Use of circpsd3 inhibitors in ptc-related drugs

Abstract

The present application relates to the technical field of biological medicine, and particularly relates to application of a circPSD3 inhibitor in PTC related drugs. Knocking down of circPSD3 can significantly inhibit the proliferation, migration and invasion of PTC cells, and the circPSD3 inhibitor can prevent or treat thyroid papillary carcinoma by inhibiting circPSD3. Therefore, the circPSD3 inhibitor can be used for preparing a drug for preventing or treating thyroid papillary carcinoma.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of circPSD3 inhibitors in PTC-related drugs. Background Technology

[0002] Thyroid cancer is a common malignant tumor of the endocrine system, including four pathological types: papillary carcinoma, follicular carcinoma, undifferentiated carcinoma, and medullary carcinoma, with papillary thyroid carcinoma (PTC) being the most common. Most PTC patients have a good prognosis and a high ten-year survival rate. However, some PTC patients develop extrathyroidal invasion, vascular invasion, and distant metastasis, resulting in a high recurrence rate and a relatively poor prognosis. For these patients, current treatment options are limited, and systemic drug therapy is particularly lacking.

[0003] In recent years, the incidence of thyroid cancer has been rising globally, becoming a significant public health issue. Therefore, developing new, safer, and more effective drugs for the treatment of thyroid cancer (PTC) is an urgent clinical need and of great social significance for improving patient prognosis and quality of life. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide the application of circPSD3 inhibitors in the preparation of drugs for the prevention or treatment of papillary thyroid carcinoma.

[0005] In a first aspect, the present invention provides the use of circPSD3 inhibitors in the preparation of medicaments for the prevention or treatment of papillary thyroid carcinoma.

[0006] circPSD3 (hsa-circ-0002111) originates from the PSD3 gene and consists of exons 5-9 of the PSD3 gene. The circular junction is located at the 5' end of exon 5 and the 3' end of exon 9. Knockdown of circPSD3 significantly inhibits the proliferation, migration, and invasion of PTC cells. circPSD3 inhibitors, by inhibiting circPSD3, can play a role in the prevention or treatment of papillary thyroid carcinoma. Therefore, circPSD3 inhibitors can be used to develop drugs for the prevention or treatment of papillary thyroid carcinoma.

[0007] In some optional embodiments, the circPSD3 inhibitor is si-circPSD3, wherein the sense strand of si-circPSD3 (si-circPSD3-SP) includes the sequence shown in SEQ ID No. 1, and the antisense strand of si-circPSD3 (si-circPSD3-AP) includes the sequence shown in SEQ ID No. 2. Specifically, SEQ ID No. 1 is AGGATCTGCTGAAACAATGCT, and SEQ ID No. 2 is AGCATTGTTTCAGCAGATCCT.

[0008] In some optional embodiments, the positive chain (si-circPSD3-SP) sequence of si-circPSD3 is 5'-AGGATCTGCTGAAACAATGCT-dTdT-3', and the negative chain (si-circPSD3-AP) sequence of si-circPSD3 is 5'-AGCATTGTTTCAGCAGATCCT-dTdT-3'.

[0009] In a second aspect, the present invention provides a medicament for the prevention or treatment of papillary thyroid carcinoma, comprising a circPSD3 inhibitor.

[0010] In some optional embodiments, the circPSD3 inhibitor is si-circPSD3, wherein the sense strand of si-circPSD3 (si-circPSD3-SP) includes the sequence shown in SEQ ID No. 1, and the antisense strand of si-circPSD3 (si-circPSD3-AP) includes the sequence shown in SEQ ID No. 2. Specifically, SEQ ID No. 1 is AGGATCTGCTGAAACAATGCT, and SEQ ID No. 2 is AGCATTGTTTCAGCAGATCCT.

[0011] In some optional embodiments, the positive chain (si-circPSD3-SP) sequence of si-circPSD3 is 5'-AGGATCTGCTGAAACAATGCT-dTdT-3', and the negative chain (si-circPSD3-AP) sequence of si-circPSD3 is 5'-AGCATTGTTTCAGCAGATCCT-dTdT-3'.

[0012] In some alternative embodiments, the medicament for preventing or treating papillary thyroid carcinoma further includes a pharmaceutically acceptable carrier.

[0013] In some alternative embodiments, the pharmaceutically acceptable carrier is water or physiological saline.

[0014] Thirdly, the present invention provides the application of the circPSD3 detection reagent in the preparation of a kit for detecting papillary thyroid carcinoma.

[0015] Fourthly, the present invention provides a kit for detecting papillary thyroid carcinoma, which includes a detection reagent for circPSD3.

[0016] Due to the adoption of the above technical solutions, the embodiments of the present invention have at least the following beneficial effects: the function of circular RNA in PTC cells was studied, and it was clarified that circPSD3 can serve as a new therapeutic target for PTC; the use of circPSD3 inhibitors in the preparation of drugs for the prevention or treatment of PTC provides a new approach for the prevention or treatment of PTC. Attached Figure Description

[0017] Figure 1 This is a statistical graph showing the transcriptome sequencing results of adjacent and cancerous tissues from three patients with papillary thyroid carcinoma in this embodiment of the invention.

[0018] Figure 2 This is a statistical graph showing the qPCR results of adjacent and cancerous tissues from 33 patients with papillary thyroid carcinoma in this embodiment of the invention.

[0019] Figure 3 This is a statistical graph showing the cell proliferation experiment results in the embodiments of the present invention. In the graph, A represents the relative expression level of circPSD3 in BCPAP cells of papillary thyroid carcinoma, B represents the absorbance value at 490 nm wavelength in BCPAP cells of papillary thyroid carcinoma, C represents the relative expression level of circPSD3 in KTC-1 cells of papillary thyroid carcinoma, and D represents the absorbance value at 490 nm wavelength in KTC-1 cells of papillary thyroid carcinoma.

[0020] Figure 4 The figures shown are statistical graphs of cell invasion and migration experiment results in embodiments of the present invention. In these figures, A represents the results of cell invasion and migration experiments using BCPAP cells of papillary thyroid carcinoma, B represents the results of cell invasion and migration experiments using KTC-1 cells of papillary thyroid carcinoma, C represents the cell count statistics of A, and D represents the cell count statistics of B.

[0021] Figure 5 This is a statistical graph showing the results of luciferase experiments in which circPSD3 was co-transfected with miRNAs of 9 different miRNAs into papillary thyroid carcinoma in this embodiment of the invention. In the graph, A represents BCPAP cells and B represents KTC-1 cells.

[0022] Figure 6The graph shows the results of circMIR1.0 analysis and luciferase experiment before and after mutation of the has-miR-30a-3p binding site in the embodiments of the present invention. In the graph, A is the result of circMIR1.0 analysis, B is before mutation, and C is after mutation.

[0023] Figure 7 This is a graph showing the analysis results of the Targetscan tool in an embodiment of the present invention.

[0024] Figure 8 This is a statistical chart showing the analysis results of the TCGA database in an embodiment of the present invention.

[0025] Figure 9 The figures show statistical graphs and Western blot results of luciferase assays in which the 3' UTR region of the TUSC3 gene was co-transfected with the has-miR-30a-3p mimic into BCPAP and KTC-1 papillary thyroid carcinoma cells, respectively, in embodiments of the present invention. In the figures, A represents the luciferase assay results before mutation, B represents the luciferase assay results after mutation, C represents the corresponding TUSC3 band, and D represents a comparison between BCPAP and KTC-1 cells.

[0026] Figure 10 This is a statistical graph showing the TCGA database analysis results of TUSC3 and CTNNB1 gene expression in patients with papillary thyroid carcinoma in this embodiment of the invention. In the graph, A represents the TUSC3 gene, B represents the CTNNB1 gene, and C represents the correlation analysis.

[0027] Figure 11 This is a statistical graph showing the TCGA database analysis results of CDH1 and CDH2 gene expression in patients with papillary thyroid carcinoma in this embodiment of the invention. In the graph, A represents the CDH1 gene and B represents the CDH2 gene. Detailed Implementation

[0028] The following will clearly and completely describe the concept of the present invention and the resulting technical effects, so as to fully explain the purpose, solution and effects of the present invention.

[0029] The inventors discovered that inhibiting circPSD3 can effectively inhibit PTC. Accordingly, this invention provides the use of circPSD3 inhibitors in the preparation of drugs for the prevention or treatment of papillary thyroid carcinoma. The technical solution of this invention was verified through the following experiments.

[0030] In the following experiment, the PTC patients came from the Second People's Hospital of Shenzhen.

[0031] Adjacent and cancerous tissues were collected from three patients with PTC (percutaneous transcranial neoplasia) and RNA-Seq was performed to analyze the expression of circPSD3. The results are as follows: Figure 1 As shown, circPSD3 expression in PTC patients' cancerous tissues was significantly higher than that in adjacent normal tissues.

[0032] Perinatal and cancerous tissue samples were collected from 33 patients with PTC and validated by qPCR. Results are as follows: Figure 2 As shown, circPSD3 expression in the cancerous tissue of PTC patients was significantly higher than that in the adjacent normal tissue.

[0033] Cell proliferation experiments were conducted, and the results were as follows: Figure 3 As shown, in PTC cell lines BCPAP and KTC-1, knockdown of circPSD3 with si-circPSD3 inhibited PTC cell proliferation. The sense strand (si-circPSD3-SP) sequence of si-circPSD3 is 5'-AGGATCTGCTGAAACAATGCT-dTdT-3', and the antisense strand (si-circPSD3-AP) sequence is 5'-AGCATTGTTTCAGCAGATCCT-dTdT-3'. The cell proliferation assay was performed by seeding 1*10 cells of each cell line. 3 Cells were cultured in cell culture plates. At the specified time, 20 μl of CellTiter 96® water-soluble single-solution cell reagent (purchased from Promega) was added to each well of the 96-well plate (100 μl of culture medium). The reaction was carried out at 37°C for 1-4 hours, and then the absorbance was measured at 490 nm. The experimental group consisted of PTC cell lines BCPAP and KTC-1 knocked down with si-circPSD3, while the unknocked PTC cell lines BCPAP and KTC-1 served as the control group.

[0034] Cell invasion and cell migration experiments were conducted, and the results were as follows: Figure 4 As shown, knocking down circPSD3 with si-circPSD3 inhibited the migration and invasion of BCPAP and KTC-1 cells. The cell invasion assay involved adding serum-free cell culture medium to the upper chamber of a Transwell substrate-coated cell bed, and then adding 1*10⁻⁶ cells to each chamber. 6 PTC cells were cultured in the lower chamber with complete culture medium for 48 hours. Cells in the upper chamber were removed, and cells at the bottom were fixed with methanol, stained with 0.5% crystal violet, and counted under a microscope. The experimental group consisted of PTC cell lines BCPAP and KTC-1 knocked down with si-circPSD3, while the control group consisted of PTC cell lines BCPAP and KTC-1 treated with si-NC. The cell migration assay was performed as follows: serum-free cell culture medium was added to the upper chamber of the Transwell containing matrix gel, and then 1*10n cells were added to each chamber.6 PTC cells were cultured in the lower chamber with complete culture medium for 48 hours. The cells in the upper part of the chamber were removed, and the cells at the bottom of the chamber were fixed with methanol, stained with 0.5% crystal violet, and finally counted under a microscope. The experimental group consisted of PTC cell lines BCPAP and KTC-1 knocked down with si-circPSD3, while the PTC cell lines BCPAP and KTC-1 treated with si-NC were used as control cells.

[0035] The full-length circPSD3 sequence was inserted downstream of the Renal luciferase gene in the luciferase vector pmiR-RB-Report. Using Lipofectamine 2000 (Thermo Fisher Scientific), this plasmid was co-transfected with mimics of nine miRNAs into BCPAP or KTC-1 cell lines. Forty-eight hours after transfection, the luciferase signals of firefly and Renal luciferase were detected using a dual-luciferase reporter gene assay system (Promega Scientific). Relative luciferase activity was calculated by standardizing the firefly luciferase readings with the Renal luciferase signal, which served as an internal control. Among them, the miRNAs of the nine miRNAs were hsa-miR-450b-5p, hsa-miR-205-3p, hsa-miR-30a-3p, hsa-miR-5096, hsa-miR-95-5p, hsa-miR-329-5p, hsa-miR-22-5p, hsa-miR-221-5p, and hsa-miR-520-5p. The results are as follows... Figure 5 As shown, in BCPAP and KTC-1 cell lines, hsa-miR-30a-3p can reduce luciferase activity by 50%-60%, indicating that hsa-miR-30a-3p has the strongest binding ability to circPSD3.

[0036] In the circMIR 1.0 software, "circPSD3" and "has-miR-30a-3p" were entered successively, and "GO" was clicked for analysis. The results showed that circPSD3 has two possible hsa-miR-30a-3p binding sites ( Figure 6 (A). When wild-type circPSD3 is ligated downstream of the Renalis luciferase gene in the luciferase vector, the hsa-miR-30a-3p mimic reduces luciferase activity in BCPAP cell lines by 60%. Figure 6 (B); while mutation of these two possible hsa-miR-30a-3p binding sites had no effect on luciferase activity (B). Figure 6(C). These results indicate that circPSD3 adsorbs hsa-miR-30a-3p like a sponge and interacts directly with it.

[0037] In the Targetscan database, select "human" and then enter "hsa-miR-30a-3p". It is found that hsa-miR-30a-3p can bind to the 3' UTR region of TUSC3. Figure 7 Analysis of the TCGA database showed that the expression of hsa-miR-30a-3p was negatively correlated with the expression of TUSC3, with a correlation coefficient of -0.4666. Figure 8 These analytical results suggest that hsa-miR-30a-3p may bind to TUSC3.

[0038] The 3' UTR region of TUSC3 was linked downstream of the Renalis luciferase gene in the luciferase vector. This plasmid was then co-transfected with the hsa-miR-30a-3p mimic into BCPAP cell lines. The results showed that overexpression of hsa-miR-30a-3p reduced luciferase activity by 64%. Figure 9 (A); while after the possible binding site of hsa-miR-30a-3p in the 3' UTR region of the mutant TUSC3, the hsa-miR-30a-3p mimic had no significant effect on luciferase activity. Figure 9 (B). Western blot results showed that overexpression of hsa-miR-30a-3p reduced TUSC3 protein levels (B). Figure 9 C and Figure 9 (Middle D). These results indicate that hsa-miR-30a-3p acts as a "sponge" for TUSC3, inhibiting TUSC3 expression.

[0039] Analysis of differentially expressed genes in PTC from the TCGA database revealed elevated expression of both TUSC3 and CTNNB1 genes (encoding β-catenin) in PTC patient tissues. Figure 10 China A, Figure 10 (B), and the correlation coefficient between the two reached 0.4259 ( Figure 10 The C-value suggests an interaction between TUSC3 and β-catenin.

[0040] In addition, TCGA database analysis showed that CDH1 expression was decreased in PTC patient cancer tissues. Figure 11 In the middle A), CDH2 expression increased ( Figure 11(B) CDH1 encodes E-cadherin, and CDH2 encodes N-cadherin. E-cadherin is a marker of epithelial cells, while N-cadherin is a marker of mesenchymal cells. This suggests that TUSC3, which is highly expressed in PTC, first activates β-catenin expression, then inhibits E-cadherin expression and upregulates N-cadherin expression, leading to cadherin switching and thus promoting PTC development.

[0041] In summary, circPSD3 can serve as a biomarker for the diagnosis of PTC, providing a novel therapeutic target for PTC. circPSD3 inhibitors can prevent or treat papillary thyroid carcinoma by inhibiting circPSD3.

[0042] The above description is merely a preferred embodiment of the present invention. The present invention is not limited to the above-described embodiments. Any embodiment that achieves the technical effects of the present invention by the same or equivalent means should fall within the protection scope of the present invention. Within the protection scope of the present invention, various modifications and variations can be made to the technical solutions and / or implementation methods.

Claims

1. Application of circPSD3 inhibitors in the preparation of drugs for the prevention or treatment of papillary thyroid carcinoma.

2. The application according to claim 1, characterized in that, The circPSD3 inhibitor is si-circPSD3, the sense strand of which includes the sequence shown in SEQ ID No. 1, and the antisense strand of which includes the sequence shown in SEQ ID No.

2.

3. The application according to claim 1, characterized in that, The positive chain sequence of si-circPSD3 is 5'-AGGATCTGCTGAAACAATGCT-dTdT-3', and the negative chain sequence of si-circPSD3 is 5'-AGCATTGTTTCAGCAGATCCT-dTdT-3'.

4. A drug for the prevention or treatment of papillary thyroid carcinoma, characterized in that, Including circPSD3 inhibitors.

5. The medicament for preventing or treating papillary thyroid carcinoma according to claim 4, characterized in that, The circPSD3 inhibitor is si-circPSD3, the sense strand of which includes the sequence shown in SEQ ID No. 1, and the antisense strand of which includes the sequence shown in SEQ ID No.

2.

6. The medicament for preventing or treating papillary thyroid carcinoma according to claim 4, characterized in that, The positive chain sequence of si-circPSD3 is 5'-AGGATCTGCTGAAACAATGCT-dTdT-3', and the negative chain sequence of si-circPSD3 is 5'-AGCATTGTTTCAGCAGATCCT-dTdT-3'.

7. The medicament for preventing or treating papillary thyroid carcinoma according to claim 4, characterized in that, The drugs mentioned for the prevention or treatment of papillary thyroid carcinoma also include pharmaceutically acceptable carriers.

8. The medicament for preventing or treating papillary thyroid carcinoma according to claim 7, characterized in that, The pharmaceutically acceptable carrier is water or physiological saline.

9. Application of circPSD3 detection reagent in the preparation of a kit for detecting papillary thyroid carcinoma.

10. A kit for detecting papillary thyroid carcinoma, characterized in that, Including detection reagents for circPSD3.

Images