Enzyme synergistic surface-displayed artificial cellulosome, its construction method and whole-cell catalytic application

Abstract

The application discloses an enzyme synergistic effect type surface display artificial fiber organelle, a construction method thereof and whole cell catalysis application. The application takes BL21 (DE3) Delta CsgA as a chassis, eliminates assembly interference by knocking out endogenous CsgA through CRISPR-Cas9, constructs a recombination vector, carries out modular fusion on CsgA anchoring protein, GH10 family xylanase and GH5 family bifunctional glucanase, and realizes efficient display of self-assembly fiber organelle on the surface of escherichia coli. It is verified that the fiber organelle is correctly assembled and clearly positioned. The constructed engineering bacteria can be used as a whole cell catalyst to directly degrade lignocellulose substrates such as corn, rice and peanut straw, and generate functional oligosaccharides with a polymerization degree of 3-4. The application has the advantages of simple process, low cost, strong catalytic synergy, specific product and the like, and can be used in the fields of biomass resource utilization, feed anti-nutritional factor removal, functional oligosaccharide preparation and the like.

Description

Technical Field

[0001] This invention relates to an enzyme-synergistic surface-displaying artificial fibrous body, its construction method, and its whole-cell catalytic application, belonging to the fields of synthetic biology and biomass degradation biotechnology. Background Art

[0002] Lignocellulose is the most abundant, widely distributed, and lowest-cost renewable biomass resource in nature. Its efficient degradation and high-value utilization are core links in biorefining, antibiotic-free feed nutrients, and the industrial production of functional oligosaccharides. Natural lignocellulose consists of a dense, anti-degradation barrier formed by the highly interwoven structure of cellulose, hemicellulose, and lignin, requiring the synergistic action of multiple enzymes such as cellulase and hemicellulase for efficient depolymerization. Traditional free enzyme catalytic processes suffer from bottlenecks such as high enzyme separation and purification costs, poor stability, difficulty in recovery and reuse, and substrate diffusion-limited catalytic efficiency, failing to meet the demands of continuous industrial production.

[0003] The CAZy database (https: / / www.cazy.org / ) currently includes five functional categories: glycoside hydrolases (GHs), polysaccharide lyases (PLs), auxiliary activities (AAs), glycosyltransferases (GTs), and carbohydrate esterases (CEs). Among these, GHs are the most widely studied carbohydrate esterases. Cellulase is a collective term for a series of hydrolases that can hydrolyze β-1,4 glycosidic bonds to produce cellooligosaccharides, cellobiose, and glucose. Hemicellulase is a collective term for a series of enzymes that can specifically hydrolyze hemicellulose. Unlike cellulose, hemicellulose is a heteropolysaccharide formed by various sugar units (xylose, mannose, arabinose, etc.) linked by different glycosidic bonds. Glucanase and xylanase can efficiently degrade non-starch polysaccharides, reduce digesta viscosity, and improve feed conversion rate, making them important components of feed enzyme preparations and widely used in livestock and poultry farming. However, these enzymes still have shortcomings such as low catalytic activity on complex substrates, leading to increased farming costs, necessitating further exploration of enzyme genes with superior properties.

[0004] Cellulosomes are extracellular multi-enzyme complexes primarily produced by anaerobic bacteria. They can be used for cell surface display and enzyme immobilization, serving as supramolecular machines for lignocellulose degradation. Cellulosomes are mainly composed of catalytic and non-catalytic subunits. The catalytic subunits consist of various types of enzymes (primarily glycoside hydrolases), while the non-catalytic subunits are scaffold proteins with no catalytic activity; therefore, they are often referred to as scaffold proteins or support proteins. Artificially constructing cellulosomes and combining them with microbial surface display technology allows enzyme complexes to be immobilized on the cell surface, forming whole-cell catalysts. This eliminates enzyme purification steps, reduces costs, and improves reusability.

[0005] Escherichia coli is a preferred host for synthetic biology and enzyme industry due to its clear genetic background, simple culture, rapid growth, and mature protein expression system. Its natural Curli secretion system can achieve efficient display and self-assembly of exogenous proteins on the outer membrane via the CsgA structural protein, providing an ideal pathway for site-specific anchoring of fibrosomes on the cell surface. However, existing fibrosome surface display technologies still have significant drawbacks, such as endogenous CsgA interference with assembly, low in vitro assembly efficiency, insufficient host expression intensity, weak enzyme synergy, lack of modular validation systems, and complex and costly processes, making them difficult to adapt to the needs of industrial biomass conversion. Summary of the Invention

[0006] The technical problem to be solved by this invention is: to address the technical problems of existing cellulose surface display technologies, such as endogenous protein interference, low assembly efficiency, weak enzyme synergy, inability to achieve fine decomposition and complete degradation of lignocellulose, and complex and costly processes, by providing a fusion protein for display on the surface of Escherichia coli and its construction and application method.

[0007] The technical solution of the present invention is: an enzyme synergistic surface display fusion protein, which contains at least three functional proteins: CsgA anchoring protein, endo-β-1,4-xylanase and GH5 family bifunctional glucanase IDSGLUC5-28.

[0008] Furthermore, the amino acid sequence of the CsgA anchoring protein is shown in SEQ ID No. 3; the amino acid sequence of IDSGLUC5-28 is shown in SEQ ID No. 2.

[0009] Furthermore, the endo-β-1,4-xylanase is IDSXYN10-1, and its mature peptide amino acid sequence is shown in SEQ ID No. 1.

[0010] Furthermore, the fusion protein also contains a linker and a tag sequence.

[0011] Furthermore, the amino acid sequence of the fusion protein is shown in SEQ ID No. 4.

[0012] The gene encoding the fusion protein described above, preferably, has the nucleotide sequence shown in SEQ ID No. 5.

[0013] Expression vectors containing the genes described above.

[0014] Engineered bacteria expressing the fusion protein described above.

[0015] Furthermore, the engineered bacteria used Escherichia coli BL21(DE3) with the endogenous CsgA gene knocked out as the host bacterium and was transformed with the expression vector described above.

[0016] The application of the engineered bacteria described above in the degradation of lignocellulose.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] This invention achieves precise deconstruction and complete degradation of lignocellulose through technological innovations such as CRISPR-Cas9 genome editing, modular cellulose body design, and whole-cell in-situ catalysis. Compared with existing technologies, it has the following core beneficial effects:

[0019] 1. For the first time, the endogenous CsgA gene in Escherichia coli was precisely knocked out using CRISPR-Cas9 technology to construct a chassis bacterium BL21(DE3)ΔCsgA without endogenous interference. This eliminated the interference of endogenous CsgA on the assembly and display of artificial fibrillosomes at the genomic level, which greatly improved the display efficiency and structural uniformity of fibrillosomes. This chassis bacterium modification method has significant novelty and provides a new chassis modification idea for microbial surface display technology.

[0020] 2. The artificial cellulosome integrates xylanase IDSXYN10-1 and bifunctional dextranase IDSGLUC5-28, both of which possess independent catalytic activity and substrate specificity: IDSGLUC5-28 has both endonuclease and exonuclease functions, and can independently and efficiently degrade dextran substrates. Thin-layer chromatography and liquid chromatography detection results provide complete data for its independent patent application; IDSXYN10-1 is the core enzyme for hemicellulose degradation, and can independently degrade xylan substrates. The two work together to achieve synchronous and precise degradation of cellulose and hemicellulose, breaking through the catalytic bottleneck of traditional single enzymes or simple combinations.

[0021] 3. By designing a modular carrier, we introduced the anchoring protein CsgA, dual protease cleavage sites, and the V5 detection tag to achieve efficient self-assembly and directional display of fibrinosomes on the surface of E. coli cells. We established a multi-dimensional verification system using immunofluorescence, Western blotting, and enzyme profiling analysis to accurately detect the assembly conformation and arrangement of fibrinosomes, ensuring their structural stability and catalytic activity.

[0022] 4. The expression is induced at a low temperature of 16℃, eliminating the need for cell disruption and protein purification. The complete engineered bacteria are used directly as whole-cell catalysts, simplifying the process, shortening the production cycle, and significantly reducing enzyme preparation and post-processing costs. The engineered bacteria are easy to cultivate, grow rapidly, and have strong mass production capacity, which better meets the actual needs of industrial biomass conversion.

[0023] 5. Engineered bacteria can break through the dense anti-degradation barrier of natural lignocellulose, achieving fine decomposition and complete degradation of natural substrates such as corn, rice, and peanut straw. The catalytic products are mainly functional fiber oligosaccharides and xylooligosaccharides with a degree of polymerization of 3-4. The products are well-defined and have high purity, and can be directly used for the elimination of anti-nutritional factors in feed, the preparation of functional food additives, and the high-value utilization of biorefining. It has a wide range of applications and high economic value. Attached Figure Description

[0024] Figure 1 IDSGLUC5-28 Enzymatic Properties (A: Optimal Temperature; B: Temperature Tolerance; C: Optimal pH; D: pH Tolerance).

[0025] Figure 2 IDSGLUC5-28 analysis of protein hydrolysates (AB: IDSGLUC5-28-catalyzed β-glucan and lichen polysaccharide thin-layer chromatography; CD: IDSGLUC5-28-catalyzed β-glucan and lichen polysaccharide liquid chromatography).

[0026] Figure 3 Colony PCR validation of endogenous CsgA gene knockout in Escherichia coli BL21(DE3) (1-8: different transformants; 9: negative control).

[0027] Figure 4 PCR verification of recombinant vectors pET28a-CsgA-IDSXYN10-1 and pET28a-CsgA-IDSXYN10-1-IDSGLUC5-28 was performed using T7 primers. The target bands matched the theoretical molecular weights, proving that both recombinant vectors were correctly constructed (A: T7 primer verification of pET28a-CsgA-IDSXYN10-1; B: T7 primer verification of pET28a-CsgA-IDSXYN10-1-IDSGLUC5-28; M: Marker; 1-8: Different transformants; 9: Negative control; 1-16: Different transformants).

[0028] Figure 5 Immunofluorescence assays of artificial fibrils on the surface of Escherichia coli confirmed that the fibrils were successfully displayed on the cell surface.

[0029] Figure 6Western-Blot and enzyme spectrum analysis of artificial fibrils (A: Simplified diagram of artificial fibrils on the surface of E. coli cells; B: Western-Blot detection of artificial fibril conformation; C: Barley β-glucan enzyme spectrum detection of artificial fibril conformation; D: Xylan enzyme spectrum detection of artificial fibril conformation; M: Marker; 1: Cell surface membrane proteins; 2: Enterokinase cleavage of cell surface membrane proteins; 3: Thrombin cleavage of cell surface membrane proteins; 4: Enterokinase-thrombin double cleavage of cell surface membrane proteins).

[0030] Figure 7 Thin-layer chromatography (TLC) analysis of whole-cell catalytic hydrolysis products (AC: barley β-glucan, lichen polysaccharide and xylan TLC; DF: peanut, rice and corn straw TLC; G1: glucose; G2: cellobiose; G3: cellotriose; G4: cellotetraose; G5: cellopentaose; X1: xylose; X2: xylobiose; X3: xylotriose; X4: xylotetraose; X5: xylopentaose).

[0031] Figure 8 Quantitative detection of reducing sugar formation from natural straw substrates by whole-cell catalysis (DNS method).

[0032] Figure 9 Comparison of scanning electron microscopy (SEM) images of natural straw before and after degradation.

[0033] Figure 10 The plasmid map constructed for this invention. Detailed Implementation

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from commercial sources.

[0035] I. Functional Study of a Novel Bifunctional Glucanase IDSGLUC5-28

[0036] Our research group previously obtained a large number of candidate genes for carbohydrate-active enzymes from rumen microbes of sheep in Huzhou, and then obtained a GH5 family glucanase gene IDSGLUC5-28 (CDS sequence shown in SEQ ID No. 6, and the amino acid sequence of the encoded protein shown in SEQ ID No. 2). We then used an E. coli expression system to obtain the recombinant target protein.

[0037] 1. Study on the properties of enzymes

[0038] 20 μL (approximately 1 μg protein) of enzyme solution was thoroughly mixed with 50 μL of 0.5% barley β-glucan substrate, and reacted at 20-80℃ for 15 min. After the reaction, 70 μL of DNS solution was added and incubated at 95℃ for 10 min. After cooling to room temperature, the OD was measured using a microplate reader. 540 Four parallel experiments were conducted, with 20 μL of inactivated enzyme solution added to the control group while maintaining all other conditions. The temperature at which the highest activity was achieved was taken as 100%, and the relative activity at different temperatures was calculated. After incubating the enzyme solution at 30, 40, and 50 °C for 5, 10, 15, 20, 30, and 60 min respectively, 20 μL of the enzyme solution was thoroughly mixed with 50 μL of 0.5% dextran substrate at the optimal pH, and the mixture was reacted at the optimal temperature for 15 min. The catalytic activity was then measured. The residual activity at each temperature was calculated, with the activity of the untreated enzyme taken as 100%.

[0039] 20 μL of enzyme solution was thoroughly mixed with 50 μL of 0.5% barley β-glucan substrate prepared in pH 2.2–10.0 buffers (citric acid / phosphate buffer pH 2.2–8.0; Tris-HCl buffer pH 8.0–9.0; sodium carbonate / sodium bicarbonate buffer pH 9.0–10.0), and the mixture was reacted at the optimum temperature for 15 min to determine catalytic activity. The pH at which the highest activity was achieved was taken as 100% to calculate the relative activity at different pH values. The enzyme solution was mixed with buffers at a 1:1 ratio with pH 2.2–10.0, and incubated on ice for 60 min. Then, 20 μL of enzyme solution was thoroughly mixed with 50 μL of 0.5% dextran substrate at the optimum pH, and the mixture was reacted at the optimum temperature for 15 min to determine catalytic activity. The residual activity at each pH value was calculated with the enzyme activity without pH buffer treatment as 100%.

[0040] The results show that ( Figure 1The optimal temperature for IDSGLUC5-28 is 40℃, and its catalytic activity is >60% within the range of 20-50℃. However, its catalytic activity decreases rapidly at 60℃, and it completely loses its catalytic activity at 80℃. Thermal stability shows that it is relatively stable at 40℃, and its activity remains essentially unchanged after 1 hour of treatment. At 50℃, it retains >80% catalytic activity after 5-15 minutes of treatment, but its activity decreases rapidly with further treatment. After 60 minutes of treatment, its catalytic activity is approximately 40%, and the rate of activity loss is even faster at 60℃, with approximately 20% activity after 60 minutes. The optimal pH for IDSGLUC5-28 is pH=5.0, and its catalytic activity is >80% at pH 4.0-7.0. pH tolerance shows that it maintains high catalytic activity at pH 4.0-9.0, with residual activity >60% after 1 hour of treatment. In conclusion, IDSGLUC5-28 is a weakly acidic mesophilic enzyme.

[0041] 2. Study on hydrolysis model

[0042] Using barley β-glucan and lichen polysaccharide as substrates, 2 mL of enzyme solution (containing 16.8 μg protein) was added to 5 mL of substrate. The reaction was carried out at 37 °C. Samples of 600 μL were collected into centrifuge tubes at intervals of 0, 5, 10, 15, 30 min, 1, 3, 6, 12, 24, and 48 h, and the reaction was terminated by treatment at 95 °C for 10 min. The supernatant was collected at 4 °C and 10000×g for substrate hydrolysis analysis. Three parallel experiments were set up.

[0043] Thin-layer chromatography (TLC) was used for preliminary analysis of the hydrolysis products of IDSGLUC5-28. 0.7 μL of the reaction product and a 0.5 mg / mL standard mixture of glucose (G1), cellobiose (G2), cellotriose (G3), cellotetraose (G4), and cellopentaose (G5) were spotted onto a glass TLC plate. The reaction product was sampled 12 times, and the standard mixture was sampled 6 times. The mobile phase was n-butanol:acetic acid:water (5:2:3, v / v). After thorough development (approximately 3 h), the plate was removed and placed in a fume hood for complete drying. Then, a colorimetric reagent (sulfuric acid:ethanol = 5:95, v / v) was evenly sprayed onto the plate. After drying, the plate was developed at 105 °C for 10 min, and photographs were taken to record the results.

[0044] The hydrolysis products of IDSGLUC5-28 were further analyzed by high-performance liquid chromatography (HPLC). An Asahipak NH2P-504E column (Shodex) and an LC-1200 HPLC system (Agilent) were used. The mobile phase was 65% acetonitrile, the column temperature was 40℃, the flow rate was 1.0 mL / min, and a RID-20A differential refractive index detector was used to analyze the hydrolyzed substrate samples.

[0045] The results show that ( Figure 2 In the initial stage (0-30 min), IDSGLUC5-28 catalyzed the formation of highly polymerized hydrolysates and small amounts of G3-G5 from barley β-glucan. With continued catalysis, the highly polymerized products were gradually degraded, leading to a significant accumulation of G3-G5 and the detection of G2. After 1 h of reaction, the highly polymerized products were fully degraded, resulting in the accumulation of G2-G4 and the detection of G1. With further reaction, the G3 content initially increased and then decreased, while the contents of G2 and G1 continuously increased. The hydrolysis process of moss and lichen polysaccharides by IDSGLUC5-28 was similar to that of barley β-glucan, generally showing an initial increase and then decrease in G3 content, while the contents of G2 and G1 continuously increased, with G1-G4 being the main products.

[0046] II. Construction of Artificial Fibrioplast Engineered Bacteria Host

[0047] 1. Construction of CRISPR-Cas9 genome editing plasmids

[0048] The pEcgRNA plasmid was digested with the restriction endonuclease Bsa I to generate linearized pEcgRNA with 5′-TAGT-3′ and 5′-AAAC-3′ overhangs. After digestion, the linearized pEcgRNA was purified and recovered using a DNA product purification kit. The linearized pEcgRNA could be used immediately or temporarily stored at −20℃. The N20 site of CsgA in BL21(DE3) (nucleotide sequence as shown in SEQ ID No. 7, amino acid sequence encoding the protein as shown in SEQ ID No. 3) was predicted using the website (http: / / chopchop.cbu.uib.no / ) (which affects gene editing efficiency), and primers were designed based on the site with the highest success rate (Table 1). Mutation at the N20 site: The N20 site was mutated by PCR amplification using the linearized pEcgRNA as a template and N20(CsgA)_F and N20(CsgA)_R as upstream and downstream primers. After mutation, the product was detected, purified, and heat-shocked into DH5α.

[0049] Selection and cloning of Donor DNA: The upstream and downstream 500 bp segments of the CsgA gene in the E. coil BL21(DE3) genome were selected as Donor DNA. Primers were designed to amplify CsgA-up and CsgA-down, respectively. The downstream primer for CsgA-up contained a portion of the CsgA-down sequence, and the upstream primer for CsgA-down contained a portion of the CsgA-up sequence. CsgA-up was amplified using CsgA-up_F and CsgA-up_R, and CsgA-down was amplified using CsgA-down_F and CsgA-down_R. Subsequently, using CsgA-up and CsgA-down as templates, and CsgA-up_F and CsgA-down_R as primers, CsgA-ud was amplified and obtained as Donor DNA.

[0050] Primer Sequence (5' to 3') N20 (CsgA)_F TTCTCCGGTAGCGCTCTGGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAA N20 (CsgA)_R CAGAGCGCTACCGGAGAAAACTAGTATTATACCTAGGACTGAGCTAGCTG CsgA-up_F CAACATGAAAAAACAAATTGTTATTTATGATGT CsgA-up_R ACAAATGATGTAGTAAAACCCCCATCGGA CsgA-down_F TGGGGGTTTTACTACATCATTTGTATTACAGAAACAGGG CsgA-down_R CCTCAATGATTAGTCATCCTTG T-CsgA_F ATACTTTCCATCGTAACGCAGCG T-CsgA_R ACGCCCCCTTGCACGGTG IDSXYN10-1_F GGTGGTGGTGGTTCTGAATTCTGCAAGGCCGGCACACCG IDSXYN10-1_R TCGTCGTCGCATGCTGCGGCCGCGGGCTCGATCTTTGAAGGATC IDSGLUC5-28_F GGTGGTGGTGGTTCTGTCGACATGAAAAAAACATTTACTTCACTTAGAAAA IDSGLUC5-28_R AGAACCACCACCACCAAGCTTTTTCAAAATTAACTTTATTATGTTTATTCCTAA

[0051] 2. CRISPR-Cas9 genome editing to knock out CsgA

[0052] (1) Preparation of electrocompetent states

[0053] The pECpCas plasmid was transformed into BL21(DE3) via heat shock and plated on LB agar plates containing Kan resistance. The plates were incubated overnight at 37°C. Single colonies were picked from the plates and inoculated into 10 mL of LB medium containing 50 μg / mL Kan and a final concentration of 10 mM arabinose. The culture was incubated at 37°C and 180 rpm for 12 h. BL21(DE3) / pEcpCas was then transferred at a 1% inoculum to LB medium containing 50 μg / mL Kan and a final concentration of 10 mM arabinose. The culture was incubated at 37°C and 180 rpm until the OD600 reached 0.6–0.8, then pre-chilled on ice. The pre-chilled culture was transferred to pre-chilled centrifuge tubes and centrifuged at 4000 rpm and 4°C for 8 min. The supernatant was discarded. 30 mL of pre-chilled sterile water was added, and the cells were resuspended thoroughly in an ice-water bath. The resuspended culture was centrifuged at 4500 rpm and 4°C for 8 min. The supernatant was discarded. This process was repeated once. Add approximately 25 mL of pre-chilled 10% glycerol and resuspend the cells in an ice-water bath. Centrifuge the resuspended bacterial solution at 4500 rpm and 4 °C for 10 min, and discard the supernatant. Add 1 mL of pre-chilled 10% glycerol to a centrifuge tube, resuspend the cells in ice water, and aliquot 100 μL of the bacterial solution into pre-chilled 1.5 mL sterile EP tubes to obtain E. coil BL21(DE3) electrocompetent cells containing the pEcpCas plasmid. Store at -80 °C.

[0054] (2) CRISPR-Cas9 genome editing process

[0055] Remove the electroporation competent cells from the -80℃ freezer and thaw them on ice. Remove the electroporation cuvette from anhydrous ethanol and place it in a laminar flow hood to evaporate residual alcohol. Add 3 µL of pEcgRNA-N20 (CsgA) plasmid and 300 ng CsgA-ud to the electroporation competent cells in the laminar flow hood and gently mix with a pipette tip. Pre-cool the electroporation cuvette on ice. Transfer the mixed competent cells to the electroporation cuvette using a pipette, remove the cuvette, wipe off any moisture, and insert it into the electroporator's groove. Perform electroporation at 1800V. After electroporation, quickly add 1 mL of LB medium to the cuvette, gently mix, and then transfer the entire mixture to a 1.5 mL sterile EP tube. Incubate at 37℃ and 220 rpm for 1 h. Centrifuge at 6000 rpm for 1 min to enrich bacterial cells. Collect 800 µL of the supernatant and resuspend the cells thoroughly in the remaining medium. Spread 100 µL of the resuspended cells onto LB agar containing Kan and Spe antibodies and incubate at 37°C for 18–20 h. Design a pair of validation primers 50 bp outside the homologous arms of the target gene. Pick clones for colony PCR detection. Determine successful knockout based on the size of the bands on nucleic acid electrophoresis. Subsequent sequencing is performed by bioengineering.

[0056] The results showed that a 2097 bp linearized pEcgRNA was obtained by digesting the pEcpCas plasmid with the restriction endonuclease Bsa I. Using the linearized pEcgRNA as a template, the linearized PCR product pEcgRNA-N20(CsgA) was amplified using primers N20(CsgA)_F / N20(CsgA)_R. Nucleic acid electrophoresis showed that the band was above 2000 bp, which was consistent with the expected size, indicating that the N20 sequence was successfully introduced into the linearized PCR product pEcgRNA. Subsequently, the purified pEcgRNA-N20(CsgA) was transformed into E. coil DH5α by heat shock transformation. The linear fragment self-circulated in DH5α competent cells after heat shock transformation, resulting in the plasmid pEcgRNA-N20(CsgA).

[0057] Using E. coil BL21(DE3) genomic DNA as a template, a 500 bp upstream homologous arm was amplified using CsgAup_F / CsgAup_R, and a 500 bp downstream homologous arm was amplified using CsgAdown_F / CsgAdown_R. Further overlap PCR amplification was performed using the upstream and downstream homologous arms as templates to obtain a 1000 bp Donor DNA-ΔCsgA.

[0058] Plasmids pEcgRNA-N20 (CsgA) and Donor DNA-ΔCsgA were transformed into BL21(DE3) / pEcpCas via electroporation. Single colonies were validated by colony PCR using primers CsgAup50_F and CsgAdown50_R; the band size was approximately 1200 bp. Figure 3 The result indicates that the positive strain BL21(DE3)(ΔCsgA) was successfully screened.

[0059] 3. CRISPR-Cas9 genome editing plasmid elimination

[0060] (1) pEcgRNA plasmid elimination

[0061] BL21(DE3) (ΔCsgA) bacteria containing pEcgRNA and pEcpCas plasmid were streaked onto LB agar containing Kan and incubated overnight at 37°C. Colonies that grew overnight at 37°C were randomly selected, dissolved thoroughly in 10 µL ddH2O, and then streaked onto LB agar containing Kan and Spe resistance, and incubated at 37°C for 18–20 h. Colonies that grew on LB agar containing Kan but not on LB agar containing Kan and Spe resistance were considered colonies with successfully eliminated pEcgRNA plasmids.

[0062] (2) pEcpCas plasmid elimination

[0063] Colonies that eliminated the pEcgRNA plasmid were inoculated into LB medley medium containing 5 g / L glucose and incubated overnight at 37°C and 220 rpm. After overnight incubation, they were streaked onto LB solid medium containing 5 g / L glucose and 10 g / L sucrose and incubated overnight at 37°C. Then, colonies that grew overnight at 37°C were randomly selected, dissolved thoroughly in 10 µL ddH2O, and streaked onto LB solid medium containing Kan and ordinary LB solid medium, respectively, and incubated overnight at 37°C. Colonies that grew on ordinary LB solid medium but did not grow on LB solid medium containing Kan were considered colonies that successfully eliminated the pEcpCas plasmid.

[0064] III. Construction of Recombinant Expression Vectors

[0065] 1. Construction of pET28a-CsgA-IDSXYN10-1

[0066] Using pET28a-IDSGLUC5-28 and pET30a-IDSXYN10-1 as templates, PCR amplification was performed using Phanta Max Super-Fidelity DNA Polymerase and gene primers. The PCR products were then detected after the reaction. pET28a-CsgA, previously constructed in our laboratory, was double-digested with restriction endonucleases EcoRI and NotI, and then detected.

[0067] The target gene IDSXYN10-1 (nucleotide sequence as shown in SEQ ID No. 8, amino acid sequence encoding the protein as shown in SEQ ID No. 1) was ligated with double-digested pET28a-CsgA using a homologous recombination cloning kit. Immediately after homologous recombination, the ligation product was transformed into E. coil DH5a by heat shock for screening and identification of positive clones. The correct strain was DH5a / pET28a-CsgA-IDSXYN10-1 (…). Figure 4 (A)

[0068] 2. Construction of pET28a-CsgA-IDSXYN10-1-IDSGLUC5-28

[0069] The plasmid pET28a-CsgA-IDSXYN10-1 was extracted using a plasmid miniprep kit. The plasmid was double-digested with restriction endonucleases Sal I and Hind III, followed by electrophoresis. The target gene IDSGLUC5-28 was ligated into the double-digested pET28a-CsgA-IDSXYN10-1 using a homologous recombination cloning kit. Immediately after homologous recombination, the ligation product was heat-shocked into E. coil DH5a for positive clone screening and identification. The correct strain was identified as DH5a / pET28a-CsgA-IDSXYN10-1-IDSGLUC5-28. Figure 4 (B)

[0070] IV. Construction and Conformation Verification of Engineered Bacteria for Displaying Escherichia coli on Cell Surface

[0071] 1. Formation of fibrosomes on the surface of E. coli cells

[0072] After obtaining the recombinant plasmid pET28a-CsgA-IDSXYN10-1-IDSGLUC5-28, it was transformed into BL21(DE3)(△CsgA), inoculated into LB liquid medium containing Kan, and further induced protein expression to assemble fibrosomes onto the surface of Escherichia coli cells.

[0073] 2. Immunofluorescence detection of cell surface features

[0074] Cell smears were added to 24-well plates. 500 µL of diluted bacterial culture (OD600=1.0) with PBS buffer was added to each well. BL21(DE3) (ΔCsgA) was used as a negative control. 500 µL of 4% paraformaldehyde solution was added to each well, and the plates were fixed at room temperature for 30 min. After fixation, the liquid in the 24-well plates was discarded, and 500 µL of PBS buffer was added. The plates were washed at 100 rpm for 5 min, repeated three times. 600 µL of 5% BSA solution was added to each well, and the plates were blocked at room temperature for 30 min. After blocking, the 5% BSA solution was discarded, and 200 µL of 5% BSA solution containing the primary antibody Anti-V5 Tag mouse monoclonal antibody (1:500 dilution) was added. The plates were incubated overnight at 4°C. After primary antibody incubation, the plates were washed three times with PBS solution for 10 min each time. After rinsing, add 200 µL of 5% BSA solution (1:500 dilution) containing FITC-conjugated Rabbit anti-mouse IgG secondary antibody, and incubate on a horizontal shaker at room temperature in the dark for 1 h. After secondary antibody incubation, rinse three times with PBS solution for 10 min each time. Finally, rinse with sterile ddH2O for 10 min to remove the PBS solution, fix the cell smears onto a glass slide, and observe under a fluorescence microscope.

[0075] The results show that ( Figure 5 The negative control BL21(DE3)(ΔCsgA) and the experimental group BL21(DE3)(ΔCsgA) / pET28a-CsgA-IDSXYN10-1-IDSGLUC5-28 showed basically similar results in the bright field. However, in the dark field, no fluorescence signal was detected in BL21(DE3)(ΔCsgA), while BL21(DE3)(ΔCsgA) / pET28a-CsgA-IDSXYN10-1-IDSGLUC5-28 showed a strong fluorescence signal, indicating that the induced BL21(DE3)(ΔCsgA) / pET28a-CsgA-IDSXYN10-1-IDSGLUC5-28 was successfully displayed on the cell surface.

[0076] 3. Extraction of Escherichia coli cell surface membrane proteins

[0077] Collect 200 mg of wet bacterial cells in a 1.5 mL EP tube. Wash the cells twice with pre-chilled PBS, centrifuging at 1000×g for 5 min each time at 4°C. Discard the supernatant. Add 1 mL of Lysis Buffer, 1 µL of protease inhibitor, and 1 µL of 1M DTT to the 1.5 mL EP tube. Vortex for 30 s, place on ice for 1 min, and repeat 5 times to lyse the cells. Centrifuge the lysed bacterial suspension at 14000×g for 10 min at 4°C, and discard the supernatant. Add 200 µL of pre-chilled extraction buffer to the pellet, vortex for 30 sec, place on ice for 5 min, and repeat 5 times. After the 5-minute centrifugation, centrifuge the 1.5 mL EP tube at 14000×g for 10 min at 4°C. Carefully transfer the supernatant to a new 1.5 mL EP tube using a pipette. The supernatant is the membrane protein.

[0078] 4. Verification of membrane protein conformation

[0079] (1) Western-Blot verification

[0080] 200 µL of membrane protein was digested with 2U enterokinase / thrombin / enterokinase and thrombin at 25°C for 24 h. Undigested membrane protein served as a control. The enzyme-digested membrane protein was mixed with 5× protein loading buffer and incubated at room temperature for 30 min before SDS-PAGE gel electrophoresis. After carefully peeling off the protein gel, the upper stacking gel and the bottom bromophenol blue band were removed. A PVDF membrane slightly larger than the protein gel was cut, immersed in methanol for 15 s, then placed in dd H2O for 1 min, and finally placed in transfer buffer. Two thick filter papers, slightly larger than the protein gel but smaller than the PVDF membrane, were selected and placed in transfer buffer. On a transfer plate, the filter paper, protein gel, PVDF membrane, and another thick filter paper were arranged in the order of "black gel, white membrane" and "sandwich". The entire transfer system was placed on ice, with a constant voltage of 80V and a transfer time of 90 min. After transfer, remove the PVDF membrane and rinse it in PBST solution for 5 min each time, washing 3 times. Add 20 mL of 5% skim milk powder (prepared with PBST solution) and block overnight at 4°C. After blocking, add 10 mL of 5% skim milk powder PBST solution (1:2000 dilution) containing the primary antibody Anti-V5 Tag mousemonoclonal antibody and incubate overnight at 4°C on a horizontal shaker. After primary antibody incubation, rinse 3 times with TBST solution for 5 min each time. After rinsing, add 10 mL of 5% skim milk powder PBST solution (1:5000 dilution) containing the secondary antibody HRP-conjugated Goat Anti-Mouse IgG and incubate at room temperature for 1 h on a horizontal shaker. After secondary antibody incubation, rinse 3 times with TBST solution for 5 min each time. Stain the PVDF membrane with the enhanced HRP-DAB staining kit at room temperature for 5-15 min after incubation and observe by photography.

[0081] (2) Enzyme spectrum verification

[0082] Enzyme profiling analysis involved adding polysaccharide substrates (β-glucan and xylan) to an SDS-PAGE gel at a final concentration of 1%. Membrane proteins digested with proteases were mixed with 5× protein loading buffer (non-denaturing) and directly used for electrophoresis at a constant voltage of 120V for 2 hours. After electrophoresis, the protein gel was removed and annealed three times in 25% isopropanol for 15 minutes each time. The gel was then completely immersed in PBS buffer and rinsed overnight at 4°C. Staining was performed with 0.1% Congo red for 30 minutes. After staining, the gel was rinsed with 0.5 mol / L NaCl for 15 minutes each time until clear bands appeared, and then photographed for observation.

[0083] The results show that ( Figure 6The fusion protein, from N-terminus to C-terminus, consists of a CsgA anchoring domain (15.1 kDa), a thrombin cleavage site, IDSXYN10-1 (47.4 kDa), an enterokinase cleavage site, IDSGLUC5-28 (54.3 kDa), and a V5 tag. The theoretical molecular weight of the full-length fusion protein is 131.3 kDa. The theoretical truncated molecular weights for different cleavage sites are also indicated: the theoretical molecular weight after thrombin cleavage is 110.9 kDa, and the theoretical molecular weight of IDSGLUC5-28+V5 after enterokinase cleavage is 59.5 kDa. Figure 6 (A)

[0084] Western-Blot analysis of membrane protein molecular weight before and after cleavage ( Figure 6 Lane B), lane 1 shows undigested cell surface membrane proteins, with three specific bands: >130 kDa, 95-130 kDa, and ~55 kDa. The >130 kDa band corresponds to the full-length fusion protein (theoretical 131.3 kDa). Lane 2 is an enterokinase-digested sample, with one band consistent with the one in lane 1, and the other above 55 kDa, corresponding to the theoretical molecular weight of IDSGLUC5-28+V5 Ta (59.5 kDa). Lane 3 is a thrombin-digested sample, also showing two bands: the upper band corresponds to the 95-130 kDa truncated band in lane 1, corresponding to the theoretical molecular weight of XYN-IDSGLUC5-28-V5 Tag (110.9 kDa) after thrombin digestion; the lower band corresponds to the ~55 kDa band in lane 1. The kDa bands are in the same position; lane 4 is a sample digested with enterokinase and thrombin, and three bands are visible: the upper band is in the same position as the 95-130 kDa band in lane 1 and the upper band in lane 3, and the two lower bands are in the same position as the two bands in lane 2, which proves that the enzyme site is highly specific and the fusion protein conformation is correct.

[0085] The results of the barley β-glucan zymography showed that ( Figure 6 In the first two lanes (C and C), lane 1 represents uncleaved membrane proteins. The uncleaved sample shows multiple active bands at the top, with a single, clear active band visible in the middle. Lane 2 represents enterokinase-cleaved membrane proteins. After enterokinase cleavage, the active band at the top shifts upwards, consistent with the decreasing molecular weight trend after cleavage. Lane 3 represents thrombin-cleaved membrane proteins. After thrombin cleavage, the top band shifts further upwards, and the band distribution differs significantly from the first two groups, consistent with the characteristic that the cleavage site is closer to the N-terminus. Lane 4 represents membrane proteins cleaved by both enterokinase and thrombin. After double cleavage, the active band at the top matches the lowest position among the single enterokinase and thrombin cleavage bands, and the cleavage product bands are consistent with expectations.

[0086] Xylan zymography results showed that ( Figure 6In the first lane (D), lane 1 represents uncut membrane proteins, showing two bands; lane 2 represents enterokinase-cleaved membrane proteins, where the active bands shifted significantly downwards after enterokinase cleavage, and the molecular weight changed markedly; lane 3 represents thrombin-cleaved membrane proteins, where two active bands also appeared after thrombin cleavage, positioned lower than the uncut group but higher than the enterokinase-cleaved group, consistent with the molecular weight differences of fragments produced by different cleavage sites; lane 4 represents membrane proteins cleaved by both enterokinase and thrombin, where the position of the active bands after double cleavage was basically consistent with that after single enterokinase cleavage, further verifying that the cleavage sites functioned normally, thus confirming that the fibrinosome conformation displayed on the surface of E. coli cells was correct.

[0087] V. Standard and natural substrates for whole-cell catalysis of engineered bacteria on the surface of E. coli cells

[0088] 1. Standard substrate catalysis

[0089] The engineered strain BL21(DE3)(ΔcsgA) / pET28a-CsgA-IDSXYN10-1-IDSGLUC5-28, used to display on the surface of *E. coli* cells, was diluted to OD600=1.0 using PBS buffer. 5 mL of each of the 0.5% natural substrates (barley β-glucan, Icelandic moss lichen, and xylan) were mixed with 2 mL of the above bacterial suspension. 500 μL samples were collected at 0, 10, and 30 min and at 1, 3, 6, 12, 24, 48, 60, and 72 h in centrifuge tubes, and the reaction was terminated by incubation at 95 °C for 10 min. After centrifugation at 12000 rpm for 10 min at 4 °C, the supernatant was used for substrate hydrolysis analysis, and four parallel experiments were set up.

[0090] 2. Catalysis by natural straw substrate

[0091] Natural substrates, including corn stalks, rice stalks, and peanut stalks, were ground, sieved through a 20-mesh sieve, dried, and then soaked in 2% NaOH for 72 h. The samples were repeatedly washed with ddH2O to adjust the pH to 7.0 and dried again. The treated substrates were used for DNS determination to verify the complete removal of residual reducing sugars. 2 g of pretreated corn stalks were mixed with 10 mL of the above bacterial solution. Samples of 500 μL were collected at intervals of 0, 1, 2, 3, 4, 6, 8, 10, 12, 24, and 48 h and centrifuged in centrifuge tubes. The reaction was terminated by treatment at 95 ℃ for 10 min. After centrifugation at 4 ℃ and 12000 rpm for 10 min, the supernatant was used for substrate hydrolysis analysis, with three parallel experiments. Thin-layer chromatography was used to analyze the whole-cell catalytic standard substrates and hydrolysis products of natural substrates from engineered bacteria. Meanwhile, the insoluble residues remaining after enzymatic hydrolysis of natural substrates were dried and analyzed by scanning electron microscopy (SEM) using a Zeiss (Oberkoche, Germany) GEMIN 560 instrument with the following parameters: accelerating voltage (EHT) = 3.0 kV, working distance (WD) = 11.5 mm, magnification = 700x, and signal A = SE2.

[0092] The results showed that thin-layer chromatography catalyzes the natural substrate exposure (…). Figure 7 Whole-cell catalysis of corn straw showed almost no hydrolysis products observed from 0-2 h, a small amount of DP4 oligosaccharides were observed at 3 h, and the DP4 oligosaccharide content rapidly increased with continued catalysis, with the final product being DP3-4 oligosaccharides. Whole-cell catalysis of rice straw showed a slightly lower reaction intensity compared to corn straw, with a small amount of DP4 oligosaccharides observed only at 4 h, reaching a peak content at 10 h, but almost no DP4 oligosaccharides were observed at 24 h and 48 h. Whole-cell catalysis of peanut straw showed similar catalytic results to corn straw, with the final product being DP3-4 oligosaccharides, the main difference being that corn straw had a higher DP3 oligosaccharide content. The DNS method was used to detect the reducing sugars of different natural substrates catalyzed by whole-cell catalysis. Figure 8 Using the DNS method to detect reducing sugars from different natural substrates catalyzed by whole cells, it was found that the reducing sugar production from peanut straw, rice straw, and corn straw exhibited a trend of first increasing, then decreasing, and finally remaining relatively constant. Peanut straw reached its peak at 3 h, with a reducing sugar concentration of 0.29 ± 0.01 mg / ml; corn straw reached its peak at 2 h, with a reducing sugar concentration of 0.11 ± 0.01 mg / ml; and rice straw reached its peak at 4 h, with a reducing sugar concentration of 0.09 ± 0.03 mg / ml. Scanning electron microscopy revealed... Figure 9After alkali treatment, the peanut straw, rice straw, and corn straw had relatively smooth surfaces, intact cell walls, and no obvious pores. After whole-cell catalysis by engineered bacteria that previously created E. coli to display artificial fibrous bodies, the surfaces all showed varying degrees of etching, depressions, and pore structures. The cell wall density was destroyed, and the fiber bundles showed signs of loosening and breakage. The originally smooth surfaces became rough and uneven.

[0093] The above-mentioned determination of reducing sugar content and morphological changes directly demonstrate that the engineered Escherichia coli strains displaying artificial fibrous bodies constructed in this study can effectively degrade the fiber structure of peanut straw, rice straw, and corn straw, thereby achieving a catalytic effect on natural straw substrates.

Claims

1. An enzyme-synergistic surface-displaying fusion protein, characterized in that, The fusion protein contains at least three functional proteins: a CsgA anchoring protein, an endoglucanase (β-1,4-xylanase), and a GH5 family bifunctional glucanase (IDSGLUC5-28).

2. The fusion protein according to claim 1, characterized in that, The amino acid sequence of the CsgA anchoring protein is shown in SEQ ID No. 3; the amino acid sequence of IDSGLUC5-28 is shown in SEQ ID No.

2.

3. The fusion protein according to claim 1, characterized in that, The endo-β-1,4-xylanase is IDSXYN10-1, and its amino acid sequence is shown in SEQ ID No.

1.

4. The fusion protein according to claim 1, characterized in that, The fusion protein also contains a linker and a tag sequence.

5. The fusion protein according to claim 1, characterized in that, The amino acid sequence of the fusion protein is shown in SEQ ID No.

4.

6. A gene encoding the fusion protein according to any one of claims 1-5.

7. An expression vector containing the gene of claim 6.

8. An engineered bacterium expressing the fusion protein according to any one of claims 1-5.

9. The engineered bacteria according to claim 8, characterized in that, The engineered bacteria used Escherichia coli BL21(DE3) with the endogenous CsgA gene knocked out as the host bacteria and were transformed with the expression vector described in claim 7.

10. The application of the engineered bacteria according to claim 9 in the degradation of lignocellulose.

Images