Anti-pd1 mRNA nano-preparation, preparation method and application thereof

By using anti-PD1 mRNA nanoparticles to generate antibodies, the complexities of traditional antibody preparation have been solved. This enables rapid and accurate blocking of PD1 receptors in solid tumors such as pancreatic cancer, increasing drug concentration, enhancing therapeutic effects, and significantly inhibiting cytotoxic CD8 T cell depletion.

CN122140649APending Publication Date: 2026-06-05HUANXIN BIOTECHNOLOGY (TAIZHOU) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411781897.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-05
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing immune checkpoint therapies have poor response rates to immune microenvironment-suppressive solid tumors such as pancreatic cancer, mainly due to poor infiltration and excessive depletion of cytotoxic T lymphocytes. Traditional antibody preparation processes are complex and difficult to effectively block PD1 receptors.

Method used

By employing anti-PD1 mRNA nanoformulations, anti-PD1 antibodies are generated autologously, and mRNA is delivered using nanodelivery carriers such as cationic lipid complexes, lipid nanoparticles, or lipid-polymer hybrid nanoparticles, thereby achieving rapid and accurate increases in drug concentration and blocking of PD1 receptors on T cells.

Benefits of technology

It enables rapid and accurate increase of drug concentration in vivo, enhances therapeutic responsiveness, reduces the complexity of traditional preparation processes, improves the stability and safety of nano-formulations, and significantly inhibits the depletion of cytotoxic CD8 T cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122140649A_ABST
    Figure CN122140649A_ABST
Patent Text Reader

Abstract

The application discloses an anti-PD1 mRNA nano preparation and a preparation method and application thereof. The anti-PD1 mRNA nano preparation comprises anti-PD1 mRNA and a nano delivery carrier, wherein the anti-PD1 mRNA is loaded in the nano delivery carrier. The anti-PD1 mRNA nano preparation can self-generate an anti-PD1 antibody, produce a protein with higher activity, effectively block a PD1 receptor on a T cell, inhibit exhaustion of a cytotoxic CD8 T cell, quickly and accurately increase a drug concentration of a drug exerting site of the antibody, and has high safety and stability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to an anti-PD1 mRNA nanoparticle formulation, its preparation method, and its application. Background Technology

[0002] Malignant tumors (cancer) are the second leading cause of death worldwide and one of the major public health problems threatening human health. According to the latest global cancer burden data released by the International Agency for Research on Cancer (IARC) in 2022, there were 20 million new cancer cases and 9.7 million cancer deaths globally in 2022. The cancers with the highest number of new cases, from highest to lowest, are lung cancer, breast cancer in women, colorectal cancer, prostate cancer, stomach cancer, and liver cancer. The cancers with the highest number of deaths, from highest to lowest, are lung cancer, colorectal cancer, liver cancer, breast cancer, stomach cancer, and pancreatic cancer. Currently, the main treatments for solid tumors include surgery, radiotherapy, chemotherapy, and immunotherapy. Among these, immunotherapy, primarily based on immune checkpoint inhibitors, has become an important means of treating solid tumors.

[0003] Immune checkpoint therapy, which enhances the anti-cancer immune response by modulating immune checkpoint signaling pathways in T cells, has achieved significant clinical progress and provided a new weapon in the fight against cancer. Although some adverse reactions have been observed with immune checkpoint therapy, patients have achieved durable clinical benefits, with some achieving long-term remission and remaining symptom-free for many years. Currently developed immune checkpoint therapy strategies include inhibiting cytotoxic T-lymphocyte-associated protein 4 (CTLA4), blocking the CD47 signaling pathway, and blocking the programmed death-1 / programmed death-ligand 1 (PD1 / PDL1) pathway. Among these, the PD1 / PDL1 pathway has demonstrated a landmark strategy, through which cancer cells can be eliminated in approximately 30% of patients with various cancers, such as melanoma, renal cell carcinoma, non-small cell lung cancer, and bladder cancer.

[0004] PD1 is an inhibitory receptor expressed on T cells. Blocking the interaction between PD1 and its ligand PDL1 with antibodies can restore the tumor-killing effect of T cells. However, for solid tumors like pancreatic cancer, which suffer from an immunosuppressive microenvironment, more than half of cancer patients do not respond to ICIs treatment due to poor infiltration and excessive depletion of cytotoxic T lymphocytes.

[0005] Therefore, there is an urgent need to provide a precise and efficient nano-formulation delivery system to improve the invasion of PD1 into tumor sites and enhance the responsiveness of PD1 therapy. Summary of the Invention

[0006] To address the shortcomings of existing technologies and practical needs, this invention provides an anti-PD1 mRNA nanoparticle formulation, its preparation method, and its application. This formulation can autogenize anti-PD1 antibodies, produce proteins with better activity, effectively block PD1 receptors on T cells, inhibit the depletion of cytotoxic CD8 T cells, and rapidly and accurately increase the drug concentration at the site of antibody efficacy. It also exhibits high safety and stability.

[0007] To achieve this objective, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides an anti-PD1 mRNA nanoformulation, the anti-PD1 mRNA nanoformulation comprising: anti-PD1 mRNA and a nanodelivery carrier, wherein the anti-PD1 mRNA is loaded in the nanodelivery carrier.

[0009] The anti-PD1 mRNA nanoformulation of the present invention can generate anti-PD1 antibodies by itself, produce proteins with better activity, effectively block PD1 receptors on T cells, inhibit the depletion of cytotoxic CD8 T cells, and can rapidly and accurately increase the drug concentration at the site of antibody efficacy, with high safety and stability.

[0010] Preferably, the anti-PD1 mRNA includes any one or a combination of at least two of the following: self-reporter gene anti-PD1 mRNA, self-amplified anti-PD11 mRNA, or circular anti-PD1 mRNA.

[0011] It is understood that the anti-PD1 mRNA in this invention can theoretically be any mRNA sequence capable of producing anti-PD11, including but not limited to self-reporter gene anti-PD1 mRNA, self-amplified anti-PD1 mRNA, and circular anti-PD1 mRNA.

[0012] Preferably, the nanodelivery carrier comprises any one or a combination of at least two of cationic lipid complexes, lipid nanoparticles, polymer nanoparticles, or lipid-polymer hybrid nanoparticles.

[0013] It is understood that the nanodelivery carrier system in this invention can theoretically be any carrier capable of delivering mRNA, including but not limited to cationic lipids, lipid nanoparticles, and polymer nanoparticles.

[0014] Preferably, the lipid-polymer hybrid nanoparticles contain cationic molecules, polymers, and biocompatible modifying molecules.

[0015] Preferably, the cationic molecule includes any one or a combination of at least two of the following: ammonia derivatives, positively charged amphiphilic lipid compounds, ammonium salts and their derivatives, or polyamides and their derivatives.

[0016] Preferably, the polymer comprises any one or a combination of at least two of polylactic acid and its copolymers, carbophospholipids and their derivatives, amino acids and their derivatives, polyols and their derivatives, or polyacrylic acid and its derivatives.

[0017] Preferably, the biocompatible modification molecule includes any one or a combination of at least two of polyethylene glycol and its derivatives, mannitol, dextran, carboxyglucan, liposomes, albumin, tetraethyl orthosilicate, or polyglutamic acid.

[0018] Preferably, the cationic molecule comprises GO-Cl4.

[0019] Preferably, the polymer comprises polylactic acid-glycolic acid copolymer.

[0020] Preferably, the biocompatibility modification molecule includes distearate phosphatidylethanolamine-methoxy polyethylene glycol.

[0021] In a second aspect, the present invention provides a method for preparing the anti-PD1 mRNA nanoparticle formulation described in the first aspect, the method comprising: encapsulating the anti-PD1 mRNA in the nanodelivery carrier.

[0022] Preferably, the preparation method includes: mixing the anti-PD1 mRNA with cationic molecules to obtain an mRNA-cationic molecule complex; mixing the mRNA-cationic molecule complex with a polymer and a biocompatible modification molecule to obtain a mixture; and mixing the mixture with an aqueous solution and then performing dialysis to obtain the anti-PD1 mRNA nanoformulation.

[0023] Preferably, the mass ratio of the anti-PD1 mRNA to the cationic molecule is 1:(10-15).

[0024] The above 1:(10-15) can be selected as 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, etc.

[0025] Preferably, the mass ratio of the mRNA-cationic molecule complex, the polymer, and the biocompatible modification molecule is 1:(10-15):(20-30):(40-60).

[0026] The above 1:(10-15):(20-30):(40-60) can be selected as 1:10:20:40, 1:15:30:40, 1:15:30:40, 1:15:20:50, 1:15:20:60, etc.

[0027] As a preferred technical solution, the preparation method of the anti-PD1 mRNA nano-formulation of the present invention includes the following steps:

[0028] (1) PCR amplification of open reading frame plasmids carrying mouse anti-PD1 sequences containing T7 promoter and T7 terminator, and purification of PCR products to form linearized DNA;

[0029] In vitro transcription involved mixing a T7 transcription kit with 1-2 μg of purified polymerase chain linearized DNA reaction product as template, 5-10 mM guanosine triphosphate, 5-10 mM 5-methylcytidine triphosphate, 5-10 mM adenosine triphosphate, and 5-10 mM pseudouridine-5'-triphosphate, and incubating at 35-37°C for 2-3 h. The mixture was then treated with deoxyribonuclease to obtain anti-PD1 mRNA. The anti-PD1 mRNA was purified by high-performance liquid chromatography (HPLC), and salts in the buffer solution were removed by centrifugation using an ultrafiltration device. After washing 3-5 times with enzyme-free water, the anti-PD1 mRNA was collected in enzyme-free water.

[0030] (2) Dissolve GO-C14, polylactic acid-glycolic acid copolymer (PLGA) and distearate phosphatidylethanolamine-methoxy polyethylene glycol (DSPE-PEG) thoroughly with N,N-dimethylformamide (DMF) to obtain the corresponding component stock solutions - GO-C14 (2-3 mg / mL), PLGA (4-6 mg / mL), DSPE-PEG (15-25 mg / mL), prepare 40-60 mM and 5-15 mM citrate buffers (pH=4.0), and perform nuclease-free treatment using DEPC;

[0031] (3) Preparation of mRNA / G0-C14 complex: Take 5-15 μL of mRNA (0.5-2 μg / μL) and add 2-3 μL of citric acid buffer (40-60 mM) to it. After mixing evenly, quickly add it to 40-60 μL of G0-C14 DMF solution under vortex and continue vortexing for 20-60 s to obtain mRNA / G0-C14 complex;

[0032] (4) Add 40-60 μL of PLGA DMF solution and 20-30 μL of DSPE-PEG DMF solution to the mRNA / G0-C14 complex in sequence, mix well to obtain solution A. Under vortexing, quickly add solution A to 600-700 μL of citrate buffer (5-15 mM), continue vortexing for 50-100 s, and under vortexing, slowly add 600-700 μL of 1×PBS dropwise to the above mixed solution. Remove the organic solvent using an EMD Millipore MWCO 100 kDa filter, repeat 3-5 times; centrifuge at 3000-5000 g for 6-10 min, and bring the volume up to 500 μL of mRNA / G0-C14 LPNPs (mRNA concentration: 15-25 ng / μL).

[0033] Thirdly, the present invention provides the application of the anti-PD1 mRNA nanoformulation described in the first aspect in the preparation of products for treating solid tumors.

[0034] Preferably, the solid tumor includes any one or a combination of at least two of pancreatic cancer, colorectal cancer, liver cancer, or melanoma.

[0035] It is understood that solid tumors in this invention include, but are not limited to, pancreatic cancer, colorectal cancer, liver cancer, and melanoma.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] (1) The anti-PD1 mRNA nano-formulation provided by the present invention can generate anti-PD1 antibodies by itself, which gets rid of the complex process of mammalian cell culture and purification in the traditional antibody industry. The anti-PD1 antibody generated by the anti-PD1 mRNA nano-formulation by itself completes the post-translational modification in somatic cells that is closer to the needs of mammals, and can produce proteins with better activity, effectively block the PD1 receptor on T cells, and inhibit the depletion of cytotoxic CD8 T cells.

[0038] (2) The anti-PD1 mRNA nanoparticle delivery system provided by the present invention can rapidly and accurately increase the drug concentration at the site where the antibody exerts its effect compared with traditional intravenous injection, thereby achieving a lower dose and higher efficacy.

[0039] (3) The anti-PD1 mRNA nanoparticle delivery system provided by the present invention reduces the introduction of polymers in the component composition and has no negative impact on the delivery performance of mRNA, making the formulation optimization of the delivery system simpler and more efficient.

[0040] (4) The anti-PD1 mRNA nanoparticle delivery system provided by the present invention introduces a polymer with a larger molecular weight and lower fluidity. In addition, the removal of other auxiliary lipids greatly increases the structural stability of the prepared nanoparticles, significantly improves the circulation time of nanoparticles in the blood, and improves the enrichment and infiltration of nanoparticles at the tumor site. The above features make the nanoparticle delivery system a new platform for efficient delivery of mRNA. Attached Figure Description

[0041] Figure 1 Image of anti-PD1 mRNA@LPNPs taken by transmission electron microscopy;

[0042] Figure 2 The graph shows the diameter and polymerization dispersion index of the nanopolymer at different time points.

[0043] Figure 3This is a comparison of the expression capabilities of EGFP mRNA@LPNPs and EGFP mRNA@Lipo.

[0044] Figure 4 Figure 1 shows the effect of anti-PD1 mRNA@LPNPs on the viability of Panc02 cells at different time points.

[0045] Figure 5 Figures showing the lysosomal escape experiment of LPNPs loaded with mRNA at different time points;

[0046] Figure 6 The size and purity of anti-PD1 mRNA were examined using agarose gel electrophoresis.

[0047] Figure 7 Image showing CD8 T cell proliferation stimulated by anti-PD1 mRNA;

[0048] Figure 8 The expression diagram of anti-PD1 mRNA@LPNPs in tumor tissue samples;

[0049] Figure 9 A diagram showing the proliferation of CD8 T cells in the tumor microenvironment stimulated by anti-PD1 mRNA@LPNPs;

[0050] Figure 10 A timeline diagram showing the treatment of pancreatic cancer-bearing mice with anti-PD1 mRNA@LPNPs;

[0051] Figure 11 Figure showing the efficacy of anti-PD1 mRNA@LPNPs in treating pancreatic cancer-bearing mice;

[0052] Figure 12 A statistical graph showing the efficacy of anti-PD1 mRNA@LPNPs in treating pancreatic cancer-bearing mice. Detailed Implementation

[0053] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0054] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0055] 1. Materials

[0056] PAMAM dendritic polymer (ethylenediamine core, G0 generation) methanol solution, 1,2-epoxytetradecane, polylactic-co-glycolic acid copolymer (PLGA), and distearate-phosphatidylethanolamine-methoxy polyethylene glycol (DSPE-PEG) were from Sigma-Aldrich. Lipofectamine 2000 (Lip2k) and TE buffer (20×) were purchased from Invitrogen, Carlsbad, California, USA. Recombinant mouse IL4 protein, recombinant mouse GM-CSF protein, and mouse CD8 T cell sorting kit were purchased from Biolegend. CFSE cell proliferation kit was purchased from Thermo Fisher.

[0057] The EGFP sequence was obtained from the Miaoling plasmid platform, the antiPD1 plasmid vector sequence was obtained from Qingke Biotechnology Co., Ltd., and the T7 HighYield RNATranscription Kit was obtained from Novizan Biotechnology Co., Ltd. Related primers were obtained from Qingke Biotechnology Co., Ltd.

[0058] 2. Cell lines

[0059] The mouse pancreatic cancer Panc02 cells were purchased from Shanghai Bosheng Biotechnology Co., Ltd., and the human kidney epithelial cells (293T) were purchased from the Cell Bank of the Chinese Academy of Sciences. The cells were cultured in DMEM medium, and 1% penicillin / streptomycin antibiotic (Thermo-Fisher Scientific) and 10% fetal bovine serum (Excell) were added to the cell culture medium.

[0060] Example 1

[0061] Chemically modified anti-PD1 mRNA and enhanced green fluorescent protein mRNA (EGFP mRNA) were synthesized in vitro.

[0062] Circular enhanced green fluorescent protein (EGFP) and anti-PD1 mRNA (SEQ ID NO.1: ATGGGACTGGGACTGCAGTGGGTGTTCTTCGTG) were synthesized using in vitro transcription (IVT). To avoid immune stimulation caused by mRNA, pseudouridine-5'-triphosphate (Pseudo-UTP) was used instead of conventional uridine triphosphate.

[0063] (1) The open reading frame plasmids of human anti-PD1 and EGFP genes carrying T7 promoter and T7 terminator were used as templates for polymerase chain reaction (PCR) amplification (the plasmids were purchased from Qingke Biotechnology and Miaoling Biotechnology, respectively, and amplified in DH5α). The T7 promoter sequence was used as the forward primer and the T7 terminator sequence was used as the reverse primer. The Novizan PCR kit was used, and the reaction was carried out in 34 cycles at 98℃ for 10s, 60℃ for 5s, and 72℃ for 15s. The template was amplified, and the amplification products were separated by 1% gel electrophoresis and purified using the Novizan gel recovery kit to form linearized DNA as a template for in vitro transcription.

[0064] (2) For in vitro transcription (IVT), the Novizan T7 transcription kit was used with 1-2 μg of in vitro transcription template, 7.5 mM guanosine triphosphate, 7.5 mM 5-methyl-cytidine triphosphate, 7.5 mM adenosine triphosphate and 7.5 mM pseudouridine-5'-triphosphate. The reaction was carried out at 37°C for 2 hours, followed by deoxyribonuclease (DNase) treatment to obtain anti-PD1 mRNA and EFFP mRNA.

[0065] (3) The above mRNA was purified by semi-preparative high performance liquid chromatography (HPLC) to obtain the total ion chromatogram of the in vitro transcription product. Salts in the buffer were removed by centrifugation using an ultrafiltration device (EMD Millipore, MWCO 100kDa). After washing three times with enzyme-free water, the above mRNA was collected in enzyme-free water for further use or stored in a -80℃ freezer to obtain further purified anti-PD1 mRNA and EFFP mRNA.

[0066] To assess the purity and fragment size of the product from step (3), step (3) was analyzed by electrophoresis on a 2% agarose gel; electrophoresis conditions: 100V, 30min. The results are as follows: Figure 6 The image shown is a 2% gel electrophoresis result.

[0067] Example 2

[0068] Preparation and characterization of nano-formulations.

[0069] EGFP-mRNA and anti-PD1 mRNA nanoformations (lipid polymer composite nanoformations encapsulating mRNA) were prepared using a self-assembly method.

[0070] (1) Synthesis of cationic molecule G0-C14: 1 mmol of PAMAM dendrimer (ethylenediamine core, G0-substituted) methanol solution (CAS No.: 155773-2-1) and 7 mmol of 1,2-epoxytetradecane (CAS No.: 3234-28-4) were added to a 20 mL reaction flask to form a mixed reaction solution. The methanol solution was removed by negative pressure distillation. The reaction was then carried out under argon protection at 90 °C and a stirring speed of 800 rpm for 48 h. After the reaction was completed, the reaction product was diluted with dichloromethane and then purified by silica gel column chromatography to obtain the cationic lipid G0-C14.

[0071] (2) Preparation of key component mother liquor: Dissolve GO-C14, PLGA and DSPE-PEG fully in N,N-dimethylformamide (DMF) to obtain the corresponding component mother liquors - GO-C14 (2.5 mg / mL), PLGA (5.0 mg / mL) and DSPE-PEG (20 mg / mL).

[0072] (3) Prepare 50mM and 10mM citrate buffer (pH=4.0) and use DEPC for nuclease-free treatment.

[0073] (4) Preparation of mRNA / G0-C14 complex: Take 10 μg of EGFP-mRNA and anti-PD1 mRNA (1 μg / μL) respectively, add 2.5 μL of citrate buffer (50 mM), mix well, and then quickly add to 50 μL of G0-C14DMF solution under vortex. Continue vortexing for 20 s to obtain mRNA / G0-C14 complex.

[0074] (5) Add 50 μL of PLGA DMF solution and 25 μL of DSPE-PEGDMF solution to the above mRNA / G0-C14 complex in sequence, and mix well to obtain solution A.

[0075] (6) Under vortexing, quickly add solution A to 625 μL of citrate buffer (10 mM) and continue vortexing for 50 s.

[0076] (7) Under vortexing, slowly add 625 μL of 1×PBS dropwise to the above mixed solution.

[0077] (8) The organic solvent and free compounds in the nano-formulation dispersion were removed by centrifugation using an ultrafiltration device (EMD Millipore, MWCO 100kDa); after washing three times with high-pressure water, the volume was adjusted to 500 μL of antiPD1 mRNA / G0-C14 LPNPs (mRNA concentration: 20 ng / μL) with pH 7.41×PBS buffer for further use or storage at 4°C. The prepared nano-formulation was characterized by dynamic light scattering (DLS) and transmission electron microscopy (TEM).

[0078] Example 3

[0079] The safety, expression capacity, and ability to inhibit T cell exhaustion of the nanoformulation were evaluated in vitro.

[0080] (1) Panc02 cells were evenly seeded in 96-well plates at a density of 5000 cells per well. After 24 h of cell adhesion, cells were transfected with different concentrations (0.25, 0.5, 0.75, or 1 μg / mL) of anti-PD1 mRNA nanoparticles for 12 h, followed by 0.1 mL of fresh complete culture medium and further culture for 24 h to assess cell viability. Cell viability was assessed using a CCK8 assay, a non-toxic method for detecting cell viability, which allows for real-time cell proliferation monitoring using a microplate reader (TECAN, Infinite M200 Pro). Absorbance was measured at 450 nm using a 96-well Spectramax plate reader (Molecular Device, Sunnyvale, California).

[0081] (2) 293T cells were evenly seeded in 6-well plates at a density of 200,000 cells per well. After 24 h of cell adhesion, cells were transfected with 1 μg / mL enhanced green fluorescent protein mRNA for 12 h, then 2 mL of fresh complete culture medium was added and the cells were cultured for another 24 h. The cells were photographed under a fluorescence microscope and the expression capacity of the green fluorescent protein nanoparticles was determined by detecting the average fluorescence intensity of the enhanced green fluorescent protein positive cells using flow cytometry (Beckman, CytoFLEX).

[0082] (3) Dendritic cells derived from primary mouse bone marrow were extracted. First, bone marrow cells from the femur and tibia were flushed into RIPM1640 medium using a syringe with a 23-gauge needle. The cell suspension was gently passed through the syringe several times to disperse clumps. Then, the cell suspension was passed through a 70 μm mesh nylon filter to remove any remaining clumps and debris. The cells were centrifuged at 300 g for 10 min and then centrifuged at (0.5-2) × 10⁻⁶. 6Cells were resuspended at a concentration of 10 cells / mL in RPMI 1640 medium containing 10% FBS, 2 mM L-Glutamine, and 5 μM 2-mercaptoethanol. The medium was supplemented with 10 ng / mL of recombinant mouse GM-CSF protein and 10 ng / mL of recombinant mouse IL4 protein. After incubation at 37°C for 5 days, non-adherent dendritic cells (DCs) were collected. DCs were transfected with 1 μg of anti-PD1 mRNA via electroporation (Thermo, Neon NXT) at 1500 v, 20 ms, and 2 pulses, and then cultured at 37°C for another 24 h. Simultaneously, fresh mouse spleens were obtained and carefully minced using scissors in a culture dish containing 5 mL of HBSS (Hanks' balanced salt solution) buffer. Place a cell sieve over a 50 mL conical tube. Using a disposable pipette, transfer the minced spleen into the sieve. Then, using the plunger of a syringe, gently abrade the spleen to pass through the sieve. Rinse the sieve with copious amounts of HBSS. Collect the cell suspension in the conical tube and centrifuge at 400-600 g for 5 min at 4°C, discarding the supernatant. Resuspend the cells in 2-5 mL of pre-chilled erythrocyte lysis buffer and incubate on ice for 5 min. Wash the cell suspension with 20 mL of ice-cold PBS and centrifuge at 600 g for 5 min at 4°C, discarding the supernatant. Resuspend the cells in PBS and extract mouse spleen CD8 T cells using a mouse CD8 T cell sorting kit. Next, co-culture the CFSE-stained CD8 T cells with untransfected dendritic cells (DCs), DCs supplemented with 1 μg of mouse PD-1 antibody (CD279, BioXCell), and DCs transfected with 1 μg of anti-PD1 mRNA for 60 h to assess T cell proliferation. T cell proliferation was assessed by detecting CFSE fluorescence decay using flow cytometry.

[0083] Experimental Results: The morphology of mRNA nanoparticles was observed using transmission electron microscopy (ThermoFisher, Talos L120C). Figure 1 (As shown). The size and stability of mRNA nanoparticles in phosphate buffer at 4°C over 5 days were determined using dynamic light scattering (DLS, Brookhaven Instruments, USA). Figure 2 (As shown). To further verify the effectiveness of in vitro transfection, enhanced green fluorescent protein mRNA (EGFP-mRNA) was selected as the model mRNA. The high transfection efficiency of the EGFP-mRNA nanoparticles could be directly observed using an inverted fluorescence microscope. Flow cytometry analysis showed that the average fluorescence intensity of cells transfected with the EGFP-mRNA nanoparticles 24 hours after transfection was close to that of Lipo2k (see...). Figure 3CCK8 experiments verified that the cell viability of Panc02 cells treated with 0.25, 0.5, 0.75, and 1 μg of nano-formulation for 24, 48, and 72 hours was above 85% (e.g., ...). Figure 4 (As shown). Nanoparticles can effectively deliver Cy5-labeled mRNA into the cytoplasm. After 6 hours of culture, a large amount of Cy5-labeled mRNA escapes from lysosomes and diffuses into the cytoplasm. In contrast, naked mRNA cannot enter cells after 6 hours of culture (e.g., ...). Figure 5 (As shown). Furthermore, the nano-formulation significantly inhibited T cell depletion compared to mouse PD-1 antibodies (e.g., Figure 7 (As shown).

[0084] Example 4

[0085] Intravenous delivery of anti-PD1 nanoparticles can target the tumor microenvironment and exert a therapeutic effect in pancreatic cancer.

[0086] (1) Establishment of an orthotopic tumor model: Male C57BL6 / J mice approximately 6 weeks old were selected. On day 0, 200,000 Panc02-luci cells were injected orthotopically into the pancreas. On day 4, the mice were randomly divided into a saline group, an empty nanoparticle group without mRNA (empty vector group), and an anti-PD1 mRNA nanoparticle group. The nanoparticles were injected intravenously at a dose of 10 μg / mouse, once every 3 days for 4 consecutive injections. The empty vector group was treated with the same dose of empty nanoparticles without anti-PD1 mRNA to exclude the influence of the nanoparticles on disease progression. The size of the orthotopic tumor was recorded every three days using small animal in vivo imaging. The modeling and treatment time points are as follows: Figure 10 As shown.

[0087] (2) To verify the tumor targeting of anti-PD1 nanoparticles and their effect on the immune microenvironment of tumor tissue, anti-PD1 mRNA nanoparticles were injected via the tail vein at a dose of 10 μg / mouse, once every three days for five consecutive days. Mice were sacrificed on day 22, and tumor tissues were collected. The expression of anti-PD1 mRNA in the tumor tissue was detected by immunofluorescence, and the expression of CD8 T cells in the tumor tissue was detected by immunohistochemical staining.

[0088] Experimental Results: In vivo antitumor studies were conducted on C57BL6 mice with orthotopic pancreatic transplantation from Panc02 tumors. Anti-PD1 mRNA nanoparticles were injected every three days via tail vein injection for a total of five injections. Saline and empty vector groups served as controls. The control group of Panc02 orthotopic tumor mice showed similar rapid tumor growth, while the tail vein-injected anti-PD1 mRNA nanoparticle group exhibited a stronger antitumor effect (e.g., ...). Figure 11 and Figure 12(As shown). Furthermore, mRNA delivered systematically via the tail vein can be effectively expressed at the tumor site (e.g., Figure 8 As shown), at the same time, compared with the empty vector group, the anti-PD1 mRNA nanoparticles injected via the tail vein significantly increased the expression of CD8 in tumor tissue (e.g., Figure 9 As shown in the figure, these results indicate that anti-PD1 mRNA can be successfully expressed in situ in pancreatic tumors and can significantly increase the number of CD8 cells, thereby improving the tumor microenvironment.

[0089] In summary, the anti-PD1 mRNA nanoformulation of the present invention can generate anti-PD1 antibodies by itself, produce proteins with better activity, effectively block PD1 receptors on T cells, inhibit the depletion of cytotoxic CD8 T cells, and can rapidly and accurately increase the drug concentration at the site of antibody efficacy, with high safety and stability.

[0090] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. An anti-PD1 mRNA nanoformulation, characterized in that, The anti-PD1 mRNA nanoformulation comprises: anti-PD1 mRNA and a nanodelivery carrier, wherein the anti-PD1 mRNA is loaded in the nanodelivery carrier.

2. The anti-PD1 mRNA nanoformulation according to claim 1, characterized in that, The anti-mRNA includes any one or a combination of at least two of the following: self-reporter gene anti-PD1 mRNA, self-amplified anti-PD1 mRNA, or circular anti-PD1 mRNA.

3. The anti-PD1 mRNA nanoformulation according to claim 1 or 2, characterized in that, The nanodelivery carrier includes any one or a combination of at least two of cationic lipid complexes, lipid nanoparticles, polymer nanoparticles, or lipid-polymer hybrid nanoparticles.

4. The anti-PD1 mRNA nanoformulation according to claim 3, characterized in that, The lipid-polymer hybrid nanoparticles contain cationic molecules, polymers, and biocompatible modifying molecules; Preferably, the cationic molecule includes any one or a combination of at least two of the following: ammonia derivatives, positively charged amphiphilic lipid compounds, ammonium salts and their derivatives, or polyamides and their derivatives. Preferably, the polymer comprises any one or a combination of at least two of polylactic acid and its copolymers, carbophospholipids and their derivatives, amino acids and their derivatives, polyols and their derivatives, or polyacrylic acid and its derivatives. Preferably, the biocompatible modification molecule includes any one or a combination of at least two of polyethylene glycol and its derivatives, mannitol, dextran, carboxyglucan, liposomes, albumin, tetraethyl orthosilicate, or polyglutamic acid.

5. The anti-PD1 mRNA nanoformulation according to claim 4, characterized in that, The cationic molecules include G0-C14; Preferably, the polymer comprises a polylactic acid-glycolic acid copolymer; Preferably, the biocompatibility modification molecule includes distearate phosphatidylethanolamine-methoxy polyethylene glycol.

6. A method for preparing an anti-PD1 mRNA nanoparticle formulation according to any one of claims 1-5, characterized in that, The preparation method includes: encapsulating the anti-PD1 mRNA in the nanodelivery carrier.

7. The preparation method according to claim 6, characterized in that, The preparation method includes: mixing the anti-PD1 mRNA with cationic molecules to obtain an mRNA-cationic molecule complex; mixing the mRNA-cationic molecule complex with a polymer and a biocompatible modification molecule to obtain a mixture; and mixing the mixture with an aqueous solution and then performing dialysis to obtain the anti-PD1 mRNA nanoparticle formulation.

8. The preparation method according to claim 6 or 7, characterized in that, The mass ratio of the anti-PD1 mRNA to the cationic molecule is 1:(10-15); Preferably, the mass ratio of the mRNA-cationic molecule complex, the polymer, and the biocompatible modification molecule is 1:(10-15):(20-30):(40-60).

9. The use of the anti-PD1 mRNA nanoformulation according to any one of claims 1-5 in the preparation of products for treating solid tumors.

10. The application according to claim 9, characterized in that, The solid tumor includes any one or a combination of at least two of pancreatic cancer, colorectal cancer, liver cancer, or melanoma.