example, by Penttilä et al.

[0046] According to one implementation scheme, L-canavanine is used in the culture medium at a concentration of 50 to 200 μg / mL.

[0047] In a fourth aspect, the present invention also relates to a method for selecting fungal strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), wherein gene ID 18487637 ( CAN1 Genes encoding the protein shown in SEQ ID NO: 2, or its variants or orthologs, or genes encoding variants or orthologs of the protein shown in SEQ ID NO: 2, have been knocked out, including: -(i) Contact the strain with a medium containing L-canavanine, and - (ii) If the strain can grow in the culture medium, then select the strain.

[0048] Therefore, according to one embodiment, the present invention relates to a method for selecting fungal strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), wherein: -Gene ID 18487637 as shown in SEQ ID NO: 1 ( CAN1 (or a gene that has at least 80% percentage identity with the gene in SEQ ID NO: 1 has been knocked out, or) - The gene encoding the protein shown in SEQ ID NO: 2 or a protein having at least 80% percentage identity with the protein in SEQ ID NO: 2 has been knocked out. The method includes: -(i) Contact the strain with a medium containing L-canavanine, and - (ii) If the strain can grow in a basic or synthetic medium that does not contain arginine, and optionally also does not contain alanine, aspartic acid and / or glutamic acid, then the strain is selected.

[0049] According to one embodiment, the method includes, prior to step (i), knocking out gene ID 18487637 in a fungal strain belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class). CAN1 The steps include: generating a gene encoding the protein shown in SEQ ID NO: 2, or a variant or orthologous gene thereof, or a gene encoding a variant or orthologous protein thereof. According to this embodiment, the fungus preferably belongs to the order Hypocreales.

[0050] According to a preferred embodiment, the invention therefore relates to selecting gene ID 18487637, which is represented by SEQ ID NO: 1. CAN1 A method for obtaining a strain of bacteria whose gene encoding the protein shown in SEQ ID NO: 2 has been knocked out, comprising: - Knock out gene ID 18487637 (as shown in SEQ ID NO: 1) in the strain. CAN1 (or the step of encoding the gene for the protein shown in SEQ ID NO: 2) - Contact the strain with a culture medium containing L-canavanine, and - The strain is selected if it can grow in a culture medium, particularly a basic or synthetic medium that does not contain arginine, and optionally also does not contain alanine, aspartic acid and / or glutamic acid.

[0051] Therefore, the method for selecting strains according to the present invention can select strains that are correctly transformed.

[0052] In a fifth aspect, the invention also relates to a method for producing fungal biomass from fungi belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), comprising the step of culturing a fungal strain according to the invention in a culture medium containing a suitable substrate, wherein gene ID 18487637 ( CAN1 The gene encoding the protein shown in SEQ ID NO: 2, or a variant or ortholog of the protein, or a variant or ortholog of the protein, has been knocked out. This step thus allows the growth of the fungal strain according to the invention, and in particular, the acquisition of biomass. Substrates suitable for the growth of fungal strains are familiar to those skilled in the art.

[0053] Therefore, according to one embodiment, the present invention relates to a method for producing fungal biomass from fungi belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), comprising the step of culturing a fungal strain according to the invention in a culture medium containing a suitable substrate, wherein: -Gene ID 18487637 as shown in SEQ ID NO: 1 ( CAN1 (or a gene that has at least 80% percentage identity with the gene in SEQ ID NO: 1 has been knocked out, or) - The gene encoding the protein shown in SEQ ID NO: 2 or a protein having at least 80% percentage identity with the protein in SEQ ID NO: 2 has been knocked out.

[0054] In a sixth aspect, the invention also relates to a method for producing a target protein, particularly an enzyme, comprising the step of culturing a fungal strain belonging to the Ascomycota (excluding fungi belonging to the Yeast class) according to the invention in a culture medium containing a suitable substrate, wherein gene ID 18487637 ( CAN1 The gene encoding the protein shown in SEQ ID NO: 2, or its variants or orthologs, or the gene encoding a variant or ortholog of the protein shown in SEQ ID NO: 2, has been knocked out. Therefore, this invention relates to the use of fungal strains according to the invention for the production of target proteins.

[0055] Therefore, according to one embodiment, the present invention relates to a method for producing a target protein, particularly an enzyme, comprising the step of culturing a fungal strain belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class) in a culture medium containing a suitable substrate, wherein: -Gene ID 18487637 as shown in SEQ ID NO: 1 ( CAN1 (or a gene that has at least 80% percentage identity with the gene in SEQ ID NO: 1 has been knocked out, or) - The gene encoding the protein shown in SEQ ID NO: 2 or a protein having at least 80% percentage identity with the protein in SEQ ID NO: 2 has been knocked out.

[0056] Advantageously, the method therefore includes a growth phase of the fungal strain according to the invention, followed by a growth phase of the strain and production of the target protein. Even more preferably, the growth phase is carried out in the presence of a growth substrate, and the growth phase and production of the target protein are carried out in the presence of an inducing substrate. The growth substrate and the inducing substrate are preferably carbon substrates.

[0057] Therefore, the carbon growth substrate is preferably selected from the residues obtained after ethanol fermentation of monosaccharides from the enzymatic hydrolysis products of lactose, glucose, xylose, and cellulose biomass, and / or crude extracts of water-soluble pentoses from pretreated cellulose biomass.

[0058] Therefore, the carbon-inducible substrate is preferably selected from the residues obtained after ethanol fermentation of monosaccharides from the enzymatic hydrolysis products of lactose, cellobiose, sophorose, and cellulose biomass, and / or crude extracts of water-soluble pentoses from pretreated cellulose biomass.

[0059] According to the present invention, the target protein is any protein that can be produced naturally by fungi or through genetic modification (e.g., after transformation using a suitable vector).

[0060] Advantageously, the target protein according to the invention is an enzyme, particularly a cellulase, such as cellulase or hemicellulase. Preferably, the enzyme is a cellulase. According to the invention, the term "cellulase" more specifically refers to an enzyme selected from endoglucanases, exoglucanases, and glucosidases, and more specifically β-glucosidases. The term "cellulase" more specifically refers to an enzyme suitable for cellulose hydrolysis and allowing microorganisms (e.g., *Trichoderma reesei*) to use cellulose as a carbon source by hydrolyzing the polymer into monosaccharides (glucose). Therefore, according to one embodiment, the invention relates to the use of fungal strains according to the invention for the production of target proteins, more particularly enzymes, especially cellulases such as cellulase.

[0061] In a seventh aspect, the invention also relates to a method for producing bio-based products from cellulose or lignocellulose substrates, comprising the step of producing a cellulase by using a fungal strain belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class) according to the invention, wherein gene ID 18487637 ( CAN1 The gene encoding the protein shown in SEQ ID NO: 2, or a variant or ortholog of the protein, or a variant or ortholog of the protein, has been knocked out. Therefore, the present invention also relates to the use of fungal strains according to the invention for the production of bio-based products from cellulose or lignocellulose substrates.

[0062] Therefore, according to one embodiment, the present invention relates to a method for producing bio-based products from cellulose or lignocellulose substrates, comprising the step of producing cellulase by using fungal strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), wherein: -Gene ID 18487637 as shown in SEQ ID NO: 1 ( CAN1 (or a gene that has at least 80% percentage identity with the gene in SEQ ID NO: 1 has been knocked out, or) - The gene encoding the protein shown in SEQ ID NO: 2 or a protein having at least 80% percentage identity with the protein in SEQ ID NO: 2 has been knocked out.

[0063] In an eighth aspect, the invention also relates to a method for producing a saccharin-containing juice or sugar from a cellulose or lignocellulose substrate, comprising the step of producing a cellulase by using a fungal strain belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class) according to the invention, wherein gene ID 18487637 ( CAN1 The gene encoding the protein shown in SEQ ID NO: 2, or a variant or ortholog of the protein, or a variant or ortholog of the protein, has been knocked out. Therefore, the present invention also relates to the use of fungal strains according to the invention for the production of saccharide juice or sugar from cellulose or lignocellulose substrates.

[0064] Therefore, according to one embodiment, the present invention relates to a method for producing a sugar-containing juice or sugar from a cellulose or lignocellulose substrate, comprising the step of producing a cellulase by using a fungal strain belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class), wherein: -Gene ID 18487637 as shown in SEQ ID NO: 1 ( CAN1 (or a gene that has at least 80% percentage identity with the gene in SEQ ID NO: 1 has been knocked out, or) - The gene encoding the protein shown in SEQ ID NO: 2 or a protein having at least 80% percentage identity with the protein in SEQ ID NO: 2 has been knocked out.

[0065] In a preferred aspect, the method according to the invention for producing a juice or sugar from a cellulose or lignocellulose substrate comprises: i) The step of pretreating cellulose or lignocellulose substrates to obtain pretreated substrates. ii) The step of producing cellulase using the strain according to the invention, iii) The step of enzymatically hydrolyzing the pretreated substrate obtained in step i) in the presence of the cellulase obtained in step ii) to obtain the hydrolysate.

[0066] Therefore, sugar (or sugar juice, usually in aqueous solution form) is obtained at the end of the hydrolysis step. Preferably, these are sugars with 5 carbons (called C5 sugars) and / or sugars with 6 carbons (called C6 sugars).

[0067] Therefore, the method according to the invention allows for the processing of (lignocellulosic) biomass to produce so-called second-generation (2G) sugar juice. These sugar juices can be used to biochemically produce other products, particularly through fermentation (e.g., alcohols such as ethanol, butanol), or other compounds (e.g., solvents such as acetone), or can be used as is, possibly after separation / processing steps, for example in the chemical / agricultural-food industry.

[0068] In a ninth aspect, the present invention relates to a method for producing biofuels from cellulose or lignocellulose substrates, comprising the step of producing a cellulase by using a fungal strain belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class) according to the invention, wherein gene ID 18487637 ( Figure 1 The gene encoding the protein shown in SEQ ID NO: 2, or a variant or ortholog of the protein, or a variant or ortholog of the protein, has been knocked out. Therefore, this invention relates to the use of fungal strains according to the invention for the production of biofuels from cellulose or lignocellulose substrates.

[0069] According to one embodiment, the present invention relates to a method for producing biofuels from cellulose or lignocellulose substrates, comprising the step of producing a cellulase by using a fungal strain belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class) according to the present invention, wherein: -Gene ID 18487637 as shown in SEQ ID NO: 1 ( Figure 1 (or a gene that has at least 80% percentage identity with the gene in SEQ ID NO: 1 has been knocked out, or) - The gene encoding the protein shown in SEQ ID NO: 2 or a protein having at least 80% percentage identity with the protein in SEQ ID NO: 2 has been knocked out.

[0070] According to the present invention, the term "biofuel" more specifically refers to second-generation biofuels, i.e., second-generation biofuels derived from non-food resources. According to the present invention, the term "biofuel" can also be defined as any product produced from the conversion of biomass and that can be used for energy purposes. Not wishing to be limited thereto, some examples include biogas, products that can be incorporated (possibly after further processing) into fuel or can be fuels themselves, such as alcohols (ethanol, butanol, and / or isopropanol, depending on the type of fermenting organism used), solvents (acetone), acids (butyric acid), lipids and their derivatives (short-chain or long-chain fatty acids, fatty acid esters), and hydrogen. Preferably, the biofuel according to the present invention is an alcohol, such as ethanol, butanol, and / or isopropanol. More preferably, the biofuel according to the present invention is ethanol. In another embodiment, the biofuel is a biogas. In another embodiment, the product is a molecule of interest to the chemical industry, such as another alcohol like 1,2-propanediol, 1,3-propanediol, 1,4-butanediol, 2,3-butanediol, an organic acid like acetic acid, propionic acid, acrylic acid, butyric acid, succinic acid, malic acid, fumaric acid, citric acid or itaconic acid, or a hydroxy acid like glycolic acid, hydroxypropionic acid or lactic acid.

[0071] In a preferred aspect, the method for producing biofuels from cellulose or lignocellulose substrates according to the present invention comprises: i) The step of pretreating cellulose or lignocellulose substrates to obtain pretreated substrates. ii) The step of producing cellulase using the strain according to the invention, iii) The step of enzymatically hydrolyzing the pretreated substrate obtained in step i) in the presence of the cellulase obtained in step ii) to obtain the hydrolysis product. iv) The obtained hydrolysis product is subjected to alcohol fermentation. v) Separation steps, particularly by distillation.

[0072] In an even more preferred aspect, the method for producing biofuel from cellulose or lignocellulose substrates according to the present invention comprises: i) The step of pretreating cellulose or lignocellulose substrates to obtain pretreated substrates. ii) The step of producing cellulase using the strain according to the invention, iii) The step of enzymatically hydrolyzing the pretreated substrate obtained in step i) in the presence of the cellulase obtained in step ii) to obtain the hydrolysis product. iv) The obtained hydrolysis product is subjected to alcohol fermentation. v) Separation steps, particularly by distillation, Steps iii) and iv) are performed simultaneously. This is typically the case in a production method known as "SSF" (Simultaneous Saccharification and Fermentation).

[0073] According to one specific implementation, the step of pretreating the cellulose or lignocellulose substrate is to suspend the cellulose or lignocellulose substrate in an aqueous phase.

[0074] According to a specific implementation scheme, the hydrolysis product obtained in step iii) is a hydrolysis product containing glucose.

[0075] According to one specific implementation, the alcohol fermentation step of the obtained hydrolysate is a step of fermenting glucose from the hydrolysate in the presence of a fermenting organism to produce a fermentation broth. The fermenting organism is, for example, yeast.

[0076] According to one specific implementation plan, the separation step is the separation of biofuel and fermentation broth, particularly through distillation.

[0077] According to even more preferred embodiments, the cellulose or lignocellulose substrate to be hydrolyzed is suspended in the aqueous phase at a concentration of 6-40%, preferably 20-30% dry matter. The pH is adjusted to 4-5.5, preferably 4.8-5.2, and the temperature is adjusted to 40°C-60°C, preferably 45°C-50°C. The hydrolysis reaction is initiated by adding an enzyme that acts on the pretreated substrate. The amount of enzyme typically used is 10-30 mg of secreted protein or less per gram of pretreated substrate. The reaction typically lasts 15 to 48 hours. The reaction is monitored by measuring the released sugars, particularly glucose. The sugar-containing juice is separated from the unhydrolyzed solid fraction, which is essentially composed of lignin, by filtration or centrifugation, and then processed in the fermentation unit.

[0078] According to another, or even more preferred, embodiment, enzymes and fermentation organisms are added simultaneously during the co-conversion of hydrolysis and fermentation steps, followed by incubation at 30°C to 35°C to produce a fermentation broth. According to this embodiment, cellulose present in the pretreated substrate is converted to glucose, while simultaneously, in the same reactor, fermentation organisms (e.g., yeast) convert glucose to the final product using an SSF (simultaneous saccharification and fermentation) method known to those skilled in the art. Depending on the metabolic and hydrolytic capacity of the fermentation organisms, successful operation may require the addition of some exogenous cellulose-decomposing mixture to a greater or lesser extent.

[0079] In a tenth aspect, the present invention also relates to the use of fungal strains belonging to the Ascomycota phylum (excluding fungi belonging to the Yeast class) according to the present invention for hydrolyzing cellulose or lignocellulose into glucose.

[0080] In this specification, the definitions and preferences indicated in one aspect are applied to other aspects with necessary modifications. For example, all the definitions and preferences indicated in the first aspect of the invention above also apply to the second, third, fourth, fifth, sixth, seventh, eighth, ninth, and tenth aspects. Attached Figure Description

[0081] Other features, details and advantages of the invention will become apparent from the accompanying drawings.

[0082] Figure 2 [ Figure 2 This image shows the sensitivity test results for Trichoderma spores in PDA medium (left column, L-canavanine-free; right column, containing 200 μg / mL L-canavanine) and basal medium (MM) (left column, L-canavanine-free; right column, containing 50 μg / mL L-canavanine). The numbers represent the number of spores distributed on each medium.

[0083] Example 1: L-canavanine sensitivity testing of Trichoderma reesei strains [ Figure 1 [ ] Schematic diagram representing the repair matrix used in Example 2.

[0084] MR5' and MR3' represent two 1kb flanking sequences identical to two 1kb regions flanking the target gene, here ID18487637 (67806-TrF1047C); Prom cpc represents the CPC promoter; IM7 represents the IM7 promoter; Term TrpC represents the TrpC terminator; and hygromycin represents the hygromycin resistance gene. The term "Cas9437" refers to the CRISPR-Cas9 tool used.

[0085] The sequence of the present invention [Table 1]

[0086] List of references cited in this patent application Kitagawa, M., and Yamada, H., Studies on the diamino acid, canavanin(II). J. Biochem. (Tokyo) 16, 339-349 (1932). Benjamin E. Volcani, Esmond E. Snell - THE EFFECTS OF CANAVANINE,ARGININE, AND RELATED COMPOUNDS ON THE GROWTH OF BACTERIA – J. Biol. Chem.174: 893-901 Horowitz (N. H.), SRB (A. M.), Growth inhibition of Neurospora bycanavanine and its reversal. Journ. biol. Cbem., 1948, 174, 371 Srb, A. M., 1954 Antibiotic effect of canavanine on yeast. Academiede Sciences Paris Compt. Rend. 239: 447-448. - 1955 Spontaneous and chemically-induced mutations giving rise tocanavanine-resistance in yeast. Compt. Rend. Lab Carlesberg, Ser. Physiol.23: 363 Grenson M, Mousset M, Wiame JM, Bechet J. Multiplicity of the aminoacid permeases in Saccharomyces cerevisiae. I. Evidence for a specificarginine-transporting system. Biochim Biophys Acta 127(2):325-38 Broach JR, Strathern JN, Hicks JB. Transformation in yeast:development of a hybrid cloning vector and isolation of the CAN1 gene. Gene.1979 Dec;8(1):121-33. doi: 10.1016 / 0378-1119(79)90012-x Ahmad M, Bussey H. Yeast arginine permease: nucleotide sequence of the CAN1 gene. Curr Genet. 1986;10(8):587-92. doi: 10.1007 / BF00418125. PMID:3327612. Wong L, Holdridge B, Engel J, Xu P. Genetic Tools for Streamlined andAccelerated Pathway Engineering in Yarrowia lipolytica. Methods Mol Biol. 2019;1927:155-177. doi: 10.1007 / 978-1-4939-9142-6_11 M. Penttilä, H. Nevalainen, M. Ratto, E. Salminen, J. Knowles. Aversatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene, 61 (1987), pp. 155-164, https: / / doi.org / 10.1016 / 0378-1119(87)90110-7 Example Example 2: Transformation of strains using L-canavanine and selection of transformed strains The test included verifying whether the growth of Trichoderma reesei changed when cultured on a medium containing L-canavanine, in order to verify the use of L-canavanine as a selective marker.

[0087] Different amounts of Trichoderma reesei spores from fresh cultures grown on PDA (potato dextrose agar) were spread on two different culture media: - A medium rich in arginine, called PDA, is supplemented with L-canavanine at a concentration of 200 μg / mL.

[0088] - A basic culture medium for culturing Trichoderma without arginine, to which L-canavanine at a concentration of 50 μg / mL is added.

[0089] Observe the spore culture, and the results are as follows: ​ As shown. The results of the enriched culture medium were observed after 4 days, and the results of the basal culture medium were observed after 8 days.

[0090] Spores grew normally on PDA medium (which is a rich medium). On PDA medium supplemented with 200 μg / mL L-canavanine, spores were unaffected by the presence of L-canavanine. Therefore, no growth inhibition was observed in the rich medium after the addition of the antimetabolite.

[0091] On the basal medium, spores grew more slowly than on PDA medium. This result was expected. Growth on basal medium supplemented with 50 μg / mL L-canavanine was significantly different from the control on basal medium (MM) alone. The cells were very small and fragile, and the higher the concentration of L-canavanine, the greater the growth inhibition. The addition of L-canavanine to MM medium (a basal medium without arginine) allowed for a significant effect on cell growth even at low concentrations (50 μg / mL).

[0092] The results confirm that the addition of L-canavanine to the basal medium, especially the arginine-free basal medium, does indeed have a detrimental effect on the growth of Trichoderma reesei.

[0093] Therefore, the addition of L-canavanine can be used as a selective marker, provided that strains sensitive to or insensitive to the addition of L-canavanine in the culture medium can be distinguished.

[0094] ​ The purpose of this experiment was to knock out gene ID 18487637 from Trichoderma reesei and to verify whether its knockout allowed the selection of TRI 67806- transformants (where gene ID 18487637 was knocked out) from TRI 67806+ strains (where gene ID 18487637 was not knocked out).

[0095] Knockout using CRISPR-Cas9 tools resulted in the following components: - Nuclease: Alt-R™ Sp HiFi Cas9 Nuclease V3 -Guide RNA: Alt-R™ CRISPR-Cas9 sgRNA (as shown in SEQ ID NO: 3, CATCCAGTACTGGACCGAGT CGG) A repair matrix (SEQ ID NO: 4) is also used. It consists of the following: -Selective marker: Hygromycin resistance cassette composed of [CPC promoter (SEQ ID NO: 6), IM7 promoter (SEQ ID NO: 7), hygromycin resistance gene (SEQ ID NO: 9), TrpC terminator (SEQ ID NO: 9)], - Two 1kb flanking regions with the same sequence as the two 1kb regions flanking the target gene, here ID 18487637 (SEQ ID NO: 5 and SEQ ID NO: 10).

[0096] All other techniques that can knock out gene ID 18487637, including those mentioned above, can also be used as an alternative to the CRISPR-Cas9 tool.

[0097] The transformation scheme and results are shown in Table 2.

[0098] [Table 2]

[0099] Plan and Results CTS50 corresponds to a diluted solution containing 50 mM CaCl2, 0.1 M Tris-HCl, and 0.4 M sucrose at pH 7.5.

[0100] The regeneration control is used to evaluate the toxicity of the conversion regimen.

[0101] The resulting protoplasts were not subjected to the mutagen (CRISPR-Cas9 RNP complex (nuclease and guide of SEQ ID NO: 3) and the repair template as described above), nor did they grow on selective media. This study, reported and compared with other transformations, provides information on the quality of the transformation protocol.

[0102] Sensitivity controls allow for the assessment of the number of false positives on selective culture media.

[0103] The resulting protoplasts were not subjected to a mutagen (the CRISPR-Cas9 RNP complex (a nuclease and the guide for SEQ ID NO: 3) and the repair template as described above), but they were cultured on a selective medium established for the selection of genetic mutants. These controls allowed for evaluation of the level of false positives, i.e., the number of spontaneous mutants that could grow during screening. For both sensitivity controls and under the conditions described above, the protoplasts could not grow on a medium containing hygromycin or L-canavanine.

[0104] Transformation The resulting protoplasts rendered the mutation in gene ID 18487637, which transports arginine and its antimetabolites, ineffective. Therefore, the transport of arginine and its antimetabolites from the culture medium into the cells was no longer possible. The mutation at site ID 18487637 replaced gene ID 18487637 based on the action of the RNP complex (CRISPR-Cas9 tools: the nuclease described above and the guide RNA of SEQ ID NO: 3) and the insertion of a repair template (SEQ ID NO: 4).

[0105] Transformants were selected on basal medium (MM) + L-canavanine; only those carrying the harmful mutation in gene ID 18487637 were able to grow on the medium containing the antimetabolite. No cells were observed in the L-canavanine-sensitive control, confirming that the transformants corresponded to the expected gene mutation (knockout of gene ID 18487637 and its replacement with a repair template). 142 transformants were obtained.

Claims

1. Filamentous fungal strains belonging to the phylum Ascomycota, excluding fungi belonging to the class Yeastae, among which: - Gene ID 18487637 or its variants or orthologs have been knocked out, or - The gene encoding the protein shown in SEQ ID NO: 2 or a variant or ortholog of it has been knocked out.

2. The fungal strain according to the preceding claims, wherein the fungus belongs to the order Hypocreales, particularly the genus Trichoderma, and even more particularly Trichoderma reesei.

3. The fungal strain according to any one of claims 1-2, wherein gene ID 18487637 or a variant thereof or an orthologous gene corresponds to the gene shown in SEQ ID NO: 1, or has at least 80%, particularly at least 90%, more particularly at least 95% percentage identity with the gene of SEQ ID NO:

1.

4. The fungal strain according to any one of claims 1-2, wherein the gene encoding the protein shown in SEQ ID NO: 2 or a variant or orthologous protein thereof corresponds to the gene encoding the protein shown in SEQ ID NO: 2 or a protein having at least 80%, particularly at least 90%, more particularly at least 95% identity percentage compared to the protein in SEQ ID NO:

2.

5. A method for genetic modification of fungal strains according to any one of claims 1-4, comprising the step of knocking out the gene or a variant thereof or an orthologous gene.

6. Use of L-canavanine as a selective marker for strains according to any one of claims 1-4.

7. The use of L-canavanine according to claim 6, wherein the basic or synthetic medium is free of arginine, and optionally also free of alanine, aspartic acid and / or glutamic acid, in the presence of the basic or synthetic medium.

8. A method for selecting a strain according to any one of claims 1-4, comprising: -Contact the strain with a culture medium containing L-canavanine. - If the strain can grow in the culture medium, then select the strain.

9. A method for producing fungal biomass, comprising the step of culturing a fungal strain according to any one of claims 1-4 in a culture medium containing a suitable substrate.

10. A method for producing a target protein, particularly an enzyme, comprising the step of culturing a fungal strain according to any one of claims 1-4 in a culture medium containing a suitable substrate.

11. A method for producing bio-based products from cellulose or lignocellulose substrates, comprising the step of producing cellulase by using a fungal strain according to any one of claims 1-4.

12. A method for producing a juice or sugar from a cellulose or lignocellulose substrate, comprising: -i) The step of pretreating cellulose or lignocellulose substrates to obtain pretreated substrates. -ii) The step of producing cellulase by using the strain according to any one of claims 1-4, -iii) The step of enzymatically hydrolyzing the pretreated substrate to obtain the hydrolysate in the presence of the cellulase obtained in step ii) and a suitable substrate.

13. A method for producing biofuels from cellulose or lignocellulose substrates, comprising the step of producing cellulase by using a fungal strain according to any one of claims 1-4.

14. The method for producing biofuel from a cellulose or lignocellulose substrate according to claim 13, comprising: -i) The step of pretreating cellulose or lignocellulose substrates to obtain pretreated substrates. -ii) The step of producing cellulase by using the strain according to any one of claims 1-4, -iii) The step of enzymatically hydrolyzing the pretreated substrate to obtain the hydrolysate in the presence of the cellulase obtained in step ii) and a suitable substrate. -iv) The alcoholic fermentation step of the hydrolysate obtained, step iv) is optionally carried out simultaneously with step iii). -v) Separation steps, especially by distillation.

15. Use of the fungal strain according to any one of claims 1-4 for hydrolyzing cellulose or lignocellulose into glucose, for producing bio-based products from cellulose or lignocellulose substrates, biofuels, sugar-containing juices or sugars, and / or for producing target proteins, more particularly enzymes, especially cellulases.