Protease and aldc enzyme for reducing beer haze and diacetyl

Abstract

The present invention relates to novel stable forms of acetolactate decarboxylase (ALDC) enzymes that have improved stability in the presence of proteases. More particularly, the present invention relates to an improved brewing process in which a stabilized ALDC is used in conjunction with a proline-specific endoprotease during beer fermentation to provide a less off-flavor, colloid-stabilized beer in a shortened time.

Description

Cross-references to related applications

[0001] This application claims priority to U.S. Application No. 63 / 580,057, filed September 1, 2023, which is hereby incorporated by reference in its entirety. Technical Field

[0002] This invention relates to a novel stable form of acetyllactate decarboxylase (ALDC), which exhibits improved stability in the presence of a protease. More particularly, this invention relates to an improved brewing process in which stable ALDC is combined with a proline-specific endopeptide during beer fermentation to deliver beer with fewer off-flavors and colloidal stability in a shorter time. References to sequence lists

[0003] The electronic submission of the sequence list text file named “NB42237USPSP_SequenceListing.xml”, created on August 31, 2023, is 60 KB in size and is hereby incorporated in its entirety by reference. Background Technology

[0004] In industrial beer brewing, the overall speed of the brewing process is crucial. Large-scale storage and refrigeration of beer significantly impact capital investments related to energy and storage space. Before bottling, beer typically undergoes two stages: maturation and stabilization. The stabilization stage provides the beer with colloidal stability, enabling it to be stored under refrigeration until consumer purchase. Maturation, on the other hand, is the necessary stage to remove unwanted off-flavors from the beer.

[0005] Beer is prone to colloidal instability because turbidity develops during bottling and refrigeration before sale. This phenomenon is called refrigerated turbidity. When beer cools, the polyphenols in the beer interact with proline-rich proteins (turbidity-active proteins) to form precipitates or turbidity. Refrigerated turbidity in bottled beer is highly undesirable. The cold stabilization phase before filtration and bottling helps eliminate or at least reduce refrigerated turbidity. However, a typical stabilization phase can last 7 days or longer and requires cooling to 0°C or even -2°C. The energy cost required to cool thousands of liters of beer to such low temperatures is extremely high.

[0006] Fermentation (the conversion of fermentable sugars in wort into alcohol) produces what is known as "draft beer." Draft beer contains high levels of undesirable flavor components, especially diketones such as diacetyl. Diacetyl has a strong, buttery off-flavor and is considered highly undesirable in most beers. Converting diacetyl into a milder compound is an important aspect of the subsequent maturation process. However, reducing diacetyl to the flavorless acetoin is a time-consuming but crucial process.

[0007] Enzymes have been employed to shorten or eliminate the stabilization and / or maturation stages. For example, proteases are known in the art to reduce the stabilization stage. Suitable proteases can be used to selectively degrade proteins in beer that can bind to polyphenols and cause colloidal instability. Acetolactate decarboxylase (ALDC) can be used to convert α-acetolactate into flavorless acetoin, thereby shortening the maturation stage. However, proteases added to beer during fermentation to provide colloidal stability may hydrolyze other exogenously added enzymes, including ALDC enzymes. It is unclear whether further shortening of the brewing process can be achieved by combining proteases with ALDC enzymes in the same step.

[0008] Therefore, there is a continued need for ALDC enzymes with lower proteolytic sensitivity, as well as proteases that can be used to improve the colloidal stability of beer and have higher specificity for turbidity-active proteins. Summary of the Invention

[0009] According to one aspect of the invention, it has been found that ALDC enzymes used in the brewing process to shorten the maturation stage are unstable in the presence of proline-specific proteases used to improve the colloidal stability of beer. The degradation of ALDCs prolongs, rather than shortens, the maturation stage. Accordingly, in one aspect of the invention, a polypeptide with acetolactate decarboxylase activity and resistance to protease inactivation is presented, the polypeptide having an amino acid sequence with at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has at most 250 amino acids. Optionally, the polypeptide has at most 249, 248, 247, 246, 245, 244, 243, 242, or 241 amino acids.

[0010] Optionally, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity and resistance to protease inactivation has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. Optionally, the polypeptide has the amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0011] The protease resistant to ALDC is optionally a proline-specific protease. More preferably, the proline-specific protease is derived from *Aspergillus niger*. Optionally, the protease has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:17. Optionally, the protease has the amino acid sequence according to SEQ ID NO:17.

[0012] In another aspect of the invention, an improved brewing process is presented, comprising the steps of fermenting wort in the presence of a polypeptide having acetolactate decarboxylase activity and resistance to protease inactivation, and a proline-specific protease, wherein both enzymes are present simultaneously in the wort. Optionally, the amino acid sequence of the polypeptide has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has at most 250 amino acids. Optionally, the polypeptide has at most 249, 248, 247, 246, 245, 244, 243, 242, or 241 amino acids.

[0013] Optionally, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity and resistance to protease inactivation has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. Optionally, the polypeptide has the amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0014] Optionally, a polypeptide with acetolactate decarboxylase activity is first added to the wort. In other preferred embodiments, a proline-specific protease is first added to the wort. Optionally, the polypeptide with acetolactate decarboxylase activity and the proline-specific protease are added to the wort simultaneously.

[0015] The proline-specific protease is optionally derived from Aspergillus niger. Optionally, the proline-specific protease has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:17.

[0016] In another aspect of the invention, a Bacillus host cell for producing heterologous target polypeptides is presented, wherein one or more protease genes have been inactivated.

[0017] Optionally, the target polypeptide is expressed without a secretion signal peptide. Optionally, the target polypeptide is expressed with a secretion signal.

[0018] Optionally, the target polypeptide is an enzyme. Optionally, the enzyme is an oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, aminopeptidase, amylase, asparaginase, glycosylase, carboxypeptidase, catalase, cellulase, chitinase, keratinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, α-galactosidase, β-galactosidase, glucosylamylase, α-glucosidase, β-glucosidase, hyaluronic acid synthase, invertase, laccase, lipase, mannosidase, polysaccharidase, oxidase, pectinase, peroxidase, phytase, polyphenol oxidase, protease, ribonuclease, transglutaminase, or xylanase.

[0019] Optionally, the enzyme is an ALDC enzyme. Optionally, the ALDC enzyme is a polypeptide whose amino acid sequence has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has at most 250 amino acids. Optionally, the polypeptide has at most 249, 248, 247, 246, 245, 244, 243, 242, or 241 amino acids.

[0020] Optionally, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. Optionally, the polypeptide has the amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0021] Optionally, the ALDC enzyme is expressed with a secretion signal. Optionally, the heterologous target polypeptide is encoded by a foreign polynucleotide that is integrated into the host cell's chromosome in at least one copy. Optionally, the foreign polynucleotide is a nucleic acid sequence having 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:28. Optionally, the foreign polynucleotide is a nucleic acid sequence according to SEQ ID NO:28.

[0022] Optionally, the one or more protease genes are inactivated by nonsense mutations within the one or more genes, partial deletion of the one or more genes, or complete deletion of the one or more genes.

[0023] Optionally, the host cell of the Bacillus is Bacillus subtilis or Bacillus licheniformis. Optionally, the host cell of the Bacillus is Bacillus subtilis.

[0024] Optionally, the one or more protease genes are selected from the group consisting of nucleic acid sequences having at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:27. Optionally, the one or more protease genes comprise nine inactivated proteases, wherein the nucleic acid sequences of these proteases have at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:27. Optionally, the nine inactivated protease genes have nucleic acid sequences according to SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:27.

[0025] In another aspect of the invention, a method for generating a target polypeptide is presented, the method comprising the steps of: i) providing a Bacillus host cell wherein one or more protease genes have been inactivated, and wherein said host cell is transformed with a nucleic acid encoding a heterologous polypeptide, the nucleic acid being operatively coupled to a promoter; and

[0026] ii) The host cells are cultured under conditions suitable for the production of the heterologous polypeptide, thereby producing the heterologous polypeptide. Optionally, the method further includes the step of recovering the produced polypeptide.

[0027] Optionally, the target polypeptide is expressed with or without a secretion signal peptide. Optionally, the target polypeptide is expressed with a secretion signal peptide.

[0028] Optionally, the target polypeptide is an enzyme. Optionally, the enzyme is an oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, aminopeptidase, amylase, asparaginase, glycosylase, carboxypeptidase, catalase, cellulase, chitinase, keratinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, α-galactosidase, β-galactosidase, glucosylamylase, α-glucosidase, β-glucosidase, hyaluronic acid synthase, invertase, laccase, lipase, mannosidase, polysaccharidase, oxidase, pectinase, peroxidase, phytase, polyphenol oxidase, protease, ribonuclease, transglutaminase, or xylanase.

[0029] Optionally, the enzyme is an ALDC enzyme. Optionally, the ALDC enzyme is a polypeptide whose amino acid sequence has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has at most 250 amino acids. Optionally, the polypeptide has at most 249, 248, 247, 246, 245, 244, 243, 242, or 241 amino acids.

[0030] Optionally, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. Optionally, the polypeptide has the amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0031] Optionally, the ALDC enzyme is expressed with a secretion signal. Optionally, the heterologous target polypeptide is encoded by a foreign polynucleotide that is integrated into the host cell's chromosome in at least one copy. Optionally, the foreign polynucleotide is a nucleic acid sequence having 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:28. Optionally, the foreign polynucleotide is a nucleic acid sequence according to SEQ ID NO:28.

[0032] Optionally, the one or more protease genes are inactivated by nonsense mutations within the one or more genes, partial deletion of the one or more genes, or complete deletion of the one or more genes.

[0033] Optionally, the host cell of the Bacillus is Bacillus subtilis or Bacillus licheniformis. Optionally, the host cell of the Bacillus is Bacillus subtilis.

[0034] Optionally, the one or more protease genes are selected from the group consisting of nucleic acid sequences having at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:27. Optionally, the one or more protease genes comprise nine inactivated proteases, wherein the nucleic acid sequences of these proteases have at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:27. Optionally, the nine inactivated protease genes have nucleic acid sequences according to SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:27.

[0035] In another aspect of the invention, a stable liquid formulation comprises a polypeptide having acetolactate decarboxylase activity and a protease, the polypeptide having an amino acid sequence identity of at least 80%, 90%, 95%, 98%, 99%, or 100% with SEQ ID NO:3, wherein the polypeptide has at most 250 amino acids. Optionally, the polypeptide has at most 249, 248, 247, 246, 245, 244, 243, 242, or 241 amino acids.

[0036] Optionally, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. Optionally, the polypeptide has the amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0037] The protease is optionally a proline-specific protease. Optionally, the proline-specific protease is derived from *Aspergillus niger*. Optionally, the protease has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:17. Optionally, the protease has the amino acid sequence according to SEQ ID NO:17.

[0038] Optionally, when the stable liquid formulation is stored at 10°C for 30, 60, 90, 120, 150 or 180 days, the ALDC peptide retains at least 99%, 98%, 95%, 90%, 85%, 80%, 75% or 70% of its activity.

[0039] Optionally, when the stable liquid formulation is stored at 30°C for 8 hours, 16 hours, 24 hours, 32 hours, 40 hours or 48 hours, the ALDC peptide retains at least 99%, 98%, 95%, 90%, 85%, 80%, 75% or 70% of its activity.

[0040] In another aspect of the invention, a proline-specific protease formulation is presented, which, when containing the protease, is substantially free of other protease activities, wherein the protease remains stable over time when combined with a polypeptide having acetolactate decarboxylase activity. Optionally, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has up to 250 amino acids and the protease.

[0041] Optionally, the polypeptide has up to 249, 248, 247, 246, 245, 244, 243, 242 or 241 amino acids.

[0042] Optionally, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. Optionally, the polypeptide has the amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0043] The protease is optionally a proline-specific protease. Optionally, the proline-specific protease is derived from *Aspergillus niger*. Optionally, the protease has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:17. Optionally, the protease has the amino acid sequence according to SEQ ID NO:17.

[0044] Optionally, when the stable liquid formulation is stored at 10°C for 30, 60, 90, 120, 150 or 180 days, the ALDC peptide retains at least 99%, 98%, 95%, 90%, 85%, 80%, 75% or 70% of its activity.

[0045] Optionally, when the stable liquid formulation is stored at 30°C for 8 hours, 16 hours, 24 hours, 32 hours, 40 hours or 48 hours, the ALDC peptide retains at least 99%, 98%, 95%, 90%, 85%, 80%, 75% or 70% of its activity. Brief description of biological sequences

[0046] SEQ ID NO:1 shows the nucleotide sequence of the wild-type aldB gene.

[0047] SEQ ID NO:2 shows the amino acid sequence of the ALDC aldB precursor protein.

[0048] SEQ ID NO:3 shows the predicted amino acid sequence of mature acetolactate decarboxylase (ALDC) aldB.

[0049] SEQ ID NO:4 shows the nucleotide sequence of the mature form of the aldB gene in plasmid alarA(CB)RIHI-Bbr.

[0050] SEQ ID NO:5 shows the amino acid sequence of the aldB precursor protein expressed by plasmid alrA(CB)RIHI-Bbr.

[0051] SEQ ID NO:6 shows the amino acid sequence of altB_BS truncated variant 1.

[0052] SEQ ID NO:7 shows the amino acid sequence of altB_BS truncated variant 2.

[0053] SEQ ID NO:8 shows the amino acid sequence of altB_BS truncated variant 3.

[0054] SEQ ID NO:9 shows the amino acid sequence of altB_BS truncated variant 4.

[0055] SEQ ID NO:10 shows the amino acid sequence of altB_BS truncated variant 5.

[0056] SEQ ID NO:11 shows the amino acid sequence of altB_BS truncated variant 6.

[0057] SEQ ID NO:12 shows the amino acid sequence of altB_BS truncated variant 7.

[0058] SEQ ID NO:13 shows the amino acid sequence of altB_Bl truncated variant 1.

[0059] SEQ ID NO:14 shows the amino acid sequence of altB_Bl truncated variant 2.

[0060] SEQ ID NO:15 shows the amino acid sequence of the truncated variant 3 of aldB_Bl.

[0061] SEQ ID NO:16 shows the AniPro_2 precursor protein.

[0062] SEQ ID NO:17 shows the mature AniPro_2 protein.

[0063] SEQ ID NO:18 shows the aprE gene sequence of Bacillus subtilis.

[0064] SEQ ID NO:19 shows the nprE gene sequence of Bacillus subtilis.

[0065] SEQ ID NO:20 shows the nprE gene sequence of Bacillus subtilis.

[0066] SEQ ID NO:21 shows the ispA gene sequence of Bacillus subtilis.

[0067] SEQ ID NO:22 shows the Bacillus subtilis bpr gene sequence.

[0068] SEQ ID NO:23 shows the wprA gene sequence of Bacillus subtilis.

[0069] SEQ ID NO:24 shows the vpr gene sequence of Bacillus subtilis.

[0070] SEQ ID NO:25 shows the Mpr gene sequence of Bacillus subtilis.

[0071] SEQ ID NO:26 shows the gene sequence of Bacillus subtilis ybfj.

[0072] SEQ ID NO:27 shows the nprB gene sequence of Bacillus subtilis.

[0073] SEQ ID NO:28 shows the DNA sequence of the aldB gene fused with the aprE signal peptide.

[0074] SEQ ID NO:29 shows the AL2 primer.

[0075] SEQ ID NO:30 shows the AL9 primer.

[0076] SEQ ID NO:31 shows the AL3 primer.

[0077] SEQ ID NO:32 shows the AL10 primer.

[0078] SEQ ID NO:33 shows the forward primers for AL19, alrA(CB)RIHI.

[0079] SEQ ID NO:34 shows the reverse primers AL20, alrA(CB)RIHI.

[0080] SEQ ID NO:35 shows the AL21, Bbrev-RIHI forward primer.

[0081] SEQ ID NO:36 shows the AL22, Bbrev-RIHI reverse primer.

[0082] SEQ ID NO:37 shows the ydoC400F primer.

[0083] SEQ ID NO:38 shows the alarA-ATG-R primer.

[0084] SEQ ID NO:39 shows the yhfO-RI-R primer.

[0085] SEQ ID NO:40 shows the Bbrev-R(aprE) primers. Attached Figure Description

[0086] Figure 1 The plasmid map of pCB_alr is shown.

[0087] Figure 2 The plasmid map of alrA(CB)RIHI-Bbr used to express acetolactate decarboxylase aldB is shown.

[0088] Figure 3 A-3B shows a) the maximum VDK level reached during the fermentation of all-malt beer when ALDC and PEP were used in combination; b) the number of hours required for VDK to decrease to 0.100 mg / L when ALDC and PEP (applied as a single addition) were used in combination on the right.

[0089] Figure 4 A-4B shows a) the maximum VDK level achieved during the fermentation of all-malt beer when ALDC was used in combination with PEP (added as a premixed mixture left to stand at 30°C for 6 hours); b) the number of hours required for VDK to decrease to 0.100 mg / L when ALDC was used in combination with PEP (applied as a premixed mixture left to stand at 30°C for 6 hours).

[0090] Figure 5 A-5B shows the turbidity (EBC 90°) of beer with and without proline-specific protease, ALDC, and combinations thereof. Forced turbidity was measured according to the EBC TOHA method, and A) initial total turbidity and B) final total turbidity are shown. Standard deviation was determined by two measurements. All enzymes were dosed at 0.5 or 2.0 g / hL.

[0091] Figure 6 A-6B shows the turbidity (EBC 25°) of beer with and without proline-specific protease, ALDC, and combinations thereof. Forced turbidity was measured according to the EBC TOHA method, and A) initial total turbidity and B) final total turbidity are shown. Standard deviation was determined by two measurements. All enzymes were administered at doses of 0.5 or 2.0 g / hL.

[0092] Figure 7 A-7E shows SDS-PAGE, which demonstrates the combination of ALDC (aldB, 29-32 kDa) and PEP (56-62 kDa), or the presence of either enzyme alone, in samples incubated at 30°C for up to 24 hours. The truncated aldB variant premixed with PEP is shown at a lower molecular weight (aldB truncated < 28 kDa).

[0093] Figure 8A-8B illustrates the formation of vitamin DK (VDK) during beer fermentation using only aldB_Bl, or a mixture of aldB_Bl and AnPro (bl-50%:50%), or a mixture of aldB_Bl and AniPro_2 (bl). The application of aldB_Bs alone, or a mixture of aldB_Bs and AnPro (bl-50%:50%), or a mixture of aldB_Bs and AniPro_2 (bl) is also shown. Additionally, AniPro_2 alone and a control sample (Ctrl) without added enzyme are also shown. Detailed Implementation

[0094] definition

[0095] The term "amino acid sequence" is synonymous with and interchangeable with the terms "polypeptide," "protein," and "peptide." When such an amino acid sequence exhibits activity, it can be called an "enzyme." Using conventional single-letter or three-letter codes for amino acid residues, the amino acid sequence is presented in a standard N-terminal to C-terminal orientation (i.e., N→C).

[0096] The term "nucleic acid" encompasses DNA, RNA, heteroduplexes, and synthetic molecules capable of encoding polypeptides. Nucleic acids can be single-stranded or double-stranded. The terms "nucleic acid" and "polynucleotide" are used interchangeably. Because the genetic code is degenerate, more than one codon can be used to encode a specific amino acid; therefore, the compositions and methods of the present invention cover nucleotide sequences encoding specific amino acid sequences. Unless otherwise stated, nucleic acid sequences are presented in a 5′ to -3′ orientation.

[0097] A "vector" is a multinucleotide sequence designed to introduce nucleic acids into one or more cell types. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, phage particles, expression cassettes, etc.

[0098] An "expression vector" is a DNA construct containing a DNA sequence encoding a target polypeptide, operatively linked to a suitable regulatory sequence that enables expression of that DNA sequence in a suitable host. Such regulatory sequences may include promoters for transcription, optional operon sequences controlling transcription, sequences encoding suitable ribosome-binding sites on the mRNA, enhancers, and sequences controlling the termination of transcription and translation.

[0099] In addition to the specific amino acid sequences and polynucleotides mentioned herein, this invention also covers their variants, homologs, derivatives and fragments.

[0100] The term "variant" is used to refer to a nucleotide or amino acid sequence that differs from the wild-type sequence.

[0101] For example, variants, relative to the wild-type sequence, can include substitutions, insertions, deletions, truncations, transversions, and / or inversions at one or more positions. Variants can be prepared using methods known in the art (e.g., site-scanning mutagenesis, insertional mutagenesis, random mutagenesis, site-directed mutagenesis, and directed evolution) and recombination methods well-known in the art. Polynucleotide sequences encoding the amino acid sequence of the variant can be readily synthesized using methods known in the art.

[0102] In some respects, a variant is a naturally occurring nucleotide or amino acid sequence that differs from the wild-type sequence. For example, a variant can be a naturally occurring genetic variant.

[0103] In some respects, variants are engineered variants. For example, variants can be engineered through recombination methods.

[0104] The protein sequences of this invention can also have deletions, insertions, or substitutions of amino acid residues, thereby generating silent mutations and producing functionally equivalent substances. Intentional amino acid substitutions can be made based on the similarity of residue polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilicity, provided that the secondary binding activity of the substance is preserved. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values ​​include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.

[0105] For example, conservative substitutions can be performed according to the table below. As shown in Table 1 below, amino acids in the same box in the second column can be substituted for each other, and preferably amino acids in the same row in the third column can be substituted for each other.

[0106] Table 1

[0107]

[0108] This invention also covers possible homologous substitutions (substitution and substitution are used herein to mean the exchange of existing amino acid residues with substituted residues), i.e., equivalent substitutions, such as basic to basic, acidic to acidic, polar to polar, etc. Non-homologous substitutions may also occur, i.e., from one class of residues to another class of residues or alternatively involving non-natural amino acids, such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), ortholeucine ornithine (hereinafter referred to as O), pyridylalanine, thiophenylalanine, naphthylalanine, and phenylglycine.

[0109] Substitution can also be achieved by synthesizing amino acids (e.g., non-natural amino acids), including: α and α-disubstituted amino acids, N-alkyl amino acids , lactic acid Halogenated derivatives of natural amino acids (such as trifluorotyrosine) p-Cl-phenylalanine p-Br-phenylalanine p-I-phenylalanine L-allyl-glycine β-alanine La-aminobutyric acid Lg-aminobutyric acid La-aminoisobutyric acid Le-aminocaproic acid # 7-Aminoheptanoic acid L-methionine sulfone # L-leucine L-valine p-Nitro-L-phenylalanine L-hydroxyproline # L-Thioproline Methyl derivatives of phenylalanine (Phe), such as 4-methyl-Phe Pentamethyl-Phe L-Phe (4-amino) # L-Tyr (methyl) L-Phe (4-isopropyl) L-Tic (1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid) L-Diaminopropionic acid # and L-Phe (4-benzyl) .

[0110] For the purposes of the above discussion (related to homologous or non-homologous substitution), the symbol # is used to refer to the hydrophobic properties of derivatives, while # is used to refer to the hydrophilic properties of derivatives. Refers to the characteristics of both parents.

[0111] Variant amino acid sequences may contain suitable spacer groups that can be inserted between any two amino acid residues in the sequence, including alkyl groups such as methyl, ethyl, or propyl groups in addition to amino acid spacer groups such as glycine or β-alanine residues. Other variant forms (involving the presence of one or more amino acid residues in a peptide-like form) will be well understood by those skilled in the art. For the avoidance of doubt, “peptide-like form” is used to refer to variant amino acid residues in which the α-carbon substituent group is on the nitrogen atom of the residue, rather than on the α-carbon. Methods for preparing peptides in peptide-like forms are known in the art, for example, Simon RJ et al., PNAS (1992) 89(20), 9367-9371 and Horwell DC, Trends Biotechnol. (1995) 13(4), 132-134.

[0112] The nucleotide sequences used in this invention may contain synthetic or modified nucleotides. Several different types of modifications to oligonucleotides are known in the art. This includes the addition of acridine or polylysine chains to the 3' and / or 5' ends of the molecule, along with methylphosphonate and thiophosphate backbones. For the purposes of this invention, it should be understood that the nucleotide sequences described herein can be modified by any method available in the art. Such modifications can be made to enhance the in vivo activity or lifetime of the nucleotide sequences of this invention.

[0113] This invention also covers the use of nucleotide sequences complementary to the sequences presented herein.

[0114] Other variants of the sequences described herein can be obtained, for example, by probe screening from DNA libraries prepared from a range of individuals (e.g., individuals from different populations). Furthermore, other homologs are available, and such homologs and fragments thereof are generally capable of selectively hybridizing with the sequences shown in the sequence listing herein. Such sequences can be obtained by probe screening of cDNA or genomic DNA libraries prepared from other animal species, and by probe screening such libraries under moderate to high stringency conditions using probes containing all or part of any of the sequences included in the appended sequence listing. Similar considerations apply to obtaining species homologs and allelic variants of the polypeptide or nucleotide sequences of the present invention.

[0115] Variants and strain / species homologs can also be obtained using degenerate PCR, which uses primers designed to target sequences within variants and homologs that encode conserved amino acid sequences within the sequences of this invention. Conserved sequences can be predicted, for example, by comparing amino acid sequences from several variants / homologs. Sequence alignment can be performed using computer software known in the art. For example, the GCG Wisconsin PileUp program is widely used.

[0116] Primers used in degenerate PCR will contain one or more degenerate positions and will be used under less stringent conditions than those used for cloning sequences from known sequences with single-sequence primers.

[0117] Alternatively, such polynucleotides can be obtained by site-directed mutagenesis of the characterized sequence. This can be useful, for example, in situations where a silent codon sequence alteration is needed to optimize the codon preference of the polynucleotide sequence expressed in a specific host cell. Other sequence alterations may be desired to introduce restriction endonuclease recognition sites or to change the properties or function of the polypeptide encoded by the polynucleotide.

[0118] Unless otherwise indicated, this invention employs conventional biochemical, molecular biological, microbiological, and recombinant DNA techniques, which are within the capabilities of a person skilled in the art. Such techniques are explained in the literature. For example, see: J. Sambrook, EF Fritsch, and T. Maniatis, 1989, *Molecular Cloning: A Laboratory Manual*, 2nd ed., Volumes 1–3, Cold Spring Harbor Laboratory Press; Ausubel, FM et al. (1995 and regular supplements); *Current Protocols in Molecular Biology*, Chapters 9, 13, and 16, John Wiley & Sons, New York, NY; B. Roe, J. Crabtree, and A. Kahn, 1996, *DNA Isolation and Sequencing: Essential Techniques*, John Wiley & Sons; MJ Gait (ed.), 1984, *Oligonucleotide Synthesis: A Practical Approach*, IrIPress [IrI Publishing]; and DMJ Lilley and JE Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. Each of these general texts is incorporated herein by reference.

[0119] As used herein, “sequence identity percentage (%)” means that when aligned using the CLUSTAL W algorithm with default parameters, a given sequence has at least a certain percentage of amino acid residues that are identical to those in a specified reference sequence. See Thompson et al. (1994) Nucleic Acids Res. [Nucleic Acid Research] 22:4673-4680. The default parameters for the CLUSTAL W algorithm are:

[0120] Open shot penalty: 10.0

[0121] Extended penalty for open looks: 0.05

[0122] Protein weight matrix: BLOSUM series

[0123] DNA weight matrix: IUB

[0124] Delayed divergence sequence %: 40

[0125] Empty space separation distance: 8

[0126] DNA conversion weight: 0.50

[0127] List of hydrophilic residues: GPSNDQEKR

[0128] Using a negative matrix: [closed]

[0129] Switching special residue penalty: On

[0130] Switch to hydrophilic penalty: On

[0131] Switch to end-space separation penalty: Off

[0132] Deletions are considered distinct residues compared to a reference sequence. This includes deletions occurring at either end. For example, a variant with a 5-amino acid deletion at the C-terminus of a mature polypeptide of 617 amino acid residues has a 99% sequence identity percentage relative to the mature polypeptide (612 identical residues / 617 residues × 100, rounded to the nearest integer). Such variants will be covered by variants having “at least 99% sequence identity” with the mature polypeptide.

[0133] According to the present invention, the proteins (including enzymes) of the present invention exist in a variety of forms. The proteins of the present invention can be cleaved or truncated (i.e., amino acid removal) from their N-terminus and / or C-terminus to produce shorter proteins. The proteins of the present invention may also have internal deletions. Shorter proteins, as described herein, may have higher or lower activity than their longer counterparts. Without being bound by theory, as used herein, the term "preproproteinogen" refers to a protein (including enzymes) with an N-terminal signal peptide that directs the secretion of the protein. Preproproteinogens are sometimes also referred to herein as "full-length" or "full-length protein." The N-terminal signal peptide is cleaved in the endoplasmic reticulum to produce a "proproteinogen." As used herein, a proproteinogen is shorter than a full-length protein (it lacks the signal peptide) but longer than a mature protein. Typically, a proproteinogen is inactive or less active compared to a mature protein. A proproteinogen can be activated by post-translational modifications (such as N- or C-terminal cleavage) or converted into a more active mature form. A proproteinogen that is an enzyme may be referred to as a "proenzyme" or "zymogen." The cleaved active protein (derived from the proteogen) is also referred to herein as a mature protein. It should be noted that the above terminology is used for convenience and does not imply denial or determination of the activity of the proteins of the present invention. It should also be noted that any protein of the present invention may have more than one variant described by the same terminology.

[0134] All references cited in this specification are incorporated herein by reference in their entirety. In particular, the teachings of all references specifically referenced herein are incorporated herein by reference.

[0135] Unless otherwise defined, all terms used in disclosing this invention (including technical and scientific terms) shall have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. Further guidance is provided by incorporating these terminology definitions to better understand the teachings of this invention.

[0136] Other definitions are shown below.

[0137] beer

[0138] As used herein, the term "beer" traditionally refers to an alcoholic beverage derived from malt (which is derived from barley) and optional adjuncts (such as grains), and flavored with hops. Beer can be produced from a variety of grains using essentially the same process. All grain starches are glucose homopolymers, in which glucose residues are linked by either α-1,4- or α-1,6- bonds, with the former being dominant. The process of preparing fermented malt beverages is generally referred to as brewing. The main ingredients used to make these beverages are water, hops, and malt. In addition, adjuncts such as plain corn grits, refined corn grits, brewer's yeast, rice, sorghum, refined corn starch, barley, barley starch, hulled barley, wheat, wheat starch, baked cereals, cereal flakes, rye, oats, potatoes, cassava, and syrups such as corn syrup, cane syrup, invert sugar syrup, barley and / or wheat syrup can be used as sources of starch. The starch is eventually converted into dextrins and fermentable sugars. For several reasons, malt, primarily derived from the selected barley variety, has the greatest impact on the overall characteristics and quality of beer. First, malt is the main flavoring agent in beer. Second, malt provides most of the fermentable sugars. Third, malt provides proteins, which determine the body and foam characteristics of the beer. Fourth, malt provides the enzyme activity required for mashing.

[0139] As used in this article, the term "hops" refers to its use in significantly enhancing beer quality, including flavor. Hops (or hop components) can add desired bitter substances to beer. In addition, hops act as a protein precipitant, build preservatives, and help with foam formation and stabilization.

[0140] As used herein, the “beer preparation process” is a well-known process in the art, which, in short, involves five steps: (a) mashing and / or adjunct cooking; (b) wort separation and extraction; (c) wort boiling and hop addition; (d) cooling, fermentation, and storage; and (e) maturation, processing, and packaging. In the first step, ground or pulverized malt is mixed with water and kept at a controlled temperature for a period of time, allowing enzymes present in the malt to convert the starch in the malt into fermentable sugars. In the second step, the mashed mash is transferred to a “filter” or mash filter to separate the liquid from the grain residue. This sweet liquid is called “wort,” and the remaining grain residue is called “wild grains.”

[0141] The mash typically undergoes extraction, which involves adding water to the mash to recover any remaining soluble extracts from the wasps. In the third step, the wort is vigorously boiled. This step sterilizes the wort and helps develop color, flavor, and aroma. Hops are added at some point during boiling. In the fourth step, the wort is cooled and transferred to a fermentation tank containing yeast, or yeast is added to it. After the yeast is added, this liquid is called the fermentation liquid. The yeast converts sugar into alcohol and carbon dioxide gas through fermentation; the fermentation tank is cooled at the end of fermentation, or fermentation can be terminated by cooling the fermentation tank. The yeast flocculates and is removed. In the final step, the beer is cooled and stored for a period of time, during which time the beer clarifies, flavor develops, and any substances that might affect the beer's appearance, flavor, and shelf life precipitate out. Before bottling, the beer is carbon dioxide-puffed and optionally filtered and pasteurized. After fermentation, a beverage is obtained that typically contains about 2% to about 10% alcohol by weight. During fermentation, non-fermentable carbohydrates are not converted and form most of the dissolved solids in the final beer. This residue remains because malt amylase cannot hydrolyze the α-1,6-bonds in starch. In every 12 ounces of beer, non-fermentable carbohydrates provide approximately 50 calories.

[0142] In the context of brewing, the term "fermentation" refers to the process by which enzymes in brewing yeast convert the sugars in wort into ethanol and carbon dioxide, and to the formation of other fermentation byproducts.

[0143] As used in this article, "fermentation broth" refers to a liquid solution undergoing a fermentation process, in which yeast or bacteria cause chemical changes in food, beer, or beverages, producing carbon dioxide and converting carbohydrates into alcohol.

[0144] As used in this article, the term "malt" should be understood as any germinated grain, such as barley.

[0145] As used in this article, the term "wheat wort" refers to the unfermented liquid run-off that remains after the malt powder (grist) has been extracted during saccharification.

[0146] As used in this article, the term "malt residue" refers to the drained solids remaining after the extraction of malt powder and the separation of malt wort from saccharified mash.

[0147] As used in this article, the term "beer" refers to fermented wort, such as an alcoholic beverage brewed from barley malt, optional adjuncts, and hops.

[0148] ALDC

[0149] In some respects, the present invention provides ALDC enzymes with better stability and activity, and further capable of being recovered from microorganisms in improved yields.

[0150] Acetolactate decarboxylase (ALDC) is an enzyme belonging to the carboxyl lyase family, responsible for cleaving carbon-carbon bonds. ALDC catalyzes the conversion of 2-acetolactate (also known as 2-hydroxy-2-methyl-3-oxobutyric acid) to 2-acetoin, releasing CO2.

[0151] Acetolactate decarboxylase catalyzes enzymatic reactions and belongs to classification EC 4.115 (acetolactate decarboxylase activity) and Gene Ontology (GO) term ID GO: 0047605. A GO term ID specifies any protein characterized by having that relevant GO term encodes an enzyme with catalytic acetolactate decarboxylase activity.

[0152] Several acetolactate decarboxylase (alsD) genes encoding acetolactate decarboxylase are known in the art. Examples of the alsD gene include, but are not limited to: gil3751436271reflYP 005006068.11 acetolactate decarboxylase [Niastella koreensis OR20-1 0] (Korea Agricultural Research Institute); gil361 0576731gb1AEV96664.11 acetolactate decarboxylase [Niastella koreensis OR20-10] (Korea Agricultural Research Institute); gi12187634151gb1ACL0588l.11 acetolactate decarboxylase [Desulfatibacillum alkenivorans AK-01] (Desulfatibacillum alkenivorans AK-01); gil220909520lreflYP002484831.11 acetolactate decarboxylase [Cyanothece sp. PCC 7425] (Cyanothece sp.); gil2187820311reflYP 002433349.11 Acetolactate decarboxylase [Desulfobacterium AK-Ol]; gi12136930901ref1YP 002323676.11 Acetolactate decarboxylase [Bifidobacterium longum subsp. infantis ATCC 15697 = JCM 1222]; gil1895002971reflYP 001959767.11 Acetolactate decarboxylase [Chlorobium phaeobacteroides BS 1]; gil 1894237871reflYP 001950964.11 Acetolactate decarboxylase [Geobacter lovleyi SZ]; gil 1720582711ref1YP 00181473l.11 Acetolactate decarboxylase [Exiguobacterium sibiricum 255-15]; gil1639387751reflYP 001643659.11 Acetolactate decarboxylase [Bacillus weihenstephanensis KBAB4]; gil 1585223041reflYP 001530174.11 Acetolactate decarboxylase [Desulfococcus oleovorans Hxd3]; gil 157371670lreflYP001479659.11 Acetolactate decarboxylase [Serratia proteamaculans 568]; gil 11503951111ref1YP 001317786.11 Acetolactate decarboxylase [Staphylococcus aureus subsp. aureus JHl]; gil 1503947151reflYP 001317390.11 Acetolactate decarboxylase [Staphylococcus aureus subsp. aureus JHl]; gil 1463116791ref1YP001176753.11 Acetolactate decarboxylase [Enterobacter sp. 638]; gil 109900061 IreflYP 663316.11 Acetolactate decarboxylase [Pseudoalteromonas atlantica T6c]; giI219866131IgbIACL46470.11 Acetolactate decarboxylase [Cyanobacterium species PCC 7425]; giI213524551IgbIACJ53298.11 Acetolactate decarboxylase [Bifidobacterium longum subsp. infantis ATCC 15697 = JCM 1222]; gil 1894200461gb1ACD94444.11 Acetolactate decarboxylase [Callicarbacterium sZ]; giI158511130IgbIABW68097.11 Acetolactate decarboxylase [Desulfococcus oleifera Hxd3]; gil 1573234341gblABV 42531.11 Acetolactate decarboxylase [Serratia speciosa 568]; gi11453185551gb1ABP60702.11 Acetolactate decarboxylase [Enterobacter 638]; gi11499475631gb1ABR53499.11 Acetolactate decarboxylase [Staphylococcus aureus subsp. aureus JH1]; gi11499471671gb1ABR53103.11 Acetolactate decarboxylase [Staphylococcus aureus subsp. aureus JH1]; gi11638609721gb1ABY42031.11 Acetolactate decarboxylase [Bacillus velutipes KBAB4]; gill097023421gb1ABG42262.11 Acetolactate decarboxylase [Pseudomonas aeruginosa T6c]; gi11894957381gb1ACE04286.11 Acetolactate decarboxylase [Brownia green bacteria BS 1]; gi11719907921gb1ACB61714.11 Acetolactate decarboxylase [Siberian microbacterium 255-15]; gil 2239325631reflZP 03624564.11 Acetolactate decarboxylase [Streptococcus suis 89 / 1591]; gil 194467531 IreflZP 03073518.11 Acetolactate decarboxylase [Lactobacillus reuteri 100-23]; gi 12238988341gb1EEF65194.11 Acetolactate decarboxylase [Streptococcus suis 89 / 1591]; gil 1944545671gb1EDX43464.11 Acetolactate decarboxylase [Lactobacillus reuteri 100-23]; gil13842671351ref1YP 005422842.11 Acetolactate decarboxylase [Bacillus amyloliquefaciens subsp. plantarum YAU B9601-Y2]; gil3753640371reflYP 005132076.11 Acetolactate decarboxylase [Bacillus amyloliquefaciens subsp. plantarum CAU B946]; gil3407932311reflYP 004758694.11 Acetolactate decarboxylase [Corynebacterium variabile DSM 44702]; gil3363251191reflYP 004605085.11 Acetolactate decarboxylase [Corynebacterium resistens DSM 45100]; gil1482690321reflYP 001247975.11 Acetolactate decarboxylase [Staphylococcus aureus subsp. aureus JH9]; gil 148268650lreflYP 001247593.11 Acetolactate decarboxylase [Staphylococcus aureus subsp. aureus JH9]; gil 1485433721reflYP 001270742.11 Acetolactate decarboxylase [Lactobacillus reuteri DSM20016]; gi13805004881emb1CCG51526.11 Acetolactate decarboxylase [Bacillus amyloliquefaciens Lactobacillus plantarum subsp. YAU] [B9601-Y2];gi13715700311emb1CCF06881.11 Acetolactate decarboxylase [Bacillus amyloliquefaciens subsp. Lactobacillus plantarum CAU B946];gi13405331411gb1AEK35621;11 Acetolactate decarboxylase [Corynebacterium variant DSM 44702]; gi13361011011gb1AEI08921.11 Acetolactate decarboxylase [Resistant Corynebacterium DSM45100]; gi11485304061gb1ABQ82405.11 Acetolactate decarboxylase [Lactobacillus reuteri DSM 20016]; gi11477421011gb1ABQ50399.11 Acetolactate decarboxylase [Staphylococcus aureus subsp. aureus JH9]; giI147741719IgbIABQ50017.11 Acetolactate decarboxylase [Staphylococcus aureus subsp. aureus JH9]; gil392529510lreflZP 10276647.11 Acetolactate decarboxylase [Carnobacterium maltaromaticum ATCC 35586]; gil36605407 41reflZP 09451796.11 Acetolactate decarboxylase [Lactobacillus suebicus KCTC 3549]; gil33962414 71reflZP08659936.11 Acetolactate decarboxylase [Fructobacillus fructosus KCTC 3544]; gil3363937271reflZP 08575126.11 Acetolactate decarboxylase [Lactobacillus coryniformis subsp. torquens KCTC 3535]. The sequences associated with the aforementioned login numbers are incorporated into this article by reference.

[0153] In some embodiments, the present invention relates to ALDC enzymes derived from Lactobacillus casei (Godtfredsen, 1984), Brevibacterium acetylicum (Oshiro, 1989), Lactococcus lactis (Vincent Phalip, 1994), Leuconostoclactis (O sulivan, 2001), Enterobacter aerogenes (Blomquist, 1993), Bacillus subtilis (Renna, 1993), Bacillus brevis (Svendsen, 1989), and Lactococcus lactis DX (Yuxing, 2014).

[0154] It should be understood that any suitable ALDC enzyme can be used according to the present invention, i.e., ALDC produced by any microorganism whose activity depends on metal ions. In some embodiments, the ALDC used in the methods and compositions described herein is ALDC derived from Bacillus brevis or Bacillus licheniformis.

[0155] The ALDC activity of the enzyme compositions according to the invention is measured by the ALDC assay as described herein or by any suitable assay known in the art. Typically, the standard assay is performed at pH 6.0, and assays for enzymes with other characteristics and specifications can be performed at different pH values ​​and temperatures.

[0156] One unit of ALDC activity is defined as the amount of enzyme that produces 1 μmol acetoin / min under assay conditions (e.g., pH 6.0 (or as specified) and 30°C).

[0157] In some embodiments, the optimal temperature of the enzyme is in the range of 5°C to 80°C, for example, in the range of 5°C to 40°C or 15°C to 80°C, for example, in the range of 20°C to 80°C, for example, in the range of 5°C to 15°C, 15°C to 20°C, 45°C to 65°C, 50°C to 65°C, 55°C to 65°C, or 60°C to 80°C. In some embodiments, the optimal temperature range of the enzyme is 45°C to 65°C. In some embodiments, the optimal temperature of the enzyme is approximately 60°C.

[0158] In some embodiments, the total number of amino acids in the enzyme is less than 350, for example less than 340, for example less than 330, for example less than 320, for example less than 310, for example less than 300, for example in the range of 200 to 350 amino acids, for example in the range of 220 to 345 amino acids.

[0159] In some embodiments, the ALDC compositions and methods according to the present invention comprise any one or more additional enzymes. In some embodiments, the one or more additional enzymes are selected from the list of the following: acetolactate reductase, acetolactate isomerase, amylase, glucosylamylase, hemicellulase, cellulase, dextranase, amylopectinase, isoamylase, endoglucanase and related β-glucan hydrolytic coenzymes, xylanase, xylanase coenzymes (e.g., arabinofuranylase, ferulic acid esterase, xylan acetylesterase), β-glucosidase, and protease.

[0160] In some embodiments, the compositions and methods according to the invention comprise an enzyme exhibiting ALDC activity, wherein the activity of the ALDC enzyme is in the range of 950 to 2500 units / mg protein. In some embodiments, the compositions and methods according to the invention comprise an enzyme exhibiting ALDC activity, wherein the activity of the ALDC enzyme is in the range of 1000 to 2500 units / mg protein.

[0161] proline-specific proteases

[0162] Beer haze (the cloudy appearance in beer) is caused by the aggregation of hydrophobic proteins (such as gliadin in barley) and polyphenols, resulting in an undesirable cloudy appearance or turbidity in beer. See, for example, Asano, K.; Shinagaawa, K.; Hashimoto, N. Characterization of haze-forming proteins of beer and their roles in chill haze formation. J. Am. Soc. Brew. Chem. 1982, 40, 147-154. The same phenomenon is also called chill haze, and similar haze formation can also occur in wine and juice.

[0163] It has been proposed that acidic proteases such as papain can be used to degrade proteins in beer, thereby preventing turbidity. However, studies have found that broad-spectrum proteases such as papain can impair beer foam formation and stability. See, for example, Posada, J.; Almenar, J.; Garcia Galindo, J. A practical approach on proteinstabilizers. Proc. - Eur. Brew. Conv. 1971, 13, 379-391. For this reason, more selective proteases, such as proline-specific endopeptidases, have also been used to reduce beer turbidity. However, there remains a need for proteases that can be used to reduce beer turbidity because existing commercially available products are too expensive and cannot completely remove beer turbidity. Furthermore, there is concern that even proline-specific endopeptidases are still too broad-spectrum. For example, according to the present invention, prior art proline-specific endopeptidases have been found to destabilize other enzymes added exogenously to beer, including ALDC enzymes added for maturation.

[0164] According to one aspect of the invention, a proline-specific endonuclease with lower destabilizing effect on other exogenously added enzymes, including ALDC enzymes, has been discovered.

[0165] "Polyphenols" are compounds that have one or more aromatic rings and are substituted by one or more hydroxyl groups. Examples of polyphenols are tannins and flavonoids, including catechins, flavonols, and anthocyanins.

[0166] The proline-specific protease and / or ALDC of this invention can be added at different stages of the beer preparation process. Adding the enzyme at the beginning of fermentation yields the best results. However, the enzyme can also be added to the mash or the beer after fermentation before turbidity forms.

[0167] The enzymes of this invention (including ALDC enzymes and proline-specific proteases) may be in isolated or purified form. "Isolated" or "purified" means that the enzyme has been removed from its natural environment. For example, recombinant proline-specific proteases or ALDCs expressed in host cells for the purposes of this invention can be considered isolated. Similarly, natural or recombinant polypeptides that have been substantially purified by any suitable technique can be considered isolated or purified.

[0168] Enzyme production

[0169] The enzymes of this invention can be produced in host cells (e.g., by secretion or intracellular expression). After the enzyme is secreted into a cell culture medium, cultured cell material containing the enzyme (e.g., whole-cell culture medium) can be obtained. Optionally, the enzyme can be isolated from the host cells, or even from the cell culture medium, depending on the desired purity of the final enzyme. Suitable host cells include bacteria, fungi (including yeast and filamentous fungi), and plant cells (including algae). Particularly useful host cells include *Aspergillus niger*, *Aspergillus oryzae*, or *Trichoderma reesei*. Other host cells include bacterial cells, such as *Bacillus subtilis* or *Bacillus licheniformis*, as well as *Streptomyces* and *Escherichia coli*.

[0170] carrier

[0171] DNA constructs containing nucleic acids encoding enzymes can be constructed for expression in host cells. Due to the well-known degeneracy of the genetic code, variant polynucleotides encoding the same amino acid sequence can be designed and prepared using conventional techniques. Optimization of codons for specific host cells is also well known in the art. Nucleic acids encoding the enzymes of the present invention can be incorporated into vectors. Vectors can be transferred into host cells using well-known transformation techniques, such as those disclosed below.

[0172] Vectors can be any vector that can be transformed into and replicate within host cells. For example, a vector containing a nucleic acid encoding an enzyme can be transformed into a bacterial host cell and replicated therein as a means of propagation and amplification of the vector. Vectors can also be transformed into expression hosts so that the nucleic acid encoding the enzyme can be expressed as a functional enzyme. Host cells that serve as expression hosts can include, for example, filamentous fungi. The strain catalogue of the Center for Fungal Genetics (FGSC) lists vectors suitable for expression in fungal host cells. See FGSC, Catalogue of Strains, University of Missouri, www.fgsc.net (last updated January 17, 2007). A representative vector is pJG153, a promoterless Cre expression vector that can replicate in a bacterial host. See Harrison et al., (June 2011) Applied Environ. Microbiol 77:3916-22. pJG153 can be modified using conventional techniques to contain and express nucleic acids encoding enzymes.

[0173] The nucleic acid encoding the enzyme can be operatively linked to a suitable promoter, which allows transcription in a host cell. The promoter can be any DNA sequence that exhibits transcriptional activity in a selected host cell and can be derived from a gene encoding a protein homologous to or heterologous to the host cell. Exemplary promoters (especially in bacterial hosts) used to direct the transcription of DNA sequences encoding enzymes include: the promoter of the lactose operon in *Escherichia coli*, the promoter of the agarase gene dagA or celA in *Streptomyces coelicolor*, the promoter of the α-amylase gene (amyL) in *Bacillus licheniformis*, the promoter of the raw maltose amylase gene (amyM) in *Bacillus stearothermophilus*, the promoter of the α-amylase gene (amyQ) in *Bacillus amyloliquefaciens*, and the promoters of the xylA and xylB genes in *Bacillus subtilis*, etc. For transcription in fungal hosts, examples of useful promoters are those derived from genes encoding Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic protease, Aspergillus niger neutral α-amylase, Aspergillus niger acid-stable α-amylase, Aspergillus niger glucosylase, Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, or Aspergillus nidulans acetamase. When expressing enzyme genes in bacterial species (such as Escherichia coli), suitable promoters can be selected, for example, from phage promoters including the T7 promoter and the phage λ promoter. Examples of suitable promoters for expression in yeast species include, but are not limited to, the Gal 1 and Gal 10 promoters of Saccharomyces cerevisiae and the AOX1 or AOX2 promoters of Pichia pastoris. cbh1 is an endogenously inducible promoter from Trichoderma reesei. See Liu et al., (2008) “Improved heterologous gene expression in Trichoderma reesei by cellobiohydrolase I gene (cbh1) promoter optimization,” Acta Biochim. Biophys. Sin (Shanghai) 40(2): 158-65.

[0174] The coding sequence can be operatively linked to the signal sequence. The DNA encoding the signal sequence can be a DNA sequence naturally associated with the enzyme gene to be expressed or derived from a different genus or species. The signal sequence and promoter sequence constituting the DNA construct or vector can be introduced into the fungal host cell and can be derived from the same source. For example, the signal sequence is the cbh1 signal sequence operatively linked to the cbh1 promoter.

[0175] Expression vectors may also contain a suitable transcription terminator, and in eukaryotes, a polyadenylated sequence that is operatively linked to a DNA sequence encoding a variant enzyme. The terminator and polyadenylated sequence may be appropriately derived from the same source as the promoter.

[0176] The vector may further contain DNA sequences that enable it to replicate in a host cell. Examples of such sequences are the origins of replication for plasmids pUC19, pACYC177, pUB110, pE194, pAMB1, and pIJ702.

[0177] The vector may also contain selectable markers, such as genes whose products can compensate for defects in isolated host cells, such as the dal gene from Bacillus subtilis or Bacillus licheniformis, or genes conferring antibiotic resistance (such as resistance to ampicillin, kanamycin, chloramphenicol, or tetracycline). Furthermore, the vector may contain Aspergillus selectable markers (such as amdS, argB, niaD, and xxsC), markers inducing hygromycin resistance, or selectability that can be achieved through co-transformation (as is known in the art). See, for example, International PCT application WO 91 / 17243.

[0178] Intracellular expression can be advantageous in several ways, for example, when using certain bacteria or fungi as host cells to produce large quantities of enzymes for subsequent enrichment or purification. Extracellular secretion of enzymes in culture media can also be used to prepare cultured cellular materials containing isolated enzymes.

[0179] Expression vectors typically include components of a cloning vector, such as elements that allow the vector to replicate autonomously in a selected host organism and one or more phenotypic detectable markers for selection purposes. Expression vectors generally contain control nucleotide sequences, such as promoters, operons, ribosome binding sites, translation initiation signals, and optionally repressor genes or one or more activator genes. Additionally, expression vectors may contain sequences encoding amino acid sequences capable of targeting the enzyme to organelles (such as peroxisomes) or specific compartments of the host cell. Such targeting sequences include, but are not limited to, the SKL sequence. For expression guided by a control sequence, the enzyme's nucleic acid sequence is operatively ligated to the control sequence in a manner appropriate for expression.

[0180] Procedures for linking the DNA constructs encoding the enzyme, promoters, terminators, and other elements, respectively, and inserting them into a suitable vector containing the information required for replication are well known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor, 1989; 3rd edition, 2001).

[0181] Transformation and culture of host cells

[0182] Isolated cells containing DNA constructs or expression vectors are advantageously used as host cells for recombinant production of enzymes according to the invention. Cells can be conveniently transformed with DNA constructs encoding the enzyme by integrating the DNA construct (in one or more copies) into the host chromosome. This integration is generally considered advantageous because the DNA sequence is more likely to be stably maintained in the cell. The DNA construct can be integrated into the host chromosome according to conventional methods, for example, by homologous or heterologous recombination. Alternatively, cells can be transformed with expression vectors associated with different types of host cells as described above.

[0183] Examples of suitable bacterial host organisms are Gram-positive bacterial species, such as those from the Bacillaceae family, including *Bacillus subtilis*, *Bacillus licheniformis*, *Bacillus lentus*, *Bacillus brevis*, *Geobacillus stearothermophilus* (formerly *Bacillus stearothermophilus*), *Bacillus alkalophilus*, *Bacillus amyloliquefaciens*, *Bacillus coagulans*, *Bacillus lautus*, *Bacillus megaterium*, and *Bacillus thuringiensis*; *Streptomyces* species, such as *Streptomyces murinus*; and lactic acid bacteria species, including *Lactococcus* species. *Lactococcus* sp., such as *Lactobacillus* sp., including *Lactobacillus reuteri* sp., *Leuconostoc* sp., *Pediococcus* sp., and *Streptococcus* sp., can be selected as host organisms. Alternatively, strains of Gram-negative bacteria belonging to the families Enterobacteriaceae (including *Escherichia coli*) or Pseudomonadaceae can be chosen as host organisms.

[0184] Suitable yeast host organisms can be selected from biotechnology-related yeast species, such as, but not limited to, species of the genera *Pichia*, *Hansenula*, *Kluyveromyces*, *Yarrowinia*, *Schizosaccharomyces*, or *Saccharomyces* (including *Saccharomyces cerevisiae*), or species belonging to the genus *Schizosaccharomyces* (e.g., *Schizosaccharomyces pombe*). The methyltrophic yeast strain *Pichiapastoris* can be used as a host organism. Alternatively, the host organism can be a species of the genus *Hansenula*. Suitable host organisms among filamentous fungi include species of the genus *Aspergillus*, such as *Aspergillus niger*, *Aspergillus oryzae*, *Aspergillus tubigensis*, *Aspergillus awamori*, or *Aspergillus nidus*. Alternatively, strains of *Fusarium* species (e.g., *Fusarium oxysporum*) or strains of *Rhizomucor* species (e.g., *Rhizomucor miltiorrhiza*) can be used as host organisms. Other suitable strains include species of the genera *Thermomyces* and *Mucor*. Additionally, species of *Trichoderma* sp. can be used as hosts. Suitable procedures for transforming *Aspergillus* host cells include, for example, those described in EP 238023. The enzyme expressed by the fungal host cell can be glycosylated, i.e., will contain a glycosyl moiety. The glycosylation pattern can be the same as or different from that present in the wild-type enzyme. The type and / or degree of glycosylation may confer alterations to the enzymatic and / or biochemical properties.

[0185] Expressing a gene deletion from the host can be advantageous, where gene defects can be corrected by a transformed expression vector. Known methods can be used to obtain fungal host cells with one or more inactivated genes. Gene inactivation can be accomplished by complete or partial deletion, by insertional inactivation, or by any other means that renders the gene ineffective for its intended purpose, thereby preventing the expression of a functional protein. Any cloned gene from a Trichoderma species or other filamentous fungal host, such as the cbh1, cbh2, egl1, and egl2 genes, can be deleted. Gene deletion can be accomplished by methods known in the art by inserting the desired form of the gene to be inactivated into a plasmid.

[0186] Introducing DNA constructs or vectors into host cells includes techniques such as transformation; electroporation; nuclear microinjection; transduction; transfection, such as lipid transfection-mediated and DEAE-dextrin-mediated transfection; incubation with calcium phosphate DNA precipitation; high-speed bombardment with DNA-coated microparticles; and protoplast fusion. Common transformation techniques are known in the art. See, for example, Sambrook et al. (2001), ibid. Expression of heterologous proteins in *Trichoderma* is described, for example, in U.S. Patent No. 6,022,725. For transformation of *Aspergillus* strains, also refer to Cao et al. (2000) Science 9:991-1001. Genetically stable transformants can be constructed using vector systems, thereby enabling the stable integration of the nucleic acid encoding the enzyme into the host cell chromosome. The transformants are then selected and purified using known techniques.

[0187] The preparation of Trichoderma species for transformation can, for example, involve the preparation of protoplasts from fungal mycelium. See Campbell et al. (1989) Curr. Genet. [Contemporary Genetics] 16: 53-56. Mycelium can be obtained from germinating vegetative spores. Protoplasts are produced by treating the mycelium with enzymes that digest the cell wall. The protoplasts are protected by the presence of osmotic stabilizers in the suspension medium. These stabilizers include sorbitol, mannitol, potassium chloride, magnesium sulfate, etc. Typically, the concentration of these stabilizers varies between 0.8 M and 1.2 M; for example, a 1.2 M solution of sorbitol can be used in the suspension medium.

[0188] Depending on the calcium ion concentration, DNA is taken up into the host Trichoderma species. Typically, CaCl2 at approximately 10–50 mM is used in the take-up solution. Additional suitable compounds include buffer systems such as TE buffer (10 mM Tris, pH 7.4; 1 mM EDTA) or 10 mM MOPS (pH 6.0) and polyethylene glycol. PEG is believed to induce cell membrane fusion, thereby allowing the contents of the culture medium to be delivered into the cytoplasm of the Trichoderma species. This fusion often leaves multiple copies of plasmid DNA integrated into the host chromosome.

[0189] Typically, protoplasts or cells that have undergone permeation treatment are used to transform Trichoderma species, typically at a ratio of 10... 5 Up to 10 7 / mL, especially 2 × 10 6The process is carried out at a density of / mL. 100 μL of these protoplasts or cells in a suitable solution (e.g., 1.2 M sorbitol and 50 mM CaCl2) can be mixed with the desired DNA. Typically, a high concentration of PEG is added to the uptake solution. From 0.1 to 1 volume of 25% PEG 4000 can be added to the protoplast suspension; however, adding approximately 0.25 volumes is useful. Additives such as dimethyl sulfoxide, heparin, spermidine, potassium chloride, etc., can also be added to the uptake solution to promote transformation. Similar procedures can be used for other fungal host cells. See, for example, U.S. Patent No. 6,022,725.

[0190] As used in this paper, the protein identification (“JGI-PID”) number of the *Trichoderma* gene is referenced to version 2 of the *Trichoderma reesei* QM6a genome sequence assembled by the Department of Energy Joint Genome Institute (The Genome Portal of the Department of Energy Joint Genome Institute, Groriev et al., *Nucleic Acids Res*, January 2012; 40(Database Special):D26-32. doi:10.1093 / nar / gkr947). The JGI-assembled scaffold sequence and annotated genes have also been deposited in GeneBank (The National Center for Biotechnology) with nucleotide accession numbers GL985056.1 to GL985132.1.

[0191] Express

[0192] A method for producing the enzyme of the present invention may include culturing a host cell as described above under conditions favorable for producing the enzyme, and recovering the enzyme from the cell and / or culture medium.

[0193] The culture medium used to culture cells can be any conventional medium suitable for the growth of the host cells under consideration and for obtaining enzyme expression. Suitable media and media components can be obtained from commercial suppliers or can be prepared according to published formulations (e.g., as described in the catalog of the American Type Culture Collection).

[0194] Enzymes secreted from host cells can be used in whole culture preparations. In the method of this invention, any culture method known in the art can be used to prepare used whole fermentation broth of recombinant microorganisms, resulting in enzyme expression. Therefore, fermentation can be understood as including shake-flask culture, small-scale or large-scale fermentation (including continuous fermentation, batch fermentation, fed-batch fermentation, or solid-state fermentation) carried out in a laboratory or industrial fermenter under suitable culture media and conditions allowing enzyme expression or isolation. The term "used whole fermentation broth" is defined herein as the ungraded contents of fermentation material comprising culture medium, extracellular proteins (e.g., enzymes), and cellular biomass. It should be understood that the term "used whole fermentation broth" also encompasses cellular biomass that has been lysed or permeated using methods well known in the art.

[0195] Enzymes secreted from host cells can be readily recovered from culture media using well-known procedures, including separating cells from the medium by centrifugation or filtration, precipitating protein components of the medium with the aid of salts (such as ammonium sulfate), and subsequently using chromatographic procedures such as ion exchange chromatography, affinity chromatography, etc.

[0196] The polynucleotide encoding an enzyme in the vector can be operatively linked to a control sequence that enables the expression of the coding sequence through the host cell; that is, the vector is an expression vector. The control sequence can be modified, for example, by adding other transcriptional regulatory elements, to make the transcriptional level directed by the control sequence more responsive to transcriptional regulators. The regulatory sequence may include a promoter.

[0197] Host cells can be cultured under suitable conditions that allow for enzyme expression. The expression of these enzymes can be constitutive, enabling continuous production, or inducible, requiring stimulation to initiate expression. In the case of inducible expression, protein production can be initiated when needed, for example, by adding an inducing agent (such as dexamethasone, IPTG, or sophorose) to the culture medium. Peptides can also be recombinantly produced in vitro in cell-free systems such as the TNT™ (Promega) rabbit reticulocyte system.

[0198] The expression host can also be cultured under aerobic conditions in a medium suitable for the host. A combination of shaking or agitation and aeration can be provided, with production occurring at a temperature suitable for the host (e.g., from about 25°C to about 75°C (e.g., 30°C to 45°C), depending on the host's needs and the desired enzyme production). Culture can take place for about 12 to about 100 hours or longer (and any hourly values ​​in between, e.g., 24 to 72 hours). Typically, the pH of the culture medium is from about 4.0 to about 8.0, again depending on the host's culture conditions required for enzyme production.

[0199] Methods for enriching and purifying enzymes

[0200] Fermentation, separation, and concentration techniques are well known in the field, and solutions containing enzyme-containing peptides can be prepared using conventional methods.

[0201] After fermentation, the fermentation broth is obtained. Microbial cells and various suspended solids (including residual crude fermentation material) are removed using conventional separation techniques to obtain the enzyme solution. Commonly used methods include filtration, centrifugation, microfiltration, rotary vacuum drum filtration, ultrafiltration, post-centrifugation ultrafiltration, extraction, or chromatography.

[0202] The goal is to concentrate the solution containing the enzyme peptides to optimize recovery. Using an undiluted solution requires increasing the incubation time to collect the enriched or purified enzyme precipitate.

[0203] The enzyme-containing solution is concentrated using conventional concentration techniques until the desired enzyme level is achieved. Concentration of the enzyme-containing solution can be achieved using any of the techniques described herein. Exemplary methods for enrichment and purification include, but are not limited to, rotary vacuum filtration and / or ultrafiltration.

[0204] The enzyme solution is concentrated until the enzyme activity of the concentrated enzyme-containing polypeptide solution reaches the desired level.

[0205] Concentration can be achieved using, for example, precipitants (such as metal halide precipitants). Metal halide precipitants include, but are not limited to, alkali metal chlorides, alkali metal bromides, and blends of two or more of these metal halides. Exemplary metal halides include sodium chloride, potassium chloride, sodium bromide, potassium bromide, and blends of two or more of these metal halides. Sodium chloride, a metal halide precipitant, can also be used as a preservative.

[0206] Metal halide precipitants are used in amounts that effectively precipitate the enzyme. After routine testing, the selection of at least an effective and optimal amount of metal halide to effectively induce enzyme precipitation, as well as the precipitation conditions (including incubation time, pH, temperature, and enzyme concentration) for maximizing recovery, will be apparent to those skilled in the art.

[0207] Typically, at least about 5% w / v (weight / volume) to about 25% w / v of metal halide is added to concentrated enzyme solutions, and usually at least 8% w / v. Typically, no more than about 25% w / v of metal halide is added to concentrated enzyme solutions, and usually no more than about 20% w / v. The optimal concentration of the metal halide precipitant will depend particularly on the nature of the specific enzyme peptide and its concentration in the concentrated enzyme solution.

[0208] Another alternative to precipitating enzymes is the use of organic compounds. Exemplary organic compound precipitants include: 4-hydroxybenzoic acid, alkali metal salts of 4-hydroxybenzoic acid, alkyl esters of 4-hydroxybenzoic acid, and blends of two or more of these organic compounds. The addition of the organic compound precipitant can be performed before, simultaneously with, or after the addition of the metal halide precipitant, and the addition of both precipitants, namely the organic compound and the metal halide, can be performed sequentially or simultaneously.

[0209] Typically, organic precipitants are selected from the group consisting of alkali metal salts (such as sodium or potassium salts) of 4-hydroxybenzoic acid, and straight-chain or branched alkyl esters of 4-hydroxybenzoic acid (wherein the alkyl group contains 1 to 12 carbon atoms), and blends of two or more of these organic compounds. The organic compound precipitant can be, for example, a straight-chain or branched alkyl ester of 4-hydroxybenzoic acid (wherein the alkyl group contains 1 to 10 carbon atoms), and blends of two or more of these organic compounds. Exemplary organic compounds are straight-chain alkyl esters of 4-hydroxybenzoic acid (wherein the alkyl group contains 1 to 6 carbon atoms), and blends of two or more of these organic compounds. Methyl esters, propyl esters, butyl esters, ethyl esters of 4-hydroxybenzoic acid, and blends of two or more of these organic compounds can also be used. Other organic compounds include, but are not limited to, methyl 4-hydroxybenzoate (called methyl paraben) and propyl 4-hydroxybenzoate (called propyl paraben), which are also preservatives. For further description, see, for example, U.S. Patent No. 5,281,526.

[0210] The addition of organic compound precipitants provides the advantage of high flexibility in precipitation conditions in terms of pH, temperature, enzyme concentration, precipitant concentration, and incubation time.

[0211] Organic compound precipitants are used to effectively improve the amount of enzyme precipitation by means of metal halide precipitants. After routine testing, the selection of at least an effective and optimal amount of organic compound precipitant, as well as the precipitation conditions (including incubation time, pH, temperature, and enzyme concentration) for maximizing recovery, will be apparent to those skilled in the art.

[0212] Typically, at least about 0.01% w / v of an organic compound precipitant is added to the concentrated enzyme solution, and usually at least about 0.02% w / v. Typically, no more than about 0.3% w / v of an organic compound precipitant is added to the concentrated enzyme solution, and usually no more than about 0.2% w / v.

[0213] Concentrated peptide solutions containing metal halide precipitants and organic compound precipitants can be adjusted to a specific pH, which will depend on the enzyme to be enriched or purified. Typically, the pH is adjusted to a level close to the enzyme's isoelectric point. The pH can be adjusted within a range from approximately 2.5 pH units below the isoelectric point (pI) to approximately 2.5 pH units above the isoelectric point.

[0214] The incubation time required to obtain an enriched or purified enzyme precipitate depends on the nature of the specific enzyme, its concentration, and one or more specific precipitants and their concentrations. Typically, the effective precipitation time for enzymes is between about 1 and 30 hours; usually, it does not exceed about 25 hours. In the presence of organic compound precipitants, the incubation time can still be reduced to less than about 10 hours, and in most cases even to about 6 hours.

[0215] Typically, the temperature during incubation is between approximately 4°C and approximately 50°C. The method is usually carried out at temperatures between approximately 10°C and approximately 45°C (e.g., between approximately 20°C and approximately 40°C). The optimal temperature for inducing precipitation varies depending on the solution conditions and the enzyme or one or more precipitants used.

[0216] The overall recovery rate of enriched or purified enzyme precipitates and the efficiency of the process can be improved by stirring a solution containing the enzyme, added metal halide, and added organic compound. Stirring steps are performed during the addition of the metal halide and organic compound, as well as during the subsequent incubation. Suitable stirring methods include mechanical stirring or shaking, vigorous aeration, or any similar technique.

[0217] After the incubation period, the enriched or purified enzymes are separated and collected from the dissociated pigments and other impurities using conventional separation techniques, including filtration, centrifugation, microfiltration, rotary vacuum filtration, ultrafiltration, pressure filtration, cross-flow membrane microfiltration, and cross-current membrane microfiltration. Further enrichment or purification of the enzyme precipitate can be achieved by washing the precipitate with water. For example, the enriched or purified enzyme precipitate can be washed with water containing a metal halide precipitant, or with water containing both metal halides and organic compounds as precipitants.

[0218] During fermentation, the enzyme peptides accumulate in the culture medium. To isolate, enrich, or purify the desired enzyme, the culture medium is centrifuged or filtered to remove cells, and the resulting cell-free liquid is used for enzyme enrichment or purification. In one embodiment, the cell-free culture medium is salted out using ammonium sulfate to approximately 70% saturation; the 70% saturated precipitate fraction is then dissolved in buffer and applied to a column (such as a Sephadex G-100 column), and eluted to recover the enzyme activity fraction. For further enrichment or purification, conventional procedures such as ion-exchange chromatography can be used.

[0219] Enriched or purified enzymes can be made into final products as liquids (solutions, slurries) or solids (granules, powders).

[0220] Description of preferred embodiments

[0221] According to one aspect of the invention, it has been found that ALDC enzymes used in the brewing process to shorten the maturation stage are unstable in the presence of proline-specific proteases used to improve the colloidal stability of beer. The degradation of ALDCs due to proteolysis prolongs rather than shortens the maturation stage. Accordingly, in one aspect of the invention, a polypeptide with acetolactate decarboxylase activity and resistance to protease inactivation is presented, the polypeptide having an amino acid sequence identity of at least 80%, 90%, 95%, 98%, 99%, or 100% with SEQ ID NO:3, wherein the polypeptide has at most 250 amino acids. Preferably, the polypeptide has at most 249, 248, 247, 246, 245, 244, 243, 242, or 241 amino acids.

[0222] Preferably, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity and resistance to protease inactivation has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. More preferably, the polypeptide has the amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0223] The protease resistant to ALDC is preferably a proline-specific protease. More preferably, the proline-specific protease is derived from Aspergillus niger. Still more preferably, the protease has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:17. More preferably, the protease has the amino acid sequence according to SEQ ID NO:17.

[0224] In another aspect of the invention, an improved brewing process is presented, comprising the steps of fermenting wort in the presence of a polypeptide having acetolactate decarboxylase activity and resistance to protease inactivation, and a proline-specific protease, wherein both enzymes are present simultaneously in the wort. Preferably, the amino acid sequence of the polypeptide has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has at most 250 amino acids. More preferably, the polypeptide has at most 249, 248, 247, 246, 245, 244, 243, 242, or 241 amino acids.

[0225] More preferably, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity and resistance to protease inactivation has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. Still more preferably, the polypeptide has the amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0226] Preferably, the polypeptide with acetolactate decarboxylase activity is first added to the wort. In other preferred embodiments, a proline-specific protease is first added to the wort. In yet another preferred embodiment, the polypeptide with acetolactate decarboxylase activity and the proline-specific protease are added to the wort simultaneously.

[0227] The proline-specific protease is preferably derived from Aspergillus niger. More preferably, the proline-specific protease has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:17.

[0228] In another aspect of the invention, a Bacillus host cell for producing heterologous target polypeptides is presented, wherein one or more protease genes have been inactivated.

[0229] Preferably, the target polypeptide is expressed without a secretion signal peptide. In other preferred embodiments, the target polypeptide is expressed with a secretion signal.

[0230] Preferably, the target polypeptide is an enzyme. More preferably, the enzyme is an oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, aminopeptidase, amylase, asparaginase, glycosylase, carboxypeptidase, catalase, cellulase, chitinase, keratinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, α-galactosidase, β-galactosidase, glucosylamylase, α-glucosidase, β-glucosidase, hyaluronic acid synthase, invertase, laccase, lipase, mannosidase, polysaccharidase, oxidase, pectinase, peroxidase, phytase, polyphenol oxidase, protease, ribonuclease, transglutaminase, or xylanase.

[0231] More preferably, the enzyme is an ALDC enzyme. Preferably, the ALDC enzyme is a polypeptide whose amino acid sequence has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has at most 250 amino acids. Preferably, the polypeptide has at most 249, 248, 247, 246, 245, 244, 243, 242, or 241 amino acids.

[0232] Preferably, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity and resistance to protease inactivation has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. More preferably, the polypeptide has the amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0233] Preferably, the ALDC enzyme is expressed with a secretion signal. Preferably, the heterologous target polypeptide is encoded by a foreign polynucleotide integrated into the host cell's chromosome in at least one copy. Preferably, the foreign polynucleotide is a nucleic acid sequence having 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:28. More preferably, the foreign polynucleotide is a nucleic acid sequence according to SEQ ID NO:28.

[0234] Preferably, the at least one protease gene is inactivated by nonsense mutation within the at least one gene, partial deletion of the at least one gene, or complete deletion of the at least one gene.

[0235] Preferably, the host cell of the Bacillus is Bacillus subtilis or Bacillus licheniformis. More preferably, the host cell of the Bacillus is Bacillus subtilis.

[0236] Preferably, the one or more protease genes are selected from the group consisting of nucleic acid sequences having at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:27. More preferably, the one or more protease genes comprise nine inactivated proteases, wherein the nucleic acid sequences of these proteases have at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:27. More preferably, the nine inactivated protease genes have nucleic acid sequences according to SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:27.

[0237] In another aspect of the invention, a method for generating a target polypeptide is presented, the method comprising the steps of: i) providing a Bacillus host cell wherein one or more protease genes have been inactivated, and wherein said host cell is transformed with a nucleic acid encoding a heterologous polypeptide, the nucleic acid being operatively coupled to a promoter; and

[0238] ii) The host cells are cultured under conditions suitable for the production of the heterologous polypeptide, thereby producing the heterologous polypeptide. Preferably, the method further includes the step of recovering the produced polypeptide.

[0239] Preferably, the target polypeptide is expressed with or without a secretion signal peptide. More preferably, the target polypeptide is expressed with a secretion signal peptide.

[0240] Preferably, the target polypeptide is an enzyme. More preferably, the enzyme is an oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, aminopeptidase, amylase, asparaginase, glycosylase, carboxypeptidase, catalase, cellulase, chitinase, keratinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, α-galactosidase, β-galactosidase, glucosylamylase, α-glucosidase, β-glucosidase, hyaluronic acid synthase, invertase, laccase, lipase, mannosidase, polysaccharidase, oxidase, pectinase, peroxidase, phytase, polyphenol oxidase, protease, ribonuclease, transglutaminase, or xylanase. More preferably, the enzyme is an ALDC enzyme. Preferably, the ALDC enzyme is a polypeptide whose amino acid sequence has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has at most 250 amino acids. Preferably, the polypeptide has at most 249, 248, 247, 246, 245, 244, 243, 242, or 241 amino acids.

[0241] Preferably, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. More preferably, the polypeptide has the amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0242] Preferably, the ALDC enzyme is expressed with a secretion signal. Preferably, the heterologous target polypeptide is encoded by a foreign polynucleotide integrated into the host cell's chromosome in at least one copy. Preferably, the foreign polynucleotide is a nucleic acid sequence having 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:28. More preferably, the foreign polynucleotide is a nucleic acid sequence according to SEQ ID NO:28.

[0243] Preferably, the at least one protease gene is inactivated by nonsense mutation within the at least one gene, partial deletion of the at least one gene, or complete deletion of the at least one gene.

[0244] Preferably, the host cell of the Bacillus is Bacillus subtilis or Bacillus licheniformis. More preferably, the host cell of the Bacillus is Bacillus subtilis.

[0245] Preferably, the one or more protease genes are selected from the group consisting of nucleic acid sequences having at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:27. More preferably, the one or more protease genes comprise nine inactivated proteases, wherein the nucleic acid sequences of these proteases have at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:27. More preferably, the nine inactivated protease genes have nucleic acid sequences according to SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:27.

[0246] In another aspect of the invention, a stable liquid formulation comprises a polypeptide having acetolactate decarboxylase activity and a protease, the polypeptide having an amino acid sequence identity of at least 80%, 90%, 95%, 98%, 99%, or 100% with SEQ ID NO:3, wherein the polypeptide has at most 250 amino acids. Preferably, the polypeptide has at most 249, 248, 247, 246, 245, 244, 243, 242, or 241 amino acids.

[0247] Preferably, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. More preferably, the polypeptide has the amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0248] The protease is preferably a proline-specific protease. More preferably, the proline-specific protease is derived from Aspergillus niger. More preferably, the protease has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:17. Still more preferably, the protease has the amino acid sequence according to SEQ ID NO:17.

[0249] Preferably, when the stable liquid formulation is stored at 10°C for 30, 60, 90, 120, 150 or 180 days, the ALDC polypeptide retains at least 99%, 98%, 95%, 90%, 85%, 80%, 75% or 70% of its activity.

[0250] In other preferred embodiments, when the stable liquid formulation is stored at 30°C for 8 hours, 16 hours, 24 hours, 32 hours, 40 hours or 48 hours, the ALDC peptide retains at least 99%, 98%, 95%, 90%, 85%, 80%, 75% or 70% of its activity.

[0251] In another aspect of the invention, a proline-specific protease formulation is presented, which, when containing the protease, is substantially free of other protease activities, wherein the protease remains stable over time when combined with a polypeptide having acetolactate decarboxylase activity. Preferably, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has up to 250 amino acids and the protease.

[0252] Preferably, the polypeptide has at most 249, 248, 247, 246, 245, 244, 243, 242 or 241 amino acids.

[0253] Preferably, the amino acid sequence of the polypeptide having acetolactate decarboxylase activity has at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. More preferably, the polypeptide has the amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

[0254] The protease is preferably a proline-specific protease. More preferably, the proline-specific protease is derived from Aspergillus niger. More preferably, the protease has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:17. Still more preferably, the protease has the amino acid sequence according to SEQ ID NO:17.

[0255] Preferably, when the stable liquid formulation is stored at 10°C for 30, 60, 90, 120, 150 or 180 days, the ALDC polypeptide retains at least 99%, 98%, 95%, 90%, 85%, 80%, 75% or 70% of its activity.

[0256] In other preferred embodiments, when the stable liquid formulation is stored at 30°C for 8 hours, 16 hours, 24 hours, 32 hours, 40 hours or 48 hours, the ALDC peptide retains at least 99%, 98%, 95%, 90%, 85%, 80%, 75% or 70% of its activity.

[0257] This disclosure is further described in detail in the following examples, which are not intended to limit the scope of the protection claimed in any way. The accompanying drawings are intended to be considered as part of the specification and description of this disclosure. The following examples are provided to illustrate, but not limit, the claimed disclosure. Example

[0258] Example 1

[0259] As an example of a proline-specific endonuclease (PEP), a proline-specific endonuclease derived from Aspergillus niger (AnPro) and sold by DSM under the Brewers Clarex® product (5 PPU / g product) was used. The activity of the proline-specific endonuclease (PEP) was determined based on the hydrolysis of the synthetic peptide Z-Gly-Pro-pNA in citrate / disodium phosphate buffer (pH 4.6) at 37°C. The reaction products were monitored spectrophotometrically at 405 nm, and one unit (1 PPU) was defined as the amount of enzyme releasing 1 mmol of p-nitroaniline per minute under these test conditions.

[0260] As an example of acetolactate decarboxylase, aldB (2500 ADU-L / g product) from Bacillus brevis (also known as brevis bacillus), sold by Novozymes (Bausway, Denmark) as Maturex® Pro and derived from Bacillus brevis, is used. This aldB expressed in Bacillus brevis is referred to herein as aldB_Bl.

[0261] Example 2

[0262] Cloning of the Aspergillus niger ATCC 1015 protease AniPro_2 (CRC02753-WT)

[0263] Aspergillus niger ATCC 1015 was selected as a potential source of enzymes for various industrial applications. One of the genes identified in Aspergillus niger ATCC 1015 (named AniPro_2 (CRC02753-WT)) encodes a protein homologous to a protease identified from a BLAST search (Altschul et al., J Mol Biol [Journal of Molecular Biology], 215: 403-410, 1990). The precursor protein encoded by the AniPro_2 gene is shown in SEQ ID NO:16 (JGI reference sequence: Aspni5_52703). At the N-terminus, the protease protein has a signal peptide of 21 amino acids as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods [Nature Methods] [Nature Methods], 8:785-786) and is derived from the aspartic protease (uniport id. G0R8T0) of Hypocrea jecorina. The presence of the signal sequence confirms that AniPro_2 is a secretory enzyme. The predicted mature form sequence of AniPro_2 is shown in SEQ ID NO:17.

[0264] Example 3

[0265] Expression, fermentation and purification of AniPro_2

[0266] The DNA sequence encoding AniPro_2 was chemically synthesized by Generay Bio-Technology Co., Ltd. (Shanghai, China) and inserted into the Trichoderma reesei expression vector pGXT (which is identical to the pTTTpyr2 vector described in the published PCT application WO 2015 / 017256, which is incorporated herein by reference). The resulting plasmid was labeled pGXT-AniPro2.

[0267] The expression plasmid was then transformed into a suitable *Trichoderma reesei* strain using protoplast transformation (Te'o et al. (2002) J. Microbiol. Methods [Microbial Methods Journal] 51:393-99) (described in published PCT application WO05 / 001036). Transformants were selected on a medium containing acetamide (as the sole nitrogen source). After 5 days of growth on acetamide plates, the transformants were collected and fermented via DASGIP (Eppendorf, Jülich, Germany).

[0268] To initiate AniPro_2 fermentation, the seed culture was grown in 1 L shake flasks, each containing 100 mL of defined medium (pH 5.5 before sterilization). This medium consisted of 50 g / L glucose monohydrate, 6 g / L glycine, 5 g / L (NH4)2SO4, 4.5 g / L KH2PO4, 1 g / L CaCl2·2H2O, 1 g / L MgSO4·7H2O, 2 g / L Mazu 6000K, and 2.5 mL of 400× Trichoderma reesei trace metal stock solution (approximately pH 1) containing 175 g / L C6H8O7·H2O, 200 g / L FeSO4·7H2O, 16 g / L ZnSO4·7H2O, 3.2 g / L CuSO4·5H2O, 1.4 g / L MnSO4·H2O, and 0.8 g / L FeSO4·7H2O. The composition was (g / L H3BO3). The seed culture was shaken at 250 rpm for 48 hours at 30°C. After this incubation, 200 mL of seed culture was transferred to a 2 L bioreactor (DASGIP).

[0269] The fermentation medium in the 2 L bioreactor (DASGIP) contained 60 g / L dextrose, 6 g / L glycine, 1 g / L CaCl2·2H2O, 4.5 g / L KH2PO4, 4 g / L (NH4)2SO4, 1 g / L MgSO4·7H2O, 1.2 g / L Mazu 6000K, and 2.5 ml of 400× Trichoderma reesei trace metals. An induction solution containing 250 g glucose / sophorose per kg was prepared and sterilized.

[0270] After inoculation, batch fermentation was initiated (working volume 1 L) and maintained at pH 3.5 and 34°C. Throughout the fermentation process, dissolved oxygen levels were maintained above 35% by adjusting gas flow rate, oxygen supply, and agitation. After 22 hours of fermentation, the glucose in the fermentation broth was depleted, at which point a feed of 250 g (glucose / sophorose) / kg solution was introduced. Gradual feed rates of 4 mL / h and 6 mL / h were applied at intervals of 22–46 hours and 46–72 hours, respectively. With the start of the feed-batch phase, the pH was linearly adjusted to 4.0, and the temperature was adjusted to 28°C. Fermentation was completed after 72 hours of operation. The fermentation broth was harvested by centrifugation, filtered, and subsequently concentrated.

[0271] To purify AniPro_2, the crude product from a 1 L Dasgip fermenter was concentrated and ammonium sulfate was added to a final concentration of 1 M. The solution was then loaded into HiPrep. TM The column was pre-equilibrated on a Phenyl FF 16 / 10 column with 20 mM NaAc (pH 5.0) supplemented with an additional 1 M ammonium sulfate (Buffer A). The target protein was eluted from the column with 0.75 M ammonium sulfate. The corresponding fractions were combined, concentrated, and the buffer was replaced with 20 mM NaPi (pH 7.0) using a VivaFlow 200 ultrafiltration system (Sartorius Stedim) (Buffer B). The resulting solution was applied to a HiLoad filter pre-equilibrated with Buffer B. TM Q FF 16 / 10 column. Elute the target protein from the column with 0.3 M NaCl. Combine the fractions containing the active protein, concentrate them, and exchange the buffer for 20 mM NaAc (pH 5.0) and 150 mM NaCl via a 10K Amicon Ultra device, and store in 40% glycerol at -20°C until use.

[0272] Example 4

[0273] Heterologous expression of acetyllactic acid decarboxylase aldB

[0274] The acetyllactone decarboxylase (ALDC) aldB gene of *Bacillus brevis* (also known as *Bacillus brevis*) was previously identified (Diderichsen et al., *Journal of Bacteriology* (1990) 172(8): 4315), and its sequence is shown in UNIPROT accession number P23616.1. The sequence of this aldB gene is described in SEQ ID NO:1. Nucleotides 1 to 72 encode a signal peptide. This aldB gene and the corresponding encoded zymogen are also referred to as wild-type (WT).

[0275] The zymogen encoded by the aldB gene is described in SEQ ID NO: 2. At the N-terminus, the protein has a signal peptide of 24 amino acids in length as predicted by SignalP-NN (Emanuelsson et al., Nature Protocols (2007) 2: 953-971). The presence of the signal peptide indicates that this acetolactate decarboxylase aldB is a secretory enzyme. The predicted sequence of the fully processed mature chain (aldB, 261 amino acids) is described in SEQ ID NO: 3.

[0276] Using a synthetic gene inserted into the pCB_alr vector, the aldB gene encoding acetyllactate decarboxylase (ALDC) was generated in Bacillus subtilis. See [link to documentation]. Figure 1 The aldB-containing gene was transcribed using the aprE promoter and subsequent Bacillus subtilis aprE signal sequence. To achieve expression, the aldA(CB)RIHI-Bbr vector was integrated into a protease-deficient Bacillus subtilis strain. A map of the pCB_alr vector (alrA(CB)RIHI-Bbr) containing the aldB gene is shown in... Figure 2 middle.

[0277] To produce aldB, a Bacillus subtilis transformant strain (BRA8014 strain described below) containing the alarA(CB)RIHI-Bbr box was cultured in 15 mL Falcon tubes in TSB (broth) supplemented with 10 ppm neomycin for 16 h. 300 µL of this pre-culture was added to 500 mL flasks containing 30 mL of medium supplemented with 10 ppm neomycin (described below). These flasks were incubated at 33°C for 24 h, 48 h, and 72 h with continuous rotary mixing at 180 rpm. The culture was harvested by centrifugation at 14500 rpm for 20 min in conical tubes. The culture supernatant was used for protein assays and analysis. The medium was a semi-defined medium enriched with MOP buffer, using urea as the primary nitrogen source, glucose as the primary carbon source, 50 µM ZnSO4 to ensure high enzyme activity, and supplemented with 1% soybean peptone for robust cell growth. The aldB expressed in Bacillus subtilis is referred to herein as aldB_Bs. The mature nucleotide sequence of the aldB gene in plasmid aldA(CB)RIHI-Bbr is depicted in SEQ ID NO:4. The amino acid sequence of the aldB precursor protein expressed by plasmid aldA(CB)RIHI-Bbr is depicted in SEQ ID NO:5.

[0278] Example 5

[0279] Protein assay methods

[0280] Protein determination using a standard stain-free imager criterion.

[0281] Protein quantification was performed using an SDS-PAGE gel and densitometric assay with a Gel Doc™ EZ imaging system. Reagents used in the assay included: concentrated (2x) Laemmli sample buffer (Bio-Rad, catalog 161-0737); 26-well XT 4-12% Bis-Tris gel (Bio-Rad, catalog 345-0125); protein marker "Precision Plus Protein Standard" (Bio-Rad, catalog 161-0363); protein standard BSA (Thermo Scientific, catalog 23208); and SimplyBlue Safestain (Ingenium, catalog LC 6060). The assay was performed as follows: 50 µL of diluted enzyme sample was mixed with 50 µL of sample buffer containing 2.7 mg DTT in a 96-well PCR plate. The plate was sealed with a Microseal 'B' membrane from Bio-Rad Laboratories and heated to 70°C for 10 minutes in a PCR machine. Afterward, the chamber was filled with run buffer to set up the gel cassette. Then, 10 µL of each sample and standard (0.125–1.00 mg / mL BSA) were loaded onto the gel, along with 5 µL of marker. Electrophoresis was then run at 200 V for 45 minutes. After electrophoresis, the gel was rinsed three times in water for 5 minutes each time, stained overnight in safe-stain, and finally destained in water. The gel was then transferred to an imager. The intensity of each band was calculated using Image Lab software. A calibration curve was constructed using BSA (Thermo Fisher Scientific, catalog number 23208), and the amount of target protein was determined by the band intensity and the calibration curve. Enzyme samples for subsequent examples were prepared using protein quantification methods. The protein concentrations of the proteases were measured as follows: the concentrated AniPro_2 sample was 55 mg / ml, and the AnPro sample was 39 mg / ml.

[0282] Example 6

[0283] The sequence of the ALDC enzyme was identified by MS, including the determination of N-terminal and C-terminal amino acids.

[0284] During sequence confirmation, SDS-PAGE gels of the isolated truncated aldB_Bs variants were analyzed by LC-MS / MS as described later. A series of chemical treatments were performed on the protein bands from the SDS-PAGE gels of the aldB fermentation samples during sequence confirmation (including N- and C-terminal determination). Between each step, the gel sheets were washed and dehydrated with Milli-Q water, 50 w / w% ethanol, and anhydrous ethanol, respectively. Protein reduction / alkylation was performed using DTT / iodoacetamide. A guanidinization step was performed to convert lysine to homoarginine to protect the lysine side chain from acetylation. The acetylation reaction using sulfosuccinimide acetate (sulfosuccinimide acetate) modified only the N-terminal residues of the protein. The gels were then treated with 40 v / v% ethanol. 18 O water: 60v / v% 16 The gel sheet swells with a water buffer and proteolytic enzymes (trypsin and α-chymotrypsin) for protein digestion. This process preserves the natural... 16 Apart from the carboxyl terminus of O, the resulting peptide will contain 18 O and 16 The mixture of O, which will be evident from the isotopic patterns of the peptides. Peptides derived from the N-terminus of proteins will appear as the only acetylated peptides. After digestion, these peptides were extracted from the gel slides using 5 w / w formic acid and acetonitrile, then lyophilized and redissolved in 0.1 w / w TFA. The digestion products were separated and analyzed using a Proxeon nano-LC system, followed by an LTQ Orbitrap (Thermo Fisher Scientific) high-resolution mass spectrometer (C18 column), and the amino acid sequences were deduced from the MS / MS fragment spectra and isotopic patterns of the peptides (using Xcalibur 2.0SR2 software).

[0285] Based on this analysis, through acetylation and as described above 18The O-labeling method confirmed that the N-terminus of the isolated full-length protein began at A

[25] (according to SEQ ID NO. 2) and that the C-terminus of the isolated full-length protein ended at position K

[285] (according to SEQ NO. 2) (see Table 2). The N-terminal position A

[25] of the mature aldB_Bs corresponds to the predicted signal peptide cleavage of gene transcription determined by the SignalP 3.0 program (http: / / www.cbs.dtu.dk / services / SignalP / ), which is configured for the SignalP-NN system (Emanuelsson et al., (2007), Nature Protocols, 2: 953-971). Different N- and C-terminal truncated variants were further identified and are given in Table 2 according to their respective N- and C-terminal positions (according to SEQ ID NO. 2).

[0286] Table 2. N-terminal and C-terminal locations of identified aldB_Bs variants (locations according to SEQ ID NO: 2).

[0287]

[0288] This revealed that the longest mature variant of aldB_Bs contains 248 amino acids, and the shortest mature variant contains 242 amino acids, with all truncations occurring at the N-terminus.

[0289] Furthermore, the mature polypeptide sequence of aldB_Bl (aldB produced in Bacillus licheniformis) was analyzed by MS. For sequence confirmation, SDS-PAGE gels of isolated truncated aldB_Bl variants were analyzed by LC-MS / MS as described later. The protein bands from SDS-PAGE gels of aldB_Bl samples were analyzed as described above for sequence confirmation (including N- and C-terminal determination). N- and C-terminal truncated variants of aldB_Bl were further identified, and their respective N- and C-terminal positions (according to SEQ ID NO. 2) are given in Table 3.

[0290] Table 3. N-terminal and C-terminal locations of identified aldB_Bl variants (locations according to SEQ ID NO: 2).

[0291]

[0292] This revealed that the longest mature variant of aldB_Bl contains 258 amino acids, and the shortest contains 253 amino acids, with all truncations occurring at the N-terminus. Compared to aldB production in Bacillus licheniformis, aldB production in Bacillus subtilis yielded shorter aldB enzyme variants.

[0293] Example 7

[0294] Method for determining α-acetolactate decarboxylase activity

[0295] Spectrophotometric determination of α-acetolactate decarboxylase

[0296] α-Acetolactate decarboxylase (ALDC) catalyzes the decarboxylation of α-acetolactate to acetoin. The reaction product acetoin can be quantified colorimetrically. Actoin, when mixed with α-naphthol and creatine, forms a characteristic red color with absorption at OD522 nm. 522 nm ALDC activity was calculated using an acetoin calibration curve. The assay was performed as follows: A 20 mM acetolactate substrate was prepared by mixing 100 μL of ethyl-2-acetoxy-2-methylacetoacetate (Sigma, catalog number 220396) with 3.6 mL of 0.5 M NaOH for 10 min at 10°C. The pH was adjusted to 6.0 by adding 20 mL of 50 mM MES (pH 6.0), and the volume was adjusted to 25 mL with 50 mM MES (pH 6.0). 80 µL of the 20 mM acetolactate substrate was mixed with 20 µL of the enzyme sample diluted in 50 mM MES (pH 6.0), 0.6 M NaCl, 0.05% BRIJ 35, and 0.01% BSA. The substrate / enzyme mixture was incubated at 30°C for 10 min. Then, 16 µL of the substrate / enzyme mixture was transferred to 200 µL of 1 M NaOH, 1.0% α-naphthol (Sigma-Aldrich, catalog number 33420), and 0.1% creatine (Sigma-Aldrich, catalog number C3630). The substrate / enzyme / chromogenic reagent mixture was incubated at 30°C for 20 min, and then the OD was read. 522 nm One unit of ALDC activity is defined as the amount of enzyme that produces 1 µmol acetoin / min under the assay conditions.

[0297] ALDC activity was determined as described in the concentrated fermentation samples and is shown in Table 4. It was shown that aldB_Bs had the highest activity (10396 ADU / g), followed by aldB_Bl (4020 ADU / g), while no ALDC activity was detected in samples containing proline-specific endonucleases AniPro_2 or AnPro (0 ADU / g).

[0298] Table 4. ALDC (α-acetyllactate decarboxylase) activity (ADU) of aldB_Bs, aldB_Bl, AniPro_2, and AnPro samples.

[0299]

[0300] Example 8

[0301] Method for Assay of Proline-Specific Endonuclease Activity

[0302] Enzyme activity test

[0303] The protease cleavage activity (PEPU activity) at the post-proline site was determined using Z-Gly-Pro-pNA (Z- stands for benzyloxycarbonyl-, -pNA stands for -p-nitroaniline) (Bachem, Bübendorf, Germany). All pNA substrates were dissolved in 100% DMSO (100 mM) and further diluted to 0.4 mM in McIlvaine reaction buffer at pH 4.6. Unless otherwise specified, all activity assays were performed at 30°C for 10 min. The absorbance of the released pNA at 405 nm was determined spectrophotometrically using a Spectramax microplate reader (Molecular Devices, UK). Under the above conditions, the PEPU activities of AniPro_2, AnPro, aldB_Bs, and aldBL were measured on Z-Gly-Pro-pNA, and the enzyme activities of the resulting enzyme solutions are shown in Table 5. One enzyme unit is defined as the activity of releasing 1 mole of pNA from Z-Gly-Pro-pNA per minute under the reaction conditions. Clearly, AniPro_2 and AnPro exhibit high post-proline site protease cleavage activity, at 6.99 PEPU / g and 5.16 PEPU / g, respectively; while aldB_Bs and aldBL show extremely low post-proline site protease cleavage activity, at 0.11 PEPU / g and 0.01 PEPU / g, respectively.

[0304] Table 5: Post-proline cleavage activity (PEPU activity) of aldB, aldBL, AniPro_2 and AnPro samples as determined by Z-Gly-Pro-pNA.

[0305]

[0306] Example 9

[0307] Enzyme activity stability of samples containing a combination of ALDC and PEP enzymes

[0308] Acetolactate decarboxylase (ALDC) can also be used as an enzyme to prevent diacetyl formation. During fermentation, the addition of ALDC can directly convert α-acetolactate to acetoin. Furthermore, more selective proteases, such as proline-specific endopeptidase (PPI), have been known to be used to reduce beer turbidity. In more recent methods, PPI is used instead of PVPP or silica gel treatment to prevent refrigerated turbidity. Adding enzymes (proline-specific PPIs) during beer fermentation selectively hydrolyzes proline-rich proteins with turbidity activity, thereby preventing the precipitation of protein-polyphenol complexes. Simultaneous addition of ALDC and PPI during beer fermentation increases brewery flexibility and saves costs. Extensive work has been done over the years to minimize the fermentation, maturation, and stabilization stages in the brewing process (Narziss, L., Ferment [Fermentation], 1990, 3, 54-62). To investigate the stability of a mixture of ALDC and PPI for simultaneous, combined, or mixed application of two enzyme products, we studied their stability. Therefore, the following combinations were prepared as 50%:50% (w / w) mixtures: aldB_Bs + AniPro_2, aldB_Bl + AniPro_2, aldB_Bs + AnPro, and aldB_Bl + AnPro. These combinations were thoroughly mixed and analyzed separately with individual ALDC samples (aldB_Bs and aldB_Bl) and proline-specific endonuclease samples (AniPro_2 and AnPro). Ten g aliquots of each sample were stored in sealed Wheaton vials at 5°C or 30°C for up to 48 hours. α-acetolactate decarboxylase activity (ADU / g) was measured at 0, 1, 3, 24, and 48 hours throughout the stability phase, and the results are shown in Tables 6 and 7. ALDC samples of aldB_Bs and aldB_Bl showed no loss of α-acetolactate decarboxylase activity at 5°C and 30°C for up to 48 hours. The variability in acetyllactone decarboxylase activity was estimated to be as high as 10%. No ALDC activity (0 ADU / g) was detected in samples containing either the proline-specific endonuclease AniPro_2 or AnPro throughout the stability testing phase. Furthermore, aldB_Bs mixed with AniPro_2 or AnPro showed no loss of α-acetyllactone decarboxylase activity after 48 hours at 5°C and 30°C. However, aldB_Bl mixed with AniPro_2 showed residual activities of 82% and 48% after 48 hours at 5°C and 30°C, respectively. aldB_Bl mixed with AnPro showed even worse stability after 48 hours at 5°C and 30°C, with residual activities of only 68% and 6%, respectively.Therefore, compared to aldB_Bs, aldB_Bl is significantly more sensitive to mixing with proline-specific endonucleases.

[0309] Table 6. ALDC (α-acetolactate decarboxylase) activities (ADU / g) of aldB_Bs, aldB_Bl, AniPro_2, AnPro, and 50%:50% (w / w) mixed samples (aldB_Bs + AniPro_2, aldB_Bl + AniPro_2, aldB_Bs + AnPro, aldB_Bl + AnPro). The activities of all samples were measured in duplicate over a period of up to 48 hours, and the residuals were calculated based on the activity at 0 hours.

[0310]

[0311] Table 7. ALDC (α-acetyllactone decarboxylase) activities (ADU / g) of aldB_Bs, aldB_Bl, AniPro_2, AnPro, and 50%:50% (w / w) mixed samples (aldB_Bs + AniPro_2, aldB_Bl + AniPro_2, aldB_Bs + AnPro, aldB_Bl + AnPro). The activities of all samples were measured in duplicate over a period of up to 48 hours, and the residuals were calculated based on the activity at 0 hours.

[0312]

[0313] Furthermore, according to Example 8, proline post-proline site protease cleavage activity (PEPU) was measured throughout the stability phase at 30°C for 0, 1, 3, 24, and 48 hours, and at 5°C for 0, 24, and 48 hours. The results are shown in Tables 8 and 9. This assay included a combination of AnPro and AniPro_2 as a 50%:50% (w / w) mixture.

[0314] Throughout the stability testing phase, no significant PEPU activity (0 ADU / g) (< 0.11 PEPU / g) was observed in either the ALDC samples aldB_Bs or aldB_Bl. AniPro_2 or AnPro showed no loss of PEPU activity at 5°C and 30°C for up to 48 hours, including mixtures thereof. Furthermore, aldB_Bs mixed with AniPro_2 or AnPro showed virtually no loss of PEPU activity (< 4%) at 5°C and 30°C for up to 48 hours, and the results were similar to those for aldB_Bl mixed with AniPro_2 or AnPro (< 4%). Therefore, the PEPU activity of AniPro_2 or AnPro is highly stable, whether alone or in combination with ALDC enzyme preparations.

[0315] Table 8. Proline cleavage activity (PEPU / g activity) of aldB_Bs, aldB_Bl, AniPro_2, AnPro, and 50%:50% (w / w) mixed samples (aldB_Bs + AniPro_2, aldB_Bl + AniPro_2, aldB_Bs + AnPro, aldB_Bl + AnPro, AniPro_2 + AnPro) stored at 5°C using Z-Gly-Pro-pNA. The activity of all samples was measured in duplicate over a period of up to 48 hours, and the residuals were calculated based on the activity at 0 hours.

[0316]

[0317] Table 9. Proline cleavage activity (PEPU / g activity) of aldB_Bs, aldB_Bl, AniPro_2, AnPro, and 50%:50% (w / w) mixed samples (aldB_Bs + AniPro_2, aldB_Bl + AniPro_2, aldB_Bs + AnPro, aldB_Bl + AnPro, AniPro_2 + AnPro) stored at 30°C using Z-Gly-Pro-pNA. The activity of all samples was measured in duplicate over a period of up to 48 hours, and the residuals were calculated based on the activity at 0 hours.

[0318]

[0319] Example 10

[0320] By using aldB to reduce diacetyl and 2,3-pentanedione during beer fermentation

[0321] The purpose of this analysis was to test the ability of the combination of acetolactate decarboxylase (ALDC) aldB expressed in Bacillus subtilis and Bacillus licheniformis with a proline-specific endonuclease to reduce the production of diacetyl and 2,3-pentanedione (VDK) during fermentation at 14°C for 7 days.

[0322] Pure malt brewing analysis

[0323] 1100 g of malt extract (Harboe Barlex 7203 light malt extract, batch 2139121, expiry date December 2, 2024) was dissolved in 6000 ml of warm tap water (45°C). The slurry was stirred for approximately 10 min until homogenized, and the pH was adjusted to 5.2 with 2.5 M sulfuric acid. 22 bitter hops from the St. Johann Hopfenveredlung were added to the slurry: medium-alpha golden hops. The mixture was then dispensed into 500 mL blue cap bottles and boiled for 1 hour to ensure protein precipitation and prevent potential microbial contamination. The final wort had an initial specific gravity of 1.048 (i.e., 12° Pareto). 200 g of filtered wort was added to 500 ml Erlenmeyer flasks (fermentation vessels; FV) and then cooled to 13°C. Each conical flask was given 0.5% freshly produced yeast from W34 / 70 (Weihenstephan beer) (1.0 g yeast / 200 g wort). Enzymes were added according to Table 10, with all enzymes added at the start of fermentation. Two fermentation trials were conducted for each enzyme addition.

[0324] Table 10. Dosage of ALDC enzymes (aldB_Bs and aldB_Bl), PEP enzyme (AniPro_2), and combinations of ALDC and PEP (AniPro_2 + aldB_Bs, AniPro_2 + aldB_Bl, and AnPro + aldB_Bl) at the initial stage of beer fermentation experiments. The following ALDC and PEP combinations were prepared as 50%:50% (w / w) mixtures: aldB_Bs + AniPro_2, aldB_Bl + AniPro_2, aldB_Bs + AnPro, and aldB_Bl + AnPro. All combinations were stored at 30°C for 6 hours before being added to the beer fermentation experiments. A control group was established without the addition of any enzymes.

[0325]

[0326] Before addition, an enzyme solution was prepared using malt extract to ensure that the amount of extract was the same in all samples. The malt extract samples were fermented in 500 ml Erlenmeyer flasks at 14°C in a rotary incubator with gentle stirring at 150 rpm under standardized laboratory testing conditions. After 24 hours, when the weight loss was less than 0.25 g, the fermentation temperature was lowered to 7°C. Fermentation was stopped after a total of 7 days. 10 ml samples were taken twice daily for diacetyl and 2,3-pentanedione analysis, preferably with an interval of 11 to 14 hours between samplings; at the end of fermentation, only one sample was taken daily. Before removal, the yeast was allowed to stand and each sample was cooled at 10°C for 10 minutes, then centrifuged at 8°C at 4000 rpm for 10 minutes to precipitate any residual yeast. The supernatant was separated from the yeast, and 0.5 g NaCl / ml of sample was added to the sample used for GC analysis. The slurry was transferred to a headspace vial and heat-treated at 65°C for 30 minutes, followed by analysis of diacetyl and 2,3-pentanedione by gas chromatography-mass spectrometry (GCMS).

[0327] Analysis was performed on an Agilent 6890N / 5973N GC with a CombiPAL headspace autosampler and MSChemStation acquisition and analysis software. Samples were equilibrated at 70°C for 10 min, followed by a 500 µL gas fraction injection into a J&W 122-0763 DB-1701 column (60 m × 0.25 mm ID × 1 µm). The injection temperature was 260°C, and the system was run at a constant helium flow rate of 2 ml / min. Oven temperatures were set at 50°C (2 min), 160°C (20°C / min), and 220°C (40°C / min) for 2 min. MS detection was performed with 500 µL of the selected ion at a split ratio of 5:1. All samples were run in duplicate, and standards were prepared using tap water supplemented with diacetyl or 2,3-pentanedione.

[0328] The concentration of the compound is calculated as follows:

[0329]

[0330] in,

[0331] RF is the response factor to acetic acid.

[0332] The area is the GC-area of ​​acetic acid.

[0333] W s This refers to the amount of sample used (in mL).

[0334] The limits for diacetyl quantification are 0.016 mg / L, and the limits for 2,3-pentanedione quantification are 0.012 mg / L.

[0335] To check whether the addition of ALDC enzymes does not affect the actual degree of fermentation (RDF) and the alcohol produced by volume: RDF was measured using Anton Paar (DMA 5000) following Standard Instruction Brewing 23.8580-B28, and alcohol was measured using Standard Instruction Brewing 23.8580-B28.

[0336] The actual degree of fermentation (RDF) value can be calculated using the following formula:

[0337]

[0338] Where: RE = Actual extract = (0.1808 × °P) 初始 ) + (0.8192 × °P 最终 ), °P 初始 It is the specific gravity and °P of the standardized wort before fermentation. 最终 It is the specific gravity of fermented wort expressed in Plato degrees.

[0339] In this context, actual degree of fermentation (RDF) is determined from specific gravity and alcohol concentration.

[0340] Specific gravity and alcohol concentration were determined for the fermented samples using a Beer Alcolyzer Plus and a DMA 5000 densitometer (both from Anton Paar, Graz, Austria). Based on these measurements, the actual degree of fermentation (RDF) value was calculated according to the following formula:

[0341]

[0342] Where E(r) is the actual extract in Plato degree (°P), and OE is the initial extract in °P.

[0343] The ability of adding ALDC, PEP, and their combinations to reduce diacetyl and 2,3-pentanedione (VDK) production during a 7-day fermentation at 14°C was investigated. VDK production was analyzed as described above. Fermentation with added enzymes was always compared to a control without any enzymes. For comparison, the calculated VDK content was defined as the sum of diacetyl and 2,3-pentanedione. The results for the control without enzymes, aldB_Bs, aldB_Bl, and AniPro_2 are shown in Table 11. It can be seen that aldB_Bs and aldB_Bl effectively reduced diacetyl and 2,3-pentanedione throughout the fermentation process, while AniPro_2 showed similar results to the control without any enzymes. The results in Table 11 indicate that the addition of both ALDC enzymes significantly affected the maximum VDK level, with the highest VDK level in the control approximately six times the lowest level in the samples with added ALDC enzymes.

[0344] Table 11. Average values ​​of diacetyl, 2,3-pentanedione, and total VDK content throughout the 0-164 hour fermentation of malt beer. Includes a control without enzymes, 0.5 g / hL aldB_Bs, 0.5 g / hL aldB_Bl, and 0.5 g / hL AniPro_2.

[0345]

[0346] The results for the control group without added enzymes and the combinations (AniPro_2 + aldB_Bs, AniPro_2 + aldB_Bl, and AnPro + aldB_Bl) are shown in Table 12. Enzymes were added individually during beer fermentation. It can be seen that aldB_Bs was not significantly affected when PEP enzymes (AniPro_2 or AnPro) were applied simultaneously. However, compared to using aldB_Bl alone, the effect was affected when aldB_Bl was used in combination with PEP enzymes during fermentation (added as a single enzyme (unmixed)). The results for the formation of vitamin D (VDK) during beer fermentation are also shown in Table 12. Figure 8This section shows the application of aldB_Bl alone, or a mixture of aldB_Bl and AnPro (bl-50% : 50%), or a mixture of aldB_Bl and AniPro_2 (bl). Application of aldB_Bs alone, or a mixture of aldB_Bs and AnPro (bl-50% : 50%), or a mixture of aldB_Bs and AniPro_2 (bl) is also shown. Additionally, AniPro_2 alone and a control sample (Ctrl) without enzyme addition are also shown. For samples treated with aldB_Bs alone or aldB_Bl, or both combined with one of the two PEP enzymes, the maximum VDK reached during fermentation and the fermentation time required to reduce the VDK threshold level below 0.1 mg / L are shown. Figure 3 a and Figure 3 b (ALDC and PEP are applied separately). Figure 3 The data indicate that aldB_Bl is more negatively affected than aldB_Bs. Furthermore, the impact is greatest when using AnPro as the PEP enzyme, requiring 164 hours of fermentation (compared to 137 hours with AniPro_2) to reach 0.1 mg / L VDK. Therefore, aldB_Bl is found to be more sensitive than aldB_Bs when used with PEP enzymes during fermentation. We acknowledge that the relative increase in time required to reach 0.1 mg / L VDK appears to be affected for both aldB enzymes. However, these estimates are extrapolated from only a very small number of data points.

[0347] Furthermore, aldB_Bl is less affected when used with AniPro_2 (compared to AnPro) and when ALDC enzymes and PEP enzymes are applied separately to beer fermentation.

[0348] Table 12. Average values ​​of diacetyl, 2,3-pentanedione, and total VDK content during the entire malt beer fermentation process from 0 to 164 hours. Control without enzyme addition, AniPro_2 + aldB_Bs (0.5 g / hL + 0.5 g / hL), AniPro_2 + aldB_Bl (0.5 g / hL + 0.5 g / hL), AnPro + aldB_Bl (0.5 g / hL + 0.5 g / hL).

[0349]

[0350] The results for the control group without added enzymes and the premixed combinations (AniPro_2 + aldB_Bs, AniPro_2 + aldB_Bl, and AnPro + aldB_Bl) are shown in Table 13. All enzyme combinations (1 g / hL) were mixed and incubated at 30°C for 6 hours before being added to beer fermentation. This served as a simulation of an enzyme tank. Samples were applied as premixes of ALDC and PEP enzymes, and the data showed that aldB_Bs performed well when premixed with AniPro_2, exhibiting the same VDK reduction as when applied alone (0.331 mg / L vs. 0.314 mg / L), and slightly worse when premixed with AnPro (0.354 mg / L vs. 0.314 mg / L). See also: Figure 4 a and Figure 4 b. The sensitivity of aldB_Bl was significantly higher when premixed with PEP enzymes. Specifically, when premixed with AniPro_2, the maximum VDK increased from 0.462 mg / L to 0.771 mg / L, and when premixed with AnPro, it increased to 1.401 mg / L. Furthermore, the fermentation time required to reduce the VDK threshold level increased from 127 hours to 161 hours and 170 hours, respectively.

[0351] Surprisingly, using a premix of aldB_Bs and AniPro_2 saved 60 hours of fermentation time compared to premixes of aldB_Bl and AnPro.

[0352] In summary, premixing with PEP enzymes has a much greater negative impact on aldB_Bl than on aldB_Bs. The greatest impact was observed when premixing with AnPro, while the impact was less when premixing with AniPro_2.

[0353] Table 13. Average values ​​of diacetyl, 2,3-pentanedione, and total VDK content throughout the entire malt beer fermentation process from 0 to 164 hours. Control without added enzymes, AniPro_2 + aldB_Bs, AnPro + aldB_Bl, AnPro + aldB_Bs, AniPro_2 + aldB_Bl. All enzyme combinations (1 g / hL) were mixed and incubated at 30°C for 6 hours before being added to beer fermentation.

[0354]

[0355] Example 11

[0356] Proteases derived from proline-specific proteases, ALDC enzymes, and their combinations in turbidity-sensitive beers demonstrate anti-turbidity properties.

[0357] Cloudy sensitive beer substrate

[0358] To test the performance of proline-specific proteases, ALDC enzymes, and combinations thereof, bottled turbidity-sensitive beer was used as the substrate. The beer brewed at the 2 hL pilot-scale brewery was unstabilized, therefore, a filtered, untreated, all-malt Pilsner with an RDF of approximately 66% and an alcohol content of 4.7% (v / v). As described in Table 14, the beer was filtered using an 8-plate diatomaceous earth filter with a pre-coated and main feed. After diatomaceous earth filtration, the beer passed first through a 1.2 µm membrane filter and then through a 0.45 µm membrane filter.

[0359] Table 14 Preparation of diatomaceous earth filtration with a flow rate of 160 l / hr.

[0360]

[0361] Enzyme incubation and pasteurization

[0362] The enzyme was applied to bottled beer by opening the capsule (crown cap) and adding the enzyme solution (using a viscous liquid pipetting method to limit oxidation), and the bottle was immediately resealed with a new capsule. A control beer sample was prepared similarly, with an equal volume of milliQ water (ddH2O) added to the enzyme solution. The enzyme was applied at low and high doses as shown in Table 15 below. The combination of ALDC and PEP was not premixed before addition.

[0363] Table 15. Dosage (g / hL) of ALDC enzymes (aldB_Bs and aldB_Bl) and PEP enzymes (AniPro_2 and AnPro) in turbidity-sensitive beer. A control beer sample was prepared similarly, with milliQ water (ddH2O) added.

[0364]

[0365] Beer samples were stored at 14°C for 5 days to allow the enzymes to activate. Subsequently, the samples were pasteurized in a water bath to approximately 30 PU by heating to 63°C (60 minutes) and maintaining the temperature at 63°C for 60 minutes, then the heat source was turned off and the temperature was lowered to room temperature (approximately 20°C).

[0366] Assessment of the likelihood of turbidity in beer samples

[0367] The prediction of turbidity development in beer samples was assessed using a forced turbidity method based on EBC Analytica method 9.30 "Prediction of beer shelf life," hereinafter referred to as the EBC TOHA forced turbidity method. Instrument calibration was performed according to the supplier's instructions, and turbidity measurements are expressed in EBC units.

[0368] Forced Turbidity EBC TOHA Method

[0369] Turbidity of beer was measured using a Sigris LabScat2. Turbidity was measured at a 90° scattering angle (S90 / S0 EBC) to detect the presence of small particles, and turbidity measured at a 25° scattering angle was used as additional information about larger particles. Turbidity was measured at 20°C prior to alternating cooling and heating cycles on the bottled sample; this measurement is called the blind value.

[0370] The sample was then placed in a constant temperature water bath (Julabo, Germany) and the temperature was lowered to 0°C and maintained for 24 hours. The turbidity was measured at 0°C and is referred to as the initial total turbidity.

[0371] Beer samples were placed in a constant-temperature water bath and kept at 60°C for 48 hours, then cooled to 0°C and kept there for 24 hours. Turbidity was measured at 0°C and termed final total turbidity. Results are shown below. Figure 5 A and Figure 5 B, where the turbidity measured according to the EBC TOHA method (EBC 90°) is divided into initial total turbidity and final total turbidity. Furthermore, the initial total turbidity and final total turbidity of large particles (EBC 25°) measured according to the EBC TOHA method are shown in [Figure / Table / Illustration]. Figure 6 A and Figure 6 B.

[0372] The measurements of initial and final total turbidity clearly show that both endopeptides significantly reduced beer turbidity compared to a reference without proteases. AniPro_2 exhibited the greatest anti-turbidity effect at both dosages (0.5 g / hL and 2.0 g / hL), as determined by turbidity assessments at EBC 25° and EBC 90°. Individual ALDC enzymes (aldB_Bs and aldB_Bl) did not show a significant effect on turbidity. However, both ALDC enzymes showed a slight but significant negative effect on both proline-specific endopeptides. This effect was highest at the low dosage of proline-specific endopeptides (0.5 g / hL), but the most significant effect on final total turbidity was observed by turbidity assessments at EBC 25° and EBC 90°. In all cases, aldB_Bl had the greatest negative impact compared to aldB_Bs. This result does not consider that the enzyme activity of aldB_Bl was only 4020 ADU / g, compared to 10396 ADU / g for aldB_Bs. At 0.5 g / hL, AniPro_2 had a relative negative impact of turbidity reduction of 4.5% and 9.5% at EBC 90° and EBC 25°, respectively; while AnPro had a relative negative impact of 6.0% and 11.3% at 0.5 g / hL, respectively. This suggests that AniPro_2 appears to be more compatible with ALDCs than AnPro, and can be combined with at least two different ALDC enzymes over a wide dosage range to effectively reduce beer turbidity. However, these differences are minimal compared to the effects produced by the protease itself. The optimal combination of proline-specific protease and ALDC was found to be AniPro_2 and aldB_Bs, which achieved the highest anti-turbidity effect at the tested dosage, thus providing the longest colloidal shelf life for beer.

[0373] Example 12

[0374] SDS-PAGE protein assay method for ALDC and PEP stability samples

[0375] Protein quantification was performed using an SDS-PAGE gel and densitometric assay with a Geldoc Go imaging system from BioRad. Reagents used in the assay included: concentrated (2x) Laemmli sample buffer containing 350 mM DDT (BioRad, catalog 161-0737); gel SDS-PAGE, NuPaGE Novex 4%–12% Bis-Tris; and the protein biomarker “Precision Plus Protein Standard” (BioRad, catalog 161-0363).

[0376] MES buffer: 35 mL 20x Novex NuPAGE MES SDS running buffer from Ingenium in 700 mL ddH2O; dilution buffer (sample): 0.1 M sodium phosphate buffer at pH 7.0, and SimplyBlue Safestain (Ingenium, catalog number LC 6060). Sample preparation was performed as follows: In a 96-well PCR plate, 50 µL of diluted enzyme sample was mixed with 50 µL of sample buffer containing DTT. The plate was sealed with a Microseal 'B' membrane from Bio-Rad Laboratories and heated to 70°C for 10 minutes in a PCR machine. Afterward, the chambers were filled with running buffer, and the gel cassette was set. Then, 10 µL of each sample and standard (0.125–1.00 mg / ml BSA, if used) were loaded onto the gel, along with 5 µL of marker. Electrophoresis was then run at 200 V for 45 min (120 mA). After electrophoresis, the gel was cooled to 20°C, rinsed three times in water for 5 min each time, stained overnight in SimplyBlue SafeStain (Ingenieur), and finally destained in water. The gel was then transferred to a Bio-Rad Geldoc Go imaging system. The intensity of each band was calculated using ImageLab software. Calibration curves were constructed using known amounts of protein from standard samples. The content of protein band variants was determined relative to the band intensity displayed on the gel.

[0377] Similar to the samples prepared in Example 9, we investigated the stability of ALDCs mixed with proline-specific endopeptides. Therefore, the following combinations were prepared as 50%:50% (w / w) mixtures: aldB_Bs + AniPro_2, aldB_Bl + AniPro_2, aldB_Bs + AnPro, and aldB_Bl + AnPro. These combinations were thoroughly mixed and analyzed separately with individual ALDC samples aldB_Bs and aldB_Bl. SDS-PAGE analysis was performed on samples incubated at 0 h, 30°C for 3 h, and 30°C for 24 h to simulate the stability of the enzyme product as a mixed product added to beer fermentation, and its stability during beer fermentation. The enzyme-protein stability results obtained from SDS-PAGE analysis are shown below. Figure 7 Furthermore, sample descriptions for gel swimming lanes are given in Table 16.

[0378] Clearly, both AldB_Bs and AldB_Bl (Mw: 31-35 kDa) are stable individually, and their bands appear unchanged after 24 hours of incubation at 30°C. The same results were observed for PEP AniPro_2 and AnPro (Mw: 56-62 kDa). However, combinations prepared as 50%:50% (w / w) mixtures (aldB_Bs + AniPro_2, aldB_Bl + AniPro_2, aldB_Bs + AnPro, and aldB_Bl + AnPro) showed differences in band pattern development after 24 hours of incubation at 30°C.

[0379] For aldB_Bs + AniPro_2, no change in the SDS page band pattern was observed during incubation at 30°C or compared separately with aldB_Bs and AniPro_2, indicating that both enzymes are stable in the mixture. aldB_Bl + AniPro_2 showed a significant shift in aldB_Bl from 35.5 kDa to 32.7 kDa, with weak bands appearing at 15, 12, and 9 kDa, indicating slight degradation of aldBs in the presence of AniPro_2. Furthermore, for aldB_Bs + AnPro, no change in the SDS page band pattern was observed during incubation at 30°C or compared separately with aldB_Bs and AnPro, clearly indicating that both enzymes are stable in the mixture. However, after 3 hours at 30°C, the aldB_Bl + AnPro assay again showed a significant shift in aldB_Bl, moving from 35.5 kDa to 32.7 kDa, with weak bands appearing at 15 kDa, 12 kDa, and 9 kDa, indicating severe degradation. After 24 hours at 30°C, the 32.7 kDa aldB_Bl fragment underwent further transformation, accumulating new fragments at 14.5 kDa and 7.8 kDa. This clearly demonstrates that aldB_Bl also degrades in the presence of AnPro, consistent with the activity analysis.

[0380] Table 16. SDS-page: Sample description, dilution, and loading. As indicated, incubate ALDC, PEP, or combinations of samples for 0 hours, 3 hours at 30°C, and 24 hours at 30°C. Combinations prepared as 50%:50% (w / w) mixtures include: aldB_Bs + AniPro_2, aldB_Bl + AniPro_2, aldB_Bs + AnPro, and aldB_Bl + AnPro.

[0381]

[0382] As described in Example 6, the truncated variants of aldB_Bl (14.5 kDa) and (7.8 kDa) were analyzed by sequence identification using MS, including the determination of the unique N-terminal and C-terminal amino acids. The sequences of the truncated variants of aldB_Bl (14.5 kDa) and (7.8 kDa) were confirmed to be 100% matches of aldB SEQ ID NO: 2. Further identification of the N- and C-terminal truncated variants of the aldB_Bl ((14.5 kDa) and (7.8 kDa)) was performed, and their respective N- and C-terminal positions (according to SEQ ID NO. 2) are given in Table 17.

[0383] The C-termini of both the truncated aldB_Bl variants (14.5 kDa and 7.8 kDa) were found to be truncated at the K

[162] and K

[109] positions. This suggests lysine-specific protease-mediated cleavage. The molecular weight of the experimentally determined truncated aldB_Bl variant (14.5 kDa) roughly corresponds to the calculated mass (A28-K162) 14.9 kDa, and the molecular weight of the truncated aldB_Bl variant (7.8 kDa) roughly corresponds to the calculated mass (A28-K109) 8.7 kDa.

[0384] Table 17 N-terminal and C-terminal locations of identified aldB_Bl variants (locations according to SEQ ID NO: 2).

[0385]

[0386] Example 13

[0387] Construction of strain BRA8014

[0388] The ALDC strain is a derivative of *Bacillus subtilis* subsp. *subtilis*. The protease genes in this strain were removed via homologous recombination, similar to the introduction of other genes. The *epr*, *isp*, *bpf*, *vpr*, *wprA*, *mpr-ybfJ*, *nprB*, and *alrA* genes were deleted, and the *comK* gene was introduced at the *amyE* locus, resulting in the final host strain BG6014. Subsequently, the plasmid *alrA(CB)RIHI-Bbrev*, containing the *Bacillus shortbreader* acetolactate decarboxylase (ALDC) gene (transcribed from the *aprE* promoter and fused with the *alrA* gene as a selectable marker), was transformed into strain BG6014. Finally, the competent regulatory gene *comK* was removed from the strain again, resulting in strain BRA8014.

[0389] The production strain is constructed as described in the example below.

[0390] Example 14

[0391] The absence of alkaline protease and the introduction of the scoC gene

[0392] As described by Stahl and Ferrari, J. Bacteriology 158, 411-418 (1984), the alkaline protease gene (aprE) (SEQ ID NO:18) was deleted in Bacillus subtilis. Simultaneously with the introduction of the aprE deletion, another mutant, scoC4, was introduced into Bacillus subtilis. It is known that the scoC and aprE genes are linked in PBS1 transduction.

[0393] Example 15

[0394] Deficiency of neutral protease

[0395] The next step in strain construction was to introduce a deletion in the second extracellular protease (neutral protease (nprE) (SEQ ID NO:19)). As described above for the aprE gene, a deletion of the nprE gene was created in the study strain using recombinant DNA technology (Yang et al., J. Bacteriology 160, 15-61 (1984)), and the mutated gene was then introduced into the strain that had already deleted aprE.

[0396] Example 16

[0397] Deprivation of extracellular proteases:

[0398] Using a similar recombination technique as used in aprE deletion, the minor extracellular protease gene (epr) (SEQ ID NO:20) was deleted from the host strain. The deletion consisted of 900 base pairs of the epr gene and was verified by Southern hybridization. After this deletion, no heterologous DNA remained in the host strain.

[0399] Example 17

[0400] Removal of intracellular serine proteases:

[0401] The intracellular serine protease gene (isp) (SEQ ID NO:21) was deleted by 1200 bp using a recombination technique similar to that used in aprE deletion. The deletion of isp was monitored by activity and DNA blotting. No foreign DNA residue was found in the host strain.

[0402] Example 18

[0403] Removal of bacitrapeptidase F protease:

[0404] The bacitrapeptidase F gene (bpf) (SEQ ID NO:22) was deleted using a similar recombination technique as used in aprE deletion, resulting in a 114 bp deletion of the bpf gene. As measured by colony hybridization, no foreign DNA remained in the host strain after the deletion was completed.

[0405] Example 19

[0406] Removal of the wprA gene:

[0407] The wprA gene (cell wall protease) deletion (SEQ ID NO:23) was introduced into Bacillus subtilis strains by removing the first 738 amino acids (including the ribosome binding site and start codon of the wprA gene). A plasmid containing the spectinomycin gene was constructed, with the flanking regions of the spectinomycin resistance gene being: one side being the DNA sequence upstream of the wprA gene, and the other side being the region downstream of amino acid 739 in WprA. A second plasmid was constructed containing the kanamycin resistance gene (Trieu-Coet, P. and P. Courvalin. 1983. Gene [gene] 23: 331-341), a temperature-sensitive origin of replication (TsOri, which can be integrated at temperatures above 37°C), and the same DNA fragment except for the spectinomycin resistance gene. First, the spectinomycin-containing plasmid was integrated into Bacillus subtilis through double crossover, thereby replacing the complete wprA gene. In the second transformation, a plasmid containing TsOri was integrated into a spectinomycin-containing strain via Campbell's method, thereby introducing a cassette containing both wprA deletion and spectinomycin gene deletion into the chromosome. Using chromosomal DNA, this cassette was transformed into a Bacillus subtilis host. This resulting host was grown at an acceptable temperature (30°C) in the absence of antibiotics, and the population was screened to identify clones that simultaneously lost both kanamycin and spectinomycin resistance and carried the wprA deletion.

[0408] Example 20

[0409] Removal of the vpr gene:

[0410] A deletion of the wild-type vpr gene (extracellular serine protease) (SEQ ID NO:24), constructed in vitro, was introduced into Bacillus subtilis. The plasmid vpr / pUCTsKan (carrying a 650-base-pair deletion in the middle of the vpr gene) was introduced into the strain via naturally competent cells. This deletion is located on a plasmid carrying the kanamycin resistance gene (kan) and a temperature-sensitive origin of replication (TsOri). Due to TsOri, the plasmid integrates into the chromosome at an unpermitted temperature (e.g., 48°C) through a region homologous to the vpr gene. After integration, the strain carrying the integrated plasmid grows profusely at permitted temperatures in the absence of kanamycin. This allows the plasmid to be excised and lost, resulting in either the wild-type vpr sequence or a deletion mutant lacking the vpr gene.

[0411] Example 21

[0412] Removal of the mpr-ybfJ gene:

[0413] The intact mpr gene (extracellular serine protease) (SEQ ID NO:25) (including its upstream ribosome binding site and the largely overlapping downstream ybfJ gene (SEQ ID NO:26)) was deleted (1.2 kb) using the cre-lox method as described in (Yan, X, Hao-Jie, Y, Hong, Q, and Shun-Peng, L, Appl.Env. Microbiol. [Applied and Environmental Microbiology], 74:5556-5562, 2008). Spectinomycin resistance genes flanking lox sites were used to select for integration of the deleted DNA via double crossover. The spectinomycin resistance gene was then removed by introducing a plasmid with a temperature-sensitive origin of replication (TsOri) that expresses the cre recombinase gene under the control of the Pspac promoter. The TsOri plasmid was selected by the presence of a humicin resistance gene on the vector. Strains that lost the spectinomycin resistance gene through lox site recombination were identified by their susceptibility to spectinomycin. The TsOri plasmid was eliminated by growth at an unpermitted temperature (e.g., 42°C), and plasmid loss was detected by cymoxanil sensitivity. Correct deletions were double-tested by PCR analysis. After recombination, a lox site (34 bp) remained at the deletion site.

[0414] Example 22

[0415] Removal of the nprB gene:

[0416] Using the cre-lox method described above, almost the entire coding region (1.5 kb) of the nprB gene (extracellular metalloproteinase) (SEQ ID NO:27) was deleted. The deletion was double-checked by PCR analysis. A lox site will remain at the deletion site.

[0417] Example 23

[0418] Construction of plasmid pCB-alrA-Bbrev

[0419] The aldB gene (Bbrev) from the strain *Bacillus brevis* encodes acetyllactone decarboxylase. This enzyme has been described (Diderichsen et al., (1990) J. Bacteriol, 172(8), 4315), and the complete nucleotide sequence of the gene is available (GenBank, accession number: AP008955.1, protein ID: BAH46868.1). The aldB gene was constructed synthetically (IDT), in which the signal peptide from the *Bacillus subtilis* aprE gene (Ferrari et al., (1988) J. Bacteriol, 170(1), 289-95) was fused to the mature protein-coding region of aldB. The synthesized aldB gene sequence was identical to that previously reported (Diderichsen et al., 1990, ibid.), however, two restriction enzyme sites (KpnI and BsrGI) were removed through silencing mutations. For cloning purposes, a SpeI site was introduced at the 5' end and a HindIII site was introduced at the 3' end. The synthetic aldB gene fused with the aprE signal peptide (SEQ ID NO:28) is shown. The deduced amino acid sequence of the mature aldB gene is shown in SEQ ID NO:3.

[0420] The pCB-alrA-Bbrev plasmid was constructed using USER-Friendly Cloning at New England BioLabs, as follows: Using the pCB-EZ1-alrA plasmid DNA as a template, the pCB-alrA vector backbone was amplified using the following primers:

[0421] AL2 (5'-ACTAGTTACCCTCTCCTTTTAAAAAA-3') (SEQ ID NO:29), and

[0422] AL9 (5'-ATAAAAGCTTACATAAAAAACCGGCCT-3') (SEQ ID NO: 30).

[0423] Therefore, one end of this PCR fragment contains a 600 bp Bacillus subtilis aprE promoter, starting at the EcoRI site upstream of the aprE promoter and terminating at the SpeI site introduced at the GTG start codon (derived from the original pBNppt-based plasmid). The other end contains a Bacillus subtilis protease (BPN') terminator from Bacillus amyloliquefaciens, located on a 250 bp HindIII BamHI fragment (also derived from the original pBNppt-based plasmid). The mature aldB coding sequence containing the Bacillus subtilis aprE signal sequence was amplified by PCR using the following primers:

[0424] AL3 (5'-AACTAGTGAGAAGCAAAAAATTGTG-3') (SEQ ID NO:31), and

[0425] AL10 (5'-AGCTTTTATTTTTCTTTCTGACTCAGCT-3') (SEQ ID NO: 32).

[0426] Purify the amplicon using the Wizard PCR Purification Kit according to the manufacturer's instructions.

[0427] Then, following the manufacturer's instructions, the purified amplicon was seamlessly cloned and ligated using the USER-Friendly Cloning Kit from New England Biolabs to generate the plasmid pCB-alrA-Bbrev. The reaction product was then ligated using T4 ligase to ensure a stable construct. The pCB-alrA-Bbrev plasmid was validated by DNA sequencing.

[0428] Example 24

[0429] Construction of Bbrev expression vector alarA(CB)RIHI-Bbrev

[0430] The expression cassette of the aldB gene (Bbrev) was cloned head-to-head relative to the aldA expression cassette using the Gibson Assembly Cloning Kit from New England Biolabs. The aldA expression cassette was generated by PCR using plasmid DNA from pUCalrA(CB)RIHI as a template and the following primers:

[0431] AL19, alrA(CB)RIHI forward primer (5'-GGATCCTGACTGCCTGAG-3') (SEQ ID NO:33), and

[0432] AL20,alrA(CB)RIHI reverse primer (5'-GGAGAAAGGCCAAACATG-3') (SEQ ID NO:34).

[0433] Using pCB-alrA-Brev as a template, the aldB expression cassette was amplified by PCR using the following primers:

[0434] AL21, Bbrev-RIHI forward primer (5'-TGTTTGGCCTTTCTCCGAATTCCTCCATTTTCTTCTG-3') (SEQ ID NO:35), and

[0435] AL22, Bbrev-RIHI reverse primer (5'-AGGCAGTCAGGATCCGATTACGAATGCCGTCTC-3') (SEQ ID NO:36).

[0436] The amplicon was column purified using the Wizard PCR Purification Kit, following the manufacturer's instructions. Subsequently, the purified amplicon was seamlessly cloned and ligated using the Gibson Assembly Cloning Kit from New England Biolabs, following the manufacturer's instructions, to generate the vector alrA(CB)RIHI-Bbrev.

[0437] Example 25

[0438] The acetyllactate decarboxylase production vector alrA(CB)RIHI-Bbrev was transformed and amplified into BG6014.

[0439] The alrA(CB)RIHI-Bbrev production vector was amplified using the GE Healthcare TempliPhi RCA kit to create a transformable DNA tandem. The reaction mixture was then used to transform competent BG6014 cells (step 21), introducing the aldB:alrA expression cassette into the host's aprE or alrA locus via homologous recombination. Cells were then plated on standard LA plates without D-alanine, as only colonies integrating the alrA expression cassette can grow in the absence of D-alanine. For screening gene amplification, colonies were seeded onto fresh 200 ppm β-chloro-D-alanine (CDA) plates and incubated at 37°C for 1 day, then seeded onto 400 ppm CDA plates, and this step was repeated. For final amplification, colonies were seeded onto fresh 500 ppm CDA plates and incubated at 37°C for 1 day. Colonies were screened and named BRA7997. The aldB gene was validated using DNA sequencing.

[0440] To determine the integration site, PCR was performed using the following primers: ydoC400F

[0441] (GGATGTCGCCACAAGCGCAAAGCCTTCC) (SEQ ID NO:37) and alrA-ATG-R

[0442] (ATCGCGGACAAGTCAATTTCCGCCCAC) (SEQ ID NO:38), if integration occurs at the aprA locus, a band of approximately 537 bp should be produced; if integration does not occur at this site, no band will be produced. Alternatively, integration at the aprE locus can be assessed by PCR using the following primers: yhfO-RI-R(CGTTGGATAGAGCTGGGTAAAGCCTATG) (SEQ ID NO:39) and Bbrev-R(aprE)(CGTTGAGTATTGAAACAGTA) (SEQ ID NO:40). If integration occurs at the aprE locus, a band of approximately 832 bp should be produced; if integration does not occur at this site, no band will be produced. The integration site was verified to be located at the aprE locus.

[0443] While preferred embodiments of the invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Many variations, alterations, and substitutions will occur to those skilled in the art without departing from the invention. Various alternatives to the embodiments of the invention described herein can be used to implement the invention. The scope of the invention is intended to be defined by the following claims, and methods and structures within the scope of these claims, as well as their equivalents, are also included within the scope of the invention.

Claims

1. A polypeptide having acetolactate decarboxylase activity and resistance to protease inactivation, said polypeptide comprising an amino acid sequence having at least 80%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO:3, said polypeptide having up to 250 amino acids.

2. The polypeptide of claim 1, wherein the polypeptide has up to 249 amino acids.

3. The polypeptide of claim 2, wherein the polypeptide has up to 248 amino acids.

4. The polypeptide of claim 3, wherein the polypeptide has up to 247 amino acids.

5. The polypeptide of claim 4, wherein the polypeptide has up to 246 amino acids.

6. The polypeptide of claim 5, wherein the polypeptide has up to 245 amino acids.

7. The polypeptide of claim 6, wherein the polypeptide has up to 244 amino acids.

8. The polypeptide of claim 7, wherein the polypeptide has up to 243 amino acids.

9. The polypeptide of claim 3, wherein the polypeptide has up to 242 amino acids.

10. The polypeptide of claim 3, wherein the polypeptide has up to 241 amino acids.

11. The polypeptide according to any one of claims 1 to 10, wherein the polypeptide comprises an amino acid sequence having at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:

12.

12. The polypeptide of claim 11, wherein the polypeptide has an amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:

12.

13. The polypeptide as claimed in any of the preceding claims, wherein the protease is a proline-specific protease.

14. The polypeptide of claim 13, wherein the protease is derived from Aspergillus niger.

15. The polypeptide of claim 13 or 14, wherein the protease has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:

17.

16. The polypeptide of claim 15, wherein the protease has the amino acid sequence according to SEQ ID NO:

17.

17. An improved brewing process comprising fermenting wort in the presence of a polypeptide having acetolactate decarboxylase activity and being resistant to protease inactivation, and a proline-specific protease, wherein both enzymes are present in the wort.

18. The improved brewing process of claim 17, wherein the amino acid sequence of the polypeptide having acetolactate decarboxylase activity has at least 80%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has up to 250 amino acids.

19. The improved brewing process of claim 18, wherein the polypeptide has up to 249 amino acids.

20. The improved brewing process of claim 19, wherein the polypeptide has up to 248 amino acids.

21. The improved brewing process of claim 20, wherein the polypeptide has up to 247 amino acids.

22. The improved brewing process of claim 21, wherein the polypeptide has up to 246 amino acids.

23. The improved brewing process of claim 22, wherein the polypeptide has up to 245 amino acids.

24. The improved brewing process of claim 23, wherein the polypeptide has up to 244 amino acids.

25. The improved brewing process of claim 24, wherein the polypeptide has up to 243 amino acids.

26. The improved brewing process of claim 25, wherein the polypeptide has up to 242 amino acids.

27. The improved brewing process of claim 26, wherein the polypeptide has up to 241 amino acids.

28. The improved brewing process according to any one of claims 17 to 27, wherein the polypeptide has an amino acid sequence having at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:

12.

29. The improved brewing process of claim 28, wherein the polypeptide has an amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:

12.

30. The improved brewing process according to any one of claims 17 to 29, wherein the polypeptide having acetolactate decarboxylase activity is first added to the wort.

31. The improved brewing process according to any one of claims 17 to 29, wherein the proline-specific protease is first added to the wort.

32. The improved brewing process according to any one of claims 17 to 29, wherein the polypeptide having acetolactate decarboxylase activity and the proline-specific protease are simultaneously added to the wort.

33. The improved brewing process according to any one of claims 17 to 32, wherein the proline-specific protease is derived from Aspergillus niger.

34. The improved brewing process according to any one of claims 17 to 33, wherein the proline-specific protease has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:

17.

35. A Bacillus host cell for producing heterologous target polypeptides, wherein one or more protease genes have been inactivated.

36. The host cell of claim 35, wherein the target polypeptide is expressed without a secretory signal peptide.

37. The host cell of claim 35, wherein the target polypeptide is expressed with a secretion signal.

38. The host cell of any one of claims 35 to 37, wherein the target polypeptide is an enzyme.

39. The host cell of claim 38, wherein the enzyme is an oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, aminopeptidase, amylase, asparaginase, glycosylase, carboxypeptidase, catalase, cellulase, chitinase, keratinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, α-galactosidase, β-galactosidase, glucosylamylase, α-glucosidase, β-glucosidase, hyaluronic acid synthase, invertase, laccase, lipase, mannosidase, polysaccharidase, oxidase, pectinase, peroxidase, phytase, polyphenol oxidase, protease, ribonuclease, transglutaminase, or xylanase.

40. The host cell of claim 39, wherein the enzyme is an ALDC enzyme.

41. The host cell of claim 40, wherein the ALDC enzyme comprises a polypeptide having an amino acid sequence having at least 80%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has up to 250 amino acids.

42. The host cell of claim 41, wherein the polypeptide has up to 249 amino acids.

43. The host cell of claim 42, wherein the polypeptide has up to 248 amino acids.

44. The host cell of claim 43, wherein the polypeptide has up to 247 amino acids.

45. The host cell of claim 44, wherein the polypeptide has up to 246 amino acids.

46. ​​The host cell of claim 45, wherein the polypeptide has up to 245 amino acids.

47. The host cell of claim 46, wherein the polypeptide has up to 244 amino acids.

48. The host cell of claim 47, wherein the polypeptide has up to 243 amino acids.

49. The host cell of claim 48, wherein the polypeptide has up to 242 amino acids.

50. The host cell of claim 49, wherein the polypeptide has up to 241 amino acids.

51. The host cell of any one of claims 41 to 50, wherein the polypeptide has an amino acid sequence having at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:

12.

52. The host cell of claim 51, wherein the polypeptide has an amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:

12.

53. The host cell of any one of claims 40 to 52, wherein the ALDC enzyme is expressed with a secretion signal.

54. The host cell of any one of claims 35 to 53, wherein the heterologous target polypeptide is encoded by an exogenous polynucleotide, the exogenous polynucleotide being integrated into the chromosome of the host cell in the form of at least one copy.

55. The host cell of claim 54, wherein the exogenous polynucleotide comprises a nucleic acid sequence having 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:

28.

56. The host cell of claim 55, wherein the exogenous polynucleotide comprises a nucleic acid sequence containing SEQ ID NO:

28.

57. The host cell of any one of claims 35 to 56, wherein the one or more protease genes are inactivated by nonsense mutations within the gene, partial deletion of the gene, or complete deletion of the gene.

58. The host cell of any one of claims 35 to 57, wherein the Bacillus host is Bacillus subtilis or Bacillus licheniformis.

59. The host cell of claim 58, wherein the Bacillus host is Bacillus subtilis.

60. The host cell of any one of claims 35 to 59, wherein the one or more protease genes are selected from the group consisting of nucleic acid sequences having at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:

27.

61. The host cell of claim 60, wherein the one or more protease genes comprise nine inactivated proteases, wherein the proteases have nucleic acid sequences having at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:

27.

62. The host cell of claim 61, wherein the one or more protease genes have nucleic acid sequences according to SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:

27.

63. A method for producing a desired polypeptide, the method comprising: i) Providing a Bacillus host cell in which one or more protease genes have been inactivated, and wherein the host cell is transformed with a nucleic acid encoding a heterologous polypeptide, the nucleic acid being operatively linked to a promoter; as well as ii) The host cells are cultured under conditions suitable for the production of the heterologous polypeptide, thereby producing the heterologous polypeptide.

64. The method of claim 63, further comprising recovering the generated polypeptide.

65. The method of claim 63 or 64, wherein the target polypeptide is expressed with or without a secretion signal peptide.

66. The method of claim 63 or 64, wherein the target polypeptide is expressed with a secretion signal peptide.

67. The method of any one of claims 63 to 66, wherein the target polypeptide is an enzyme.

68. The method of claim 67, wherein the enzyme is an oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, aminopeptidase, amylase, asparaginase, glycosylase, carboxypeptidase, catalase, cellulase, chitinase, keratinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, α-galactosidase, β-galactosidase, glucosylamylase, α-glucosidase, β-glucosidase, hyaluronic acid synthase, invertase, laccase, lipase, mannosidase, polysaccharidase, oxidase, pectinase, peroxidase, phytase, polyphenol oxidase, protease, ribonuclease, transglutaminase, or xylanase.

69. The method of claim 68, wherein the enzyme is an ALDC enzyme.

70. The method of claim 69, wherein the ALDC enzyme comprises a polypeptide having an amino acid sequence having at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has at most 250 amino acids.

71. The method of claim 70, wherein the polypeptide has up to 249 amino acids.

72. The method of claim 71, wherein the polypeptide has up to 248 amino acids.

73. The method of claim 72, wherein the polypeptide has up to 247 amino acids.

74. The method of claim 73, wherein the polypeptide has up to 246 amino acids.

75. The method of claim 74, wherein the polypeptide has up to 245 amino acids.

76. The method of claim 75, wherein the polypeptide has up to 244 amino acids.

77. The method of claim 76, wherein the polypeptide has up to 243 amino acids.

78. The method of claim 77, wherein the polypeptide has up to 242 amino acids.

79. The method of claim 78, wherein the polypeptide has at most 241 amino acids.

80. The method of any one of claims 69 to 79, wherein the polypeptide has an amino acid sequence having at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:

12.

81. The method of claim 80, wherein the polypeptide has an amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:

12.

82. The method of any one of claims 69 to 81, wherein the ALDC enzyme is secretory.

83. The method of any one of claims 63 to 82, wherein the heterologous target polypeptide is encoded by an exogenous polynucleotide, the exogenous polynucleotide being integrated into the chromosome of the host cell in the form of at least one copy.

84. The method of claim 83, wherein the exogenous polynucleotide comprises a nucleic acid sequence having 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:

28.

85. The method of claim 84, wherein the exogenous polynucleotide comprises a nucleic acid sequence containing SEQ ID NO:

28.

86. The method of any one of claims 63 to 85, wherein the at least one protease gene is inactivated by: nonsense mutation within the at least one gene, partial deletion of the at least one gene, or complete deletion of the at least one gene.

87. The method of any one of claims 63 to 86, wherein the Bacillus host is Bacillus subtilis or Bacillus licheniformis.

88. The method of claim 87, wherein the Bacillus host is Bacillus subtilis.

89. The method of any one of claims 63 to 88, wherein the one or more protease genes are selected from the group consisting of nucleic acid sequences having at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:

27.

90. The method of claim 89, wherein the one or more protease genes comprise nine inactivated protease genes, the protease genes having nucleic acid sequences having at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:

27.

91. The method of claim 90, wherein the one or more protease genes have nucleic acid sequences according to SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:

27.

92. A stable liquid formulation comprising a polypeptide and a protease having acetolactate decarboxylase activity, the polypeptide comprising an amino acid sequence having at least 80%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has up to 250 amino acids.

93. The stable liquid formulation of claim 92, wherein the ALDC polypeptide has up to 249 amino acids.

94. The stable liquid formulation of claim 93, wherein the ALDC polypeptide has up to 248 amino acids.

95. The stable liquid formulation of claim 94, wherein the ALDC polypeptide has up to 247 amino acids.

96. The stable liquid formulation of claim 95, wherein the ALDC polypeptide has up to 246 amino acids.

97. The stable liquid formulation of claim 96, wherein the ALDC polypeptide has up to 245 amino acids.

98. The stable liquid formulation of claim 97, wherein the ALDC polypeptide has up to 244 amino acids.

99. The stable liquid formulation of claim 98, wherein the ALDC polypeptide has up to 243 amino acids.

100. The stable liquid formulation of claim 99, wherein the ALDC polypeptide has up to 242 amino acids.

101. The stable liquid formulation of claim 100, wherein the ALDC polypeptide has up to 241 amino acids.

102. The stable liquid formulation according to any one of claims 92 to 101, wherein the ALDC polypeptide comprises an amino acid sequence having at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:

12.

103. The stable liquid formulation of claim 102, wherein the ALDC polypeptide comprises an amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:

12.

104. The stable liquid formulation according to any one of claims 92 to 103, wherein the protease is a proline-specific protease.

105. The stable liquid formulation of claim 104, wherein the protease is derived from Aspergillus niger.

106. The stable liquid formulation of claim 104 or 105, wherein the protease has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:

17.

107. The stable liquid formulation of claim 106, wherein the protease has the amino acid sequence according to SEQ ID NO:

17.

108. The stable liquid formulation according to any one of claims 92 to 107, wherein the ALDC polypeptide retains at least 99%, 98%, 95%, 90%, 85%, 80%, 75%, or 70% of its activity when the stable liquid formulation is stored at 10°C for 30, 60, 90, 120, 150, or 180 days.

109. The stable liquid formulation according to any one of claims 92 to 107, wherein when the stable liquid formulation is stored at 30°C for 8 hours, 16 hours, 24 hours, 32 hours, 40 hours or 48 hours, the ALDC polypeptide retains at least 99%, 98%, 95%, 90%, 85%, 80%, 75% or 70% of its activity.

110. A proline-specific protease formulation, said formulation being substantially free of other protease activities when containing said protease, wherein when said protease is combined with a polypeptide having acetolactate decarboxylase activity, said polypeptide is stable over time.

111. The protease formulation of claim 110, wherein the polypeptide having acetolactate decarboxylase activity comprises an amino acid sequence having at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:3, wherein the polypeptide has at most 250 amino acids.

112. The protease formulation of claim 111, wherein the ALDC polypeptide has up to 249 amino acids.

113. The protease formulation of claim 112, wherein the ALDC polypeptide has up to 248 amino acids.

114. The protease formulation of claim 113, wherein the ALDC polypeptide has up to 247 amino acids.

115. The protease formulation of claim 114, wherein the ALDC polypeptide has up to 246 amino acids.

116. The protease formulation of claim 115, wherein the ALDC polypeptide has up to 245 amino acids.

117. The protease formulation of claim 116, wherein the ALDC polypeptide has up to 244 amino acids.

118. The protease formulation of claim 117, wherein the ALDC polypeptide has up to 243 amino acids.

119. The protease formulation of claim 118, wherein the ALDC polypeptide has up to 242 amino acids.

120. The protease formulation of claim 119, wherein the ALDC polypeptide has up to 241 amino acids.

121. The protease formulation according to any one of claims 110 to 120, wherein the ALDC polypeptide comprises an amino acid sequence having at least 80%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:

12.

122. The protease formulation of claim 121, wherein the ALDC polypeptide comprises an amino acid sequence according to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:

12.

123. The protease formulation according to any one of claims 110 to 122, wherein the protease is a proline-specific protease.

124. The protease formulation of claim 123, wherein the protease is derived from Aspergillus niger.

125. The protease formulation of claim 123 or 124, wherein the protease has at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:

17.

126. The protease formulation of claim 125, wherein the protease has the amino acid sequence according to SEQ ID NO:

17.

127. The protease formulation according to any one of claims 110 to 126, wherein the protease formulation is solid.

128. The protease formulation according to any one of claims 110 to 126, wherein the protease formulation is a liquid.

129. The protease formulation of claim 128, wherein the ALDC polypeptide retains at least 99%, 98%, 95%, 90%, 85%, 80%, 75%, or 70% of its activity when the formulation is stored at 10°C for 30, 60, 90, 120, 150, or 180 days.

130. The protease formulation of claim 128, wherein the ALDC polypeptide retains at least 99%, 98%, 95%, 90%, 85%, 80%, 75%, or 70% of its activity when the formulation is stored at 30°C for 8, 16, 24, 32, 40, or 48 hours.

Images