Rapid and efficient propagation method of a flower cattle apple rootstock
By combining disinfection, light quality regulation, and gradient hardening in tissue culture, the problems of high virus carrying rate, low propagation efficiency, and poor rootstock-scion compatibility in the propagation of Huaniu apple rootstock have been solved, achieving efficient, economical, and environmentally friendly rootstock propagation and improving orchard yield and production efficiency.
Patent Information
- Application Number
- CN202511677028.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-17
- Publication Date
- 2026-06-05
AI Technical Summary
The propagation of Huaniu apple rootstocks suffers from problems such as high virus carrying rate, low propagation efficiency, and poor compatibility between rootstock and scion, leading to reduced orchard yield and long propagation cycle.
Explants were sterilized using a combination of 0.05% nano-silver solution and 40kHz ultrasound. Propagation culture was conducted under blue light:red light ratio of 4:6 and a diurnal temperature range of 8℃. Rooting medium containing 1.0 mg/L IBA and 0.3 mg/L PP333 was used for gradient hardening. Well-rotted apple branch fragments and perlite were used as the transplanting substrate to establish a dedicated propagation system.
It achieved a virus eradication rate of 98.3%, shortened the propagation cycle to 45 days, increased the grafting survival rate to 89.7%, reduced costs by 59%, increased annual production capacity by 15 times, and increased orchard yield by 20%, realizing efficient, economical and environmentally friendly rootstock propagation.
Abstract
Description
Technical Field
[0001] This invention relates to the field of fruit tree cultivation technology, specifically a tissue culture method for rapid propagation of *Prunus armeniaca* rootstock. By optimizing explant selection, hormone ratio, and hardening-off system, the method enables the industrialized production of virus-free rootstock seedlings. Background Technology
[0002] Huaniu apple is a unique and high-quality variety in China. Its rootstock propagation faces three major challenges: First, poor varietal compatibility; grafting onto common rootstocks often results in poor graft union healing (<70%). Second, low propagation efficiency; traditional cuttings achieve a rooting rate of only 35-40%, with a cycle of ≥180 days. Third, high viral prevalence; Huaniu apple rootstocks are susceptible to stem groove viruses, leading to yield reductions of over 30% in orchards. While existing technologies disclose tissue culture methods for apple rootstocks, they do not address varietal-specific parameters for Huaniu apple rootstocks, such as hormone tolerance thresholds and photoperiod requirements. Summary of the Invention
[0003] This invention provides a rapid and efficient propagation method for Huaniu apple rootstock, which solves three major technical problems in Huaniu apple rootstock propagation: high virus carrying rate (virus positivity rate of mother plant > 45%), resulting in a yield reduction of more than 30% in grafted orchards; low propagation efficiency (rooting rate of traditional cuttings < 40%, cycle ≥ 180 days); and poor compatibility between rootstock and scion (grafting survival rate < 75%).
[0004] To address the above problems, this invention provides the following technical solution:
[0005] A rapid and efficient propagation method for *Prunus armeniaca* rootstock includes the following steps: (1) Explant preparation: Take the stem tip of *Prunus armeniaca* seedlings, disinfect it with a combination of 0.05% nano-silver solution and 40kHz ultrasound, and then inoculate it longitudinally into an induction medium; (2) Proliferation culture: Transfer the induced clustered shoots to MS medium containing 0.5 mg / L mutant zeatin (mT) and 0.5 g / L activated carbon, and culture them under the conditions of blue light:red light = 4:6 and a day-night temperature difference of 8℃ (26℃ during the day / 18℃ at night);
[0006] (3) Rooting culture: Cut healthy stem segments and inoculate them into 1 / 2QL rooting medium containing 1.0 mg / L IBA and 0.3 mg / L PP333; (4) Gradual hardening: Harden the seedlings in stages according to the closed bottle period (100% humidity), the transition period (85% humidity), and the adaptation period (65% humidity) before transplanting.
[0007] Further, the explants mentioned in step (1) are the shoot tips of the 3rd to 5th nodes below the top of the seedling of *Prunus armeniaca*, with a length of 1.5 ± 0.2 cm and one axillary bud; the induction medium is QL + 1.0 mg / L TDZ + 35 g / L sorbitol (pH 5.8).
[0008] Furthermore, in step (2), the light intensity was 2500±200Lx, the light cycle was 14h / d, the culture time was 21 days, and the proliferation coefficient reached 5.8±0.4 times.
[0009] Furthermore, the rooting medium described in step (3) is 1 / 2QL + 1.0mg / L IBA + 0.3mg / L PP333 + 20g / L sucrose (pH 5.8), and the culture conditions are 25℃ during the day and 22℃ at night, with a light intensity of 1500±100Lx, and a rooting rate of ≥94.2%.
[0010] Furthermore, in step (4), the hardening-off stage lasts for 10 days, the transplanting substrate is decomposed apple branch debris: perlite = 3:1, and the transplanting survival rate is ≥91.5%.
[0011] Furthermore, the decomposed apple branch debris has a particle size of 2–5 mm and is subjected to high-pressure sterilization.
[0012] Furthermore, the obtained tissue culture seedlings were tested by RT-PCR using the following primers:
[0013] SGV virus: Forward GATCCGTTGGAAGTGGTTCG, Reverse TTGCAAGCTCCAACACCAAT (Amplified fragment 312bp).
[0014] ACLSV virus: Forward CGGTGGTTCTGGTGTGTTTC, Reverse GGTCCAAACCCAAACCAACT (amplified fragment 278bp).
[0015] Virus eradication rate ≥98.3%.
[0016] The present invention has the following beneficial effects:
[0017] index This invention Traditional methods Technical Principles Virus elimination rate ≥98.3% Not detoxified Seedling stem tip peeling + heat treatment proliferation efficiency 5.8 times 2.5–3.0 times Blue light promotes cell division, while temperature difference inhibits browning. Root system lodging resistance Diameter ↑40% Easily broken PP333 enhances cellulose deposition Transplant survival rate 91.5% 55.0% Humidity gradient adaptation + exclusive substrate water retention
[0018] Variety compatibility: For the first time in the world, a dedicated propagation system for the Huaniu apple rootstock was established, increasing the grafting survival rate to 89.7% (compared to 72.3% in the control group).
[0019] Feasibility of industrialization: The propagation cycle is shortened to 45 days (traditional 180 days), and the cost per plant is 0.38 yuan (a reduction of 59%); the annual production capacity reaches 432,000 plants / 200㎡ workshop, meeting the needs of large-scale planting;
[0020] Eco-friendly: Using discarded branches from orchards as transplanting substrate, the solid waste utilization rate is >90%; nano-silver replaces highly toxic HgCl2, achieving zero emissions of heavy metals.
[0021] On the planting side: Virus-free rootstocks extend the orchard's peak fruiting period to 15 years (while virus-infected seedlings only last 8-10 years), increasing yield per acre by 20%;
[0022] Industry side: Providing virus testing standards (SGV / ACLSV primer sequences) to promote quality upgrades in the industry;
[0023] Economic benefits: Based on an annual production of 500,000 plants, the annual profit is 1.21 million yuan. Detailed Implementation
[0024] The technical solution of the rapid and efficient propagation method for *Acer buergerianum* rootstock of the present invention will be clearly and completely described below with reference to the embodiments.
[0025] Example 1: Explant disinfection and primary induction
[0026] 1.1 Materials and Equipment
[0027] Plant material: Flowering apple seedlings (90±5 days old), taken from a standardized nursery in Tianshui City, Gansu Province;
[0028] Disinfectant: Nano silver solution (particle size 15nm, concentration 0.05%);
[0029] Ultrasonic cleaner (frequency 40kHz, power 200W).
[0030] Culture medium: QL + 1.0 mg / L TDZ + 35 g / L sorbitol + 6.2 g / L agar (pH 5.8).
[0031] 1.2 Operating Procedures
[0032] Cut the stem tip (1.5±0.2cm in length, with 1 axillary bud) from the 3rd to 5th node below the top of the seedling.
[0033] Rinse with running water for 40 minutes, then operate inside the clean bench:
[0034] Step 1: Soak in 75% ethanol for 45 seconds, then rinse 3 times with sterile water;
[0035] Step 2: 0.05% Nano-Ag + 40kHz ultrasonic vibration for 8 minutes, then rinse 5 times with sterile water;
[0036] Step 3: Use sterile filter paper to absorb surface moisture;
[0037] Step 4: Cut the stem tip longitudinally into two equal parts (to increase the exposed surface of the callus) and inoculate it into the induction medium: QL + 1.0 mg / LTDZ + 35 g / L sorbitol + 6.2 g / L agar (pH 5.8);
[0038] Culture conditions: temperature 24±0.5℃, light 12h / d (light intensity 800±100Lx).
[0039] 1.3 Results Statistics (n=200 shoot tips)
[0040] Processing group Pollution rate Survival rate Budding Time 28-day cluster bud height Nano-Ag+ ultrasound 2.5% 96.3% Day 5 4.2±0.5cm <![CDATA[Traditional disinfection (0.1% HgCl2)]]> 18.7% 76.4% Day 9 2.1±0.4cm Sterile water control 100% 0% – –
[0041] Conclusion: Nano-Ag-ultrasound combined disinfection significantly reduced the contamination rate and promoted early germination.
[0042] Example 2: Light-controlled proliferation culture
[0043] 2.1 Experimental Design
[0044] Materials: Induced clustered shoots from Example 1 (height 3.0 ± 0.3 cm);
[0045] Culture medium: MS + 0.5 mg / L mT (mutant zeatin) + 0.5 g / L activated carbon;
[0046] The light intensity was 2500±200 Lx, the photoperiod was 14 h / d, and the culture time was 21 days.
[0047] Light quality treatment group (50 bottles per group, 8 stem segments per bottle);
[0048] Group Blue light: Red light Photoperiod Temperature (day / night) experimental group 4:6 14h / d 26℃ / 18℃ Comparison 1 0:10 (Pure Red Light) 14h / d 26℃ / 18℃ Comparison 2 10:0 (pure blue light) 14h / d 26℃ / 18℃ Comparison 3 White light 14h / d 26℃ / 18℃
[0049] 2.2 Monitoring of the cultivation process
[0050] Measure stem height, number of buds, and chlorophyll content (SPAD value) every 7 days.
[0051] On day 21, the proliferation coefficient (= number of terminal buds / number of initial buds) was calculated.
[0052] 2.3 Results (21 days of culture)
[0053] Group Proliferation coefficient Average number of buds / stem segment Browning rate Chlorophyll content (SPAD) 4:6 Blue and Red 5.8±0.4 6.3±0.8 1.2% 38.5±1.2 Pure red light 3.1±0.3 2.7±0.5 5.6% 29.8±1.5 Pure blue light 4.2±0.5 3.9±0.6 22.3% 35.1±1.0 White light 3.6±0.4 3.2±0.4 8.9% 32.4±1.3
[0054] Conclusion: The blue light:red light ratio of 4:6 achieved the highest proliferation efficiency and significantly improved chlorophyll synthesis.
[0055] Example 3: Lodging-resistant rooting and graded hardening-off
[0056] 3.1. Materials and Methods
[0057] Materials: Healthy stem segments in the propagation stage (height 4.0±0.5cm);
[0058] Rooting medium: 1 / 2 QL + 1.0 mg / L IBA + 0.3 mg / L PP333 + 20 g / L sucrose + 5.2 g / L agar (pH 5.8);
[0059] Seedling hardening system: intelligent greenhouse (temperature control accuracy ±0.5℃, humidity accuracy ±3%).
[0060] Transplanting substrate: well-rotted apple branch debris (2–5 mm in diameter): perlite = 3:1 (autoclaved).
[0061] 3.2 Rooting Culture Process
[0062] Make a slanted cut (45° angle) at the base of the stem segment and insert it 1.0 cm deep into the rooting medium;
[0063] Cultivation conditions:
[0064] Temperature 25±0.5℃ (day) / 22±0.5℃ (night);
[0065] Irradiation 1500±100 Lx (white light), 12 h / d;
[0066] Rooting was measured starting on day 10.
[0067] 3.3 Gradual hardening-off procedure
[0068] stage Duration humidity Container state Light intensity Closing bottle period 1–3 days 100% Tissue culture bottles are sealed 800Lx transition period 4–6 days 85% The bottle cap has a 0.5cm opening. 2500Lx adaptation period 7–10 days 65% Fully open the lid Natural light
[0069] 3.4 Data Comparison (n=150 plants)
[0070] index PP333 treatment group (0.3 mg / L) PP333-free control group Rooting rate (day 15) 94.2% 86.7% Average number of roots 8.5±1.2 5.3±0.9 Root thickness 0.52±0.08mm 0.37±0.05mm Transplant survival rate (30 days) 91.5% 73.6% Grafting survival rate (60 days) 89.7% 70.2%
[0071] Note: The grafted variety is the Huaniu apple scion. T-budding is performed when the stem diameter at the base of the rootstock is ≥3.5mm.
[0072] Example 4: Virus Removal Verification
[0073] 4.1 Detection Method
[0074] Subject: Seedlings that have survived hardening (Example 3 group);
[0075] Target viruses: Apple stem groove virus (SGV), Apple chlorotic leaf spot virus (ACLSV);
[0076] Technique: RT-PCR (primer sequences are shown in the table below) + ELISA double verification.
[0077] Virus Forward primer (5'-3') Reverse primer (5'-3') Amplified fragments SGV GATCCGTTGGAAGTGGTTCG TTGCAAGCTCCAACACCAAT 312bp ACLSV CGGTGGTTCTGGTGTGTTTC GGTCCAAACCCAAACCAACT 278bp
[0078] 4.2 Results
[0079] Sample source SGV positivity rate ACLSV positivity rate Overall detoxification rate Tissue culture seedlings 0% (0 / 50) 1.7% (1 / 60) 98.3% Seedlings from mother plants 36.7% 28.3% –
[0080] After three generations of subculture, the tissue culture seedlings tested negative for the virus.
[0081] Note: This method was implemented in a 200㎡ tissue culture workshop (5-layer culture rack, covering an area of 40㎡).
[0082] Compared with existing technologies, the core technological advantages of a rapid and efficient propagation method for *Gnaphalium affine* rootstock are systematically analyzed using tables and text.
[0083] I. Efficiency Breakthrough
[0084] index This invention Traditional methods Increase Reproductive cycle 45 days 180–240 days shorten by 75% Proliferation coefficient 5.8 times 2.5–3.0 times Increase by 130% Rooting rate 94.2% 35–40% Increased by 169% Transplant survival rate 91.5% 50–55% Increased by 83%
[0085] Industrialized production capacity: 12,000 plants per square meter of cultivation rack per year (compared to 800 plants / square meter / year for traditional cutting nurseries), representing a 15-fold increase.
[0086] II. Variety Adaptability Innovation
[0087] Virus elimination from the source: the first method to use the stem tip of Huaniu apple seedlings as explants (virus carrying rate <5% → traditional grafted seedling explants >45%); the virus elimination rate is 98.3% (verified by RT-PCR / ELISA), eradicating the SGV virus that Huaniu apples are susceptible to (causing a yield reduction of 30%+).
[0088] Precise regulation revealed that the chlorophyll synthesis of Huaniu apple rootstock was highest under a blue light:red light ratio of 4:6 (SPAD 38.5 vs. control 32.4); a diurnal temperature range of 8℃ (26℃ / 18℃) activated stress-resistance genes, reducing the browning rate to 1.2% (control > 20%).
[0089] III. Culture medium formulation
[0090] stage core ingredients Functional Mechanism Induction 35g / L sorbitol + 1.0mg / L TDZ Promotes axillary bud germination, with a germination rate of 96.3%. proliferation 0.5 mg / L mT + 0.5 g / L activated carbon Mutant cytokinin → 87% increase in bud differentiation root 1.0 mg / L IBA + 0.3 mg / L PP333 Increased root thickness (diameter increased by 40%), improved resistance to transplant stress
[0091] Gradual hardening-off system: Humidity decreases stepwise from 100% to 65% (transplant survival rate 91.5% vs. conventional hardening-off 73.6%); Special substrate formula: decomposed apple branch fragments: perlite = 3:1 → root entanglement increases by 50% (accelerating nutrient absorption).
[0092] IV. Economic Benefits
[0093] Cost items This invention Traditional methods Savings / Gain Production cost per plant 0.38 yuan 0.92 yuan 59% reduction Grafted-ready seedlings price 2.8 yuan / plant 1.5 yuan / plant 87% premium Yield increase per acre (after grafting) +20% benchmark + Increased income per mu by approximately 5,000 yuan
[0094] Based on an annual production of 500,000 plants: annual cost of 190,000 yuan vs. traditional 460,000 yuan, saving 270,000 yuan; annual profit (2.8-0.38)×500,000 = 1,210,000 yuan.
[0095] V. Addressing pain points at the planting end: rootstock-scion compatibility: grafting survival rate 89.7% (control 72.3%); orchard life cycle: virus-free seedlings extend the peak fruiting period to 15 years (virus-infected seedlings only 8-10 years); promoting standardized production: parameters are controllable throughout the entire process from tissue culture bottles to grafted seedlings (temperature ±0.5℃, humidity ±3%).
[0096] VI. Green disinfection process, using 0.05% Nano-Ag, reduces heavy metal pollution to 0, reducing environmental safety risks; and resource recycling, the apple branch debris in the substrate comes from orchard pruning waste, with a utilization rate of >90%, reducing solid waste treatment costs.
Claims
1. A rapid and efficient propagation method for *Prunus armeniaca* rootstock, characterized in that, Includes the following steps: (1) Explant preparation: The stem tips of *Prunus armeniaca* seedlings were disinfected by a combination of 0.05% nano-silver solution and 40kHz ultrasound, and then longitudinally inoculated into the induction medium; (2) Proliferation culture: The induced shoot clusters were transferred to MS medium containing 0.5 mg / L mutant zeatin (mT) and 0.5 g / L activated carbon, and cultured under the conditions of blue light:red light = 4:6 and a day-night temperature difference of 8℃ (26℃ during the day / 18℃ at night); (3) Rooting culture: Cut healthy stem segments and inoculate them into 1 / 2QL rooting medium containing 1.0 mg / L IBA and 0.3 mg / L PP333; (4) Gradual hardening: Harden the seedlings in stages according to the closed bottle period (100% humidity), the transition period (85% humidity), and the adaptation period (65% humidity) before transplanting.
2. The rapid and efficient propagation method for *Prunus armeniaca* rootstock according to claim 1, characterized in that, The explants mentioned in step (1) are the shoot tips of the 3rd to 5th nodes below the top of the seedling of *Prunus armeniaca*, with a length of 1.5 ± 0.2 cm and one axillary bud; the induction medium is QL + 1.0 mg / L TDZ + 35 g / L sorbitol + 6.2 g / L agar (pH 5.8).
3. The rapid and efficient propagation method for *Prunus armeniaca* rootstock according to claim 1, characterized in that, In step (2), the light intensity was 2500±200Lx, the light cycle was 14h / d, the culture time was 21 days, and the proliferation coefficient reached 5.8±0.4 times.
4. The rapid and efficient propagation method for *Prunus armeniaca* rootstock according to claim 1, characterized in that, The rooting medium described in step (3) is 1 / 2 QL + 1.0 mg / L IBA + 0.3 mg / L PP333 + 20 g / L sucrose + 5.2 g / L agar (pH 5.8), and the culture conditions are 25℃ during the day and 22℃ at night, with a light intensity of 1500±100 Lx, and the rooting rate is ≥94.2%.
5. The rapid and efficient propagation method for *Prunus armeniaca* rootstock according to claim 1, characterized in that: In step (4), the hardening-off stage lasts for 10 days. The transplanting substrate is decomposed apple branch fragments: perlite = 3:1, and the transplanting survival rate is ≥91.5%.
6. The rapid and efficient propagation method for *Prunus armeniaca* rootstock according to claim 5, characterized in that: The decomposed apple branch fragments have a particle size of 2–5 mm and are subjected to high-pressure sterilization.
7. A rapid and efficient propagation method for *Prunus armeniaca* rootstock according to any one of claims 1-6, characterized in that: The obtained tissue culture seedlings were tested by RT-PCR using the following primers: SGV virus: Forward GATCCGTTGGAAGTGGTTCG, Reverse TTGCAAGCTCCAACACCAAT (Amplified fragment 312bp). ACLSV virus: Forward CGGTGGTTCTGGTGTGTTTC, Reverse GGTCCAAACCCAAACCAACT (amplified fragment 278bp); Virus removal rate ≥98.3%.