A high-temperature inducible promoter and use thereof
By constructing a high-temperature inducible promoter Picd and inducing the expression of alcohol dehydrogenase AdhP in recombinant strains, the problems of inhibited strain growth and reduced acid production caused by high temperature during acetic acid fermentation were solved, and efficient acetic acid production was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-09
- Publication Date
- 2026-06-05
AI Technical Summary
In traditional acetic acid fermentation, the high temperature environment inhibits the growth of bacterial strains, reduces the activity of alcohol dehydrogenase, decreases the acid production rate and acetic acid content, and limits the cooling efficiency of the fermentation process, thus increasing energy consumption.
A high-temperature inducible promoter, Picd, was developed, amplified by PCR, and ligated into the recombinant vector pBBR1MCS2. A recombinant strain was constructed to induce the expression of alcohol dehydrogenase AdhP under high-temperature conditions, thereby regulating gene expression to improve the strain's tolerance and acid production capacity.
At high temperatures, the recombinant strain increased acetic acid production by approximately 31.5%, maintained cellular metabolic balance and growth trend, and solved the problem of decreased acid production rate and yield in traditional acetic acid fermentation.
Smart Images

Figure CN122146699A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a high-temperature inducible promoter and its application, specifically to a promoter derived from *Acetobacter pasteurellii* (…). Acetobacter pasteurianus The high-temperature inducible promoter, recombinant expression vector containing the promoter, recombinant bacteria, and their applications belong to the fields of genetic engineering and fermentation engineering. Background Technology
[0002] Acetic acid fermentation is the core step in vinegar production, and *Acetobacter pasteurellium* is the main microorganism used in industrial vinegar production. However, acetic acid fermentation is a highly exothermic process, and the temperature inside the fermentation tank can rise rapidly as fermentation progresses. Traditional processes rely on turning the mash to maintain the temperature, but this not only increases energy consumption but also limits the cooling efficiency of turning the mash in high summer temperatures, leading to inhibited bacterial growth, decreased alcohol dehydrogenase activity, and consequently a significant reduction in the acid production rate and the final acetic acid content.
[0003] A promoter is a DNA sequence that can be specifically recognized and bound by RNA polymerase. Its function is to regulate the initiation time and expression intensity of downstream target genes. In genetic engineering, promoters are commonly classified into constitutive and inducible types. Although constitutive promoters have high expression intensity, they often lead to excessive accumulation of the target protein throughout the cell growth cycle. This not only increases the metabolic burden on the host bacteria but may also inhibit the normal growth of the strain due to premature accumulation of products or protein toxicity. In contrast, inducible promoters have greater flexibility and can precisely regulate gene expression according to specific culture conditions, thereby avoiding unnecessary energy waste and reducing the damage to cells caused by metabolic stress.
[0004] Utilizing inducible promoters to regulate the expression of key metabolic genes is an effective approach to addressing this problem. High-temperature inducible promoters can specifically initiate or enhance the transcription of downstream target genes (such as the alcohol dehydrogenase gene AdhP) when ambient temperatures rise, thereby compensating for the damage to enzyme activity caused by high temperatures and improving the strain's tolerance and acid production capacity under unstable high-temperature conditions. Currently, resources of heat-inducible promoters with high inducibility for *Acetobacter pasteurellis* remain scarce. Therefore, screening and identifying a promoter that can respond to high-temperature signals and has strong regulatory capabilities is of great significance for improving the high-temperature fermentation efficiency in the vinegar industry. Summary of the Invention
[0005] Objectives of the Invention: The first objective of this invention is to provide a high-temperature inducible promoter. The second objective is to provide a recombinant vector, expression cassette, transgenic cell line, or recombinant bacteria containing the aforementioned high-temperature inducible promoter. The third objective is to provide the application of the aforementioned recombinant bacteria in the fermentation production of acetic acid at high temperatures.
[0006] Technical solution: The high-temperature induced promoter of the present invention is a P icd Its nucleotide sequence is shown in SEQ ID NO.1.
[0007] The recombinant vector, expression cassette, transgenic cell line, or recombinant bacteria containing the above-mentioned high-temperature inducible promoter are described in this invention.
[0008] The recombinant expression vector of the present invention includes the high-temperature induced promoter described above.
[0009] The method for constructing the recombinant expression vector of the present invention includes the following steps: using *Acetobacter pasteurellium* (… Acetobacter pasteurianus Using the TCBRC 103 genome as a template, the high-temperature induced promoter sequence described in claim 1 was amplified by PCR and ligated into plasmid pBBR1MCS2 to obtain the high-temperature induced promoter expression vector pBBR1MCS2-icd.
[0010] Furthermore, the primer pair used for PCR amplification of the high-temperature induced promoter sequence was P. icd -F and P icd -R, the primer pair nucleotide sequences are shown in SEQ ID NO.3~4.
[0011] The high-acetic acid-producing recombinant bacteria of the present invention comprises the above-mentioned recombinant expression vector and alcohol dehydrogenase gene.
[0012] The method for preparing the recombinant bacteria of the present invention includes the following steps: (1) With *Acetobacter pasteurellii* ( Acetobacter pasteurianus Using the genome of TCBRC 103 as a template, the nucleotide sequence of alcohol dehydrogenase AdhP was amplified by PCR, and the nucleotide sequence of alcohol dehydrogenase AdhP was ligated into the recombinant expression vector described in claim 3 to obtain the recombinant plasmid pBBR1MCS2-icd-AdhP. (2) The recombinant plasmid pBBR1MCS2-icd-AdhP was transferred into the host cell to obtain a recombinant bacterium with high acetic acid production.
[0013] Further, the nucleotide sequence of the alcohol dehydrogenase AdhP described in step (1) is shown in SEQ ID NO.2.
[0014] Furthermore, the primer pair used for PCR amplification of the AdhP sequence in step (1) is AdhP-F and AdhP-R, and the nucleotide sequences of the amplification primers are shown in SEQ ID NO.5~6.
[0015] The present invention relates to the application of the high-yield recombinant acetic acid bacteria described above and the recombinant bacteria prepared by the above preparation method in the fermentation production of acetic acid at high temperature.
[0016] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: The high-temperature inducible promoter of this invention can regulate the downstream target gene alcohol dehydrogenase AdhP to induce high expression under high-temperature conditions. The high-yield recombinant acetic acid strain of this invention not only reduces the metabolic burden on cells and maintains a good growth trend under high-temperature fermentation conditions, but also achieves a final acetic acid yield of 52.65 g / L, which is about 31.5% higher than that of the wild-type strain. This invention effectively solves the problem of decreased acid production rate and yield in traditional acetic acid fermentation under high-temperature conditions in summer. Attached Figure Description
[0017] Figure 1 The high-temperature induction carrier pBBR1MCS2-icd of this invention; Figure 2 Fluorescence patterns of recombinant strain ApGFP under conditions with and without high-temperature pressure; Figure 3 The spectra of the high-temperature induced expression cassettes pBBR1MCS2-icd-AdhP and pBBR1MCS2-tac-AdhP of the present invention are shown. Figure 4 Figure 1 shows the results of acetic acid production by fermentation of recombinant strain ApAdhP(icd), recombinant strain ApAdhP(tac), and wild strain TCBRC103. Detailed Implementation
[0018] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0019] Example 1: Screening of Inducible Promoters The *Acetobacter pastoris* used in this embodiment ( Acetobacter pasteurianus TCBRC 103 comes from patent application CN116496920A.
[0020] Transcriptome sequencing was used to obtain a temperature-inducible promoter. Specifically, a loopful of activated *Acetobacter pasteurellium* was selected. Acetobacter pasteurianus TCBRC 103 cells were inoculated into YPD liquid medium (10 g / L yeast extract, 20 g / L protein, 20 g / L glucose, balance water) and cultured to the logarithmic growth phase. Then, at a 2% inoculum, cells were transferred to 50 mL of fresh YPD liquid medium and cultured at 30 °C and 200 rpm for 8 h. The culture temperature was then increased to 42 °C and cultured for another 4 h. Cells cultured at 30 °C and 200 rpm for 12 h served as a control sample. Cells were collected by centrifugation, frozen in liquid nitrogen, and then sent to Novogene Biotechnology Co., Ltd. for transcriptome sequencing.
[0021] By analyzing transcriptome data, it was found that icdThe gene's expression level at room temperature is 4814 (FPKM value). After high-temperature treatment, icd The gene expression level reached an FPKM value of 26587, upregulated by 5.52-fold. Data were validated using qRT-PCR, with primers ICD-F (SEQ ID NO.7: 5'-GGTGGTGGGTTCAAATCCAT-3') and ICD-R (SEQ ID NO.8: 5'-AGGCGCAATGCCCTTGGGGT-3'). The reaction mixture consisted of 20 μL: 10 μL SYBR Premix Ex Taq II, 0.4 μL each of forward and reverse primers, 2 μL cDNA template, and 7.2 μL ddH2O. The amplification program included: pre-denaturation at 95 ℃ for 12 min; denaturation at 95 ℃ for 30 s, annealing at 53 ℃ for 30 s, extension at 72 ℃ for 20 s, repeated 30 times; and a final extension at 72 ℃ for 10 min. Results showed that under high-temperature (42 ℃) treatment, icd The gene was significantly upregulated, by 6.37-fold, with no significant difference from the transcriptome data.
[0022] Extraction was performed using a rapid bacterial genomic DNA extraction kit (purchased from Shanghai Sangon Biotech Co., Ltd., catalog number: B518225). Acetobacter pasteurianus After obtaining the genome of TCBRC 103, using this genome as a template, and through primer P... icd -Upstream (SEQ ID NO.9: 5'-GCATGAAGGGCCAGCCCGTAT-3') and P ICD - Downstream (SEQ ID NO. 10: 5'-TTTTTTTTCTATGACTCTGACAAAG-3') amplification icd promoter segment P icd The amplification system and procedure were the same as above. After gel recovery, the amplified fragments were ligated into the cloning vector T-Vector pMD™19 (Simple) (purchased from Takara, catalog number: 3217) and sent to Genewiz Biotechnology Co., Ltd. for sequencing.
[0023] Promoter P obtained from sequencing icdThe sequence is: 5'- GCATGAAGGGCCAGCCCGTATTTCCAAAATGCCTTCTCCCATTACGCTTGAAGAAGGCATGGTGATTTCCAACGAGCCGGGCTTTTACAAACCCGGCGCCTACGGCATCCGGCTGGAAACACTAGTGATGATCCGCCCCGGCAACATGCCGCATTCGGACCGGGCTTTTCTGGAATTTGAAACCCTTACACTGGCACCTTTTGACAGACGGTTGATTGACCTCACCCTGTT AGGCCCGGAAGATACCGCCGTGCTGGACGCGTACCATGCTCAAATCTTGGATCAGGTAGGCCCTCACCTGCCATCTGATGCACAGAAATGGCTGAAAACGGCATGTGCGCCTCTCAAGAGGGCGTGAGAGGCGGAGTCTTTCCCCTCTGGTCACGAAATTGAGAATCGCATGCACCGTAAAACGGGCGCAAAACAGGCTACGAAGTTGAAGGGAGCTTCTCAGA-3' (SEQ ID NO.1).
[0024] Example 2: Construction of the inducible promoter expression vector pBBR1MCS2-icd Extraction was performed using a rapid bacterial genomic DNA extraction kit (purchased from Shanghai Sangon Biotech Co., Ltd., catalog number: B518225). Acetobacter pasteurianus After obtaining the genome of TCBRC 103, using this genome as a template, and through primer P... icd -F (SEQ ID NO.3: 5'-C GAGCTC GCATGAAGGGCCAGCCCGTAT-3', SacI) and P icd -R(SEQID NO.4:5'-CG) GAATTC TTTTTTTTCTATGACTCTGACAAAG-3', EcoRI) amplifies the promoter fragment P of ICD. icd(SEQ ID NO.1). PCR reaction system (50 μL): 0.2 μL each of forward and reverse primers, 0.1 μL template, 25 μL 2 × Phanta MaxMaster Mix, and 24.5 μL distilled water. Amplification program: pre-denaturation at 95℃ for 5 minutes; denaturation at 95℃ for 15 seconds, annealing at 60℃ for 15 seconds, extension at 72℃ for 15 seconds, 30 cycles (denaturation-annealing-extension); final extension at 72℃ for 5 minutes. The gel was recovered and ligated into pBBR1MCS2 (purchased from Miaoling Biotechnology Co., Ltd., catalog number: P0306) via the SacI and EcoRI restriction sites to obtain pBBR1MCS2-icd, which is the high-temperature inducible promoter expression vector. See the schematic diagram below. Figure 1 .
[0025] Example 3: Promoter Induction Effect Detection (1) Construction of recombinant plasmid pBBR1MCS2-icd-GFP The green fluorescent protein gene GFP (SEQ ID NO.13) was selected to target the promoter P. icd The induction effect of high temperature was detected. Using the vector pBBR1MCS2-pAmp-EGFP (purchased from Miaoling Biotechnology Co., Ltd., catalog number: P0525) as a template, primers GFP-F (SEQ ID NO.11: 5'-CG) were used. GAATTC ATGGTGAGCAAGGGCGAGGAGCTGTTCA-3', EcoRI) and GFP-R (SEQ ID NO. 12: 5'-GG GGTACC GFP gene was amplified using TTACTTGTACAGCTCGTCCATGCCG-3' (KpnI). PCR reaction system (50 μL): 0.2 μL each of forward and reverse primers, 0.1 μL template, 25 μL 2 × Phanta Max Master Mix, and 24.5 μL distilled water. Amplification program: pre-denaturation 95℃ for 5 minutes; denaturation 95℃ for 15 seconds, annealing 60℃ for 15 seconds, extension 72℃ for 30 seconds, 30 cycles (denaturation-annealing-extension); final extension 72℃ for 5 minutes. After gel recovery, the gene was digested with restriction endonucleases EcoRI and KpnI before gel recovery. The high-temperature inducible promoter expression vector pBBR1MCS2-icd constructed in Example 2 was digested with restriction endonucleases EcoRI and KpnI, and GFP was inserted into the P3' of the expression vector pBBR1MCS2-icd using DNA ligase. icd Following the promoter, the recombinant plasmid pBBR1MCS2-icd-GFP was obtained.
[0026] (2) Construction of recombinant strain ApGFP Pick a ringAcetobacter pasteurianus Single colony strain TCBRC 103 was inoculated into YPD liquid medium and cultured overnight at 30°C. A 2% inoculum was then transferred to 50 mL of fresh YPD liquid medium and cultured with shaking at 200 rpm at 30°C until the bacterial concentration reached OD500. 600 Once the pH reaches 0.8, centrifuge to collect the bacterial cells. Wash the collected cells twice with pre-cooled 50 mL of distilled water, and then resuspend the cells in 1 mL of distilled water. Aliquot the resuspended bacterial solution into 100 μL 1.5 mL sterile centrifuge tubes for later use. Acetobacter pasteurianus TCBRC 103 competent cells have been successfully prepared.
[0027] 10 μL of recombinant plasmid pBBR1MCS2-icd-GFP was added to a centrifuge tube containing 100 μL of competent cells, and then introduced into the culture medium via electroporation. Acetobacter pasteurianus TCBRC 103 competent cells were plated on Kans resistant medium and cultured at 30°C for 2-3 days to obtain single colonies. These single colonies were then picked and inoculated into YPD liquid medium and cultured at 30°C for 12 h. The strains were then centrifuged to collect the genome for PCR verification. Once verified, the recombinant strain ApGFP was obtained.
[0028] (3) Fluorescent protein-induced expression Single colonies of the recombinant strain ApGFP were inoculated into YPD liquid medium and cultured overnight at 30°C. Cells were also inoculated at a 2% inoculum into 50 mL of fresh YPD liquid medium and cultured at 30°C with shaking at 200 rpm for 8 h, then the temperature was increased to 42°C and cultured for another 12 h. Cells cultured at 30°C and 200 rpm for 20 h served as a control sample, and were collected by centrifugation. Fluorescence was observed using a DM500-FL fluorescence microscope with an excitation wavelength of 488 nm and an emission wavelength of 507 nm. The results showed that the recombinant strain ApGFP exhibited very weak fluorescence at room temperature (7325 nm); however, under high-temperature stress, the fluorescence intensity significantly increased to 56287 (…). Figure 2 ), indicating the promoter P icd It is a high-temperature induced strong promoter.
[0029] Example 4: Application of inducible promoters in acetic acid production To investigate the induced promoter P icd To enhance acetic acid production at high temperatures, a constitutive strong promoter, P, was selected. tac For comparison.
[0030] (1) Construction of expression box Acetobacter pasteurellosis ( Acetobacter pasteurianusUsing the TCBRC 103 genome as a template, primers AdhP-F (SEQ ID NO.5: 5' - CG GAATTC ATGTCCGGAAAAAATGAAAGCCGCTGT-3', EcoRI) and AdhP-R (SEQ ID NO. 6: 5'- GG GGTACC Amplification of the AdhP gene (SEQ ID NO.2) using TCAGTTGCGGAAGTCCAGAACCACG -3', KpnI. PCR reaction system (50 μL): 0.2 μL each of forward and reverse primers, 0.1 μL template, 25 μL 2 × PhantaMax Master Mix, 24.5 μL distilled water. Amplification program: pre-denaturation 95℃ for 5 min; denaturation 95℃ for 15 s, annealing 60℃ for 15 s, extension 72℃ for 30 s, 30 cycles (denaturation-annealing-extension); final extension 72℃ for 5 min. After gel recovery, digestion with restriction endonucleases EcoRI and KpnI followed by gel recovery. The high-temperature inducible promoter expression vector pBBR1MCS2-icd constructed in Example 2 was digested with restriction endonucleases EcoRI and KpnI, and AdhP was inserted into the P of the expression vector pBBR1MCS2-icd using DNA ligase. icd Following the promoter, the recombinant plasmid pBBR1MCS2-icd-AdhP was obtained.
[0031] Acetobacter pasteurellosis ( Acetobacter pasteurianus Using the TCBRC 103 genome as a template, primers AdhP-F (SEQ ID NO.5: 5' - CG GAATTC ATGTCCGGAAAAAATGAAAGCCGCTGT-3', EcoRI) and AdhP-R (SEQ ID NO. 6: 5'- GG GGTACC The AdhP gene was amplified using TCAGTTGCGGAAGTCCAGAACCACG -3', KpnI. The constitutive strong promoter expression vector pBBR1MCS2-tac (purchased from Miaoling Biotechnology Co., Ltd., catalog number: P31085) was digested with restriction endonucleases EcoRI and KpnI, and AdhP was inserted into the P' region of the expression vector pBBR1MCS2-tac using DNA ligase. tac Following the promoter, the recombinant plasmid pBBR1MCS2-tac-AdhP was obtained.
[0032] See the schematic diagram of carrier construction. Figure 3 .
[0033] (2) Construction of recombinant strains ApAdhP(icd) and ApAdhP(tac) Pick a ring Acetobacter pasteurianus Single colony strain TCBRC 103 was inoculated into YPD liquid medium and cultured overnight at 30°C. A 2% inoculum was then transferred to 50 mL of fresh YPD liquid medium and cultured with shaking at 200 rpm at 30°C until the bacterial concentration reached OD500. 600 Once the pH reaches 0.8, centrifuge to collect the bacterial cells. Wash the collected cells twice with pre-cooled 50 mL of distilled water, and then resuspend the cells in 1 mL of distilled water. Aliquot the resuspended bacterial solution into 100 μL 1.5 mL sterile centrifuge tubes for later use. Acetobacter pasteurianus TCBRC 103 competent cells have been successfully prepared.
[0034] 10 μL of recombinant plasmids pBBR1MCS2-icd-AdhP and pBBR1MCS2-tac-AdhP were added to centrifuge tubes containing 100 μL of competent cells, respectively, and then introduced into the cells using electroporation. Acetobacter pasteurianus In TCBRC 103 competent cells, KAN resistant medium plates were plated and cultured at 30°C for 2-3 days to obtain single colonies. The obtained single colonies were picked and inoculated into YPD liquid medium and cultured at 30°C for 12 h. The strains were collected by centrifugation, and the genome was extracted for PCR verification. After successful verification, the recombinant strains ApAdhP (icd) and ApAdhP (tac) were obtained.
[0035] (3) Application of high-temperature synthesis of acetic acid One loop of activated recombinant strains ApAdhP(icd) and ApAdhP(tac) were picked from the plate and inoculated into a 50 mL Erlenmeyer flask containing 10 mL of seed culture medium (10 g / L yeast extract, 20 g / L protein, 20 g / L glucose, and the remainder water). The flask was placed in a shaker at 30 ℃ and 180 r / min and cultured for 12 h to obtain the primary seed culture. The primary seed cultures of recombinant strains ApAdhP(icd) and ApAdhP(tac) were inoculated at a rate of 5% (v / v) into 250 mL Erlenmeyer flasks containing 50 mL of seed culture medium (10 g / L yeast extract, 20 g / L protein, 20 g / L glucose, with the remainder being water). The flasks were then placed in a shaker at 30 °C and 180 r / min and cultured for 12 h to obtain the secondary seed cultures. The secondary seed cultures of recombinant strains ApAdhP(icd) and ApAdhP(tac) were inoculated at a rate of 5% (v / v) into 250 mL Erlenmeyer flasks containing 50 mL of fermentation medium (10 g / L yeast extract, 20 g / L protein, 20 g / L glucose, 6% ethanol, and the remainder water). The flasks were then used for fermentation in a shaker at 180 r / min, with the fermentation temperature gradually increasing as follows: 30℃ for 0-12 h, 35℃ for 12-24 h, 39℃ for 24-36 h, and 42℃ for 36-72 h.
[0036] During fermentation, samples were taken periodically. The fermentation broth samples were centrifuged at 10,000 r / min for 10 min, and the supernatant was collected. The supernatant was filtered through a 0.22 μm microporous membrane and then analyzed by high-performance liquid chromatography (HPLC, Agilent). Acetic acid determination conditions: Aminex HPX-87H column, RID detector, mobile phase 5 mM sulfuric acid, flow rate 0.6 mL / min, column temperature 50 ℃, injection volume 10 μL.
[0037] To investigate the effects of different promoters on host cell growth, we measured the biomass changes of wild-type strain TCBRC103 and two recombinant strains, ApAdhP (tac) and ApAdhP (icd), during a 72-hour fermentation process. Figure 4 As shown, all strains were in the logarithmic growth phase within 0-12 hours, followed by the stationary phase. The wild-type strain TCBRC103 and the recombinant strain ApAdhP (icd) exhibited similar growth trends, both reaching maximum biomass around 36 hours, with OD600 values of approximately 1.51 and 1.47, respectively. This indicates that the introduction... icd The promoter-driven expression system did not impose a significant metabolic burden or growth inhibition on the host cells. In contrast, the growth of the recombinant strain ApAdhP (tac) was inhibited to some extent. Although its rate of entering the logarithmic growth phase was similar to that of the wild type, its maximum biomass (OD600 of 1.26) was significantly lower than that of the other two strains. This growth defect may be attributed to the increased metabolic load caused by the premature expression of the exogenous protein (AdhP) by the strong promoter of tac, as well as the synthesis of more acetic acid, which is cytotoxic and thus limits the growth of the strain.
[0038] Further analysis was conducted on the acetic acid accumulation of each strain during fermentation. The results showed that the recombinant strain ApAdhP(icd) produced significantly more acetic acid than the wild-type strain and the ApAdhP(tac) strain. In the early stages of fermentation (0-24 hours), the differences in acid production rates among the three strains were small, but these differences gradually widened as fermentation progressed into the middle and late stages. Although the ApAdhP(tac) strain exhibited a faster acid production rate during 12-36 hours, reaching a yield of approximately 40 g / L at 36 hours, the yield subsequently plateaued and no longer increased significantly. This is consistent with its lower biomass level, suggesting that decreased cell viability limited the continued accumulation of the product. Conversely, the ApAdhP(icd) strain maintained a sustained product synthesis capacity throughout the entire fermentation cycle. Particularly after 48 hours, when the yields of other strains tended to stabilize, the acetic acid concentration of ApAdhP(icd) continued to rise, reaching a peak of approximately 52.65 g / L at 72 hours. Compared with the wild-type strain (approximately 40 g / L) and the ApAdhP (tac) strain, the final yield of ApAdhP (icd) was increased by approximately 31.5% and 30%, respectively. This suggests that the icd promoter may be more advantageous in maintaining the metabolic balance between cell growth and product synthesis, and can maintain a high metabolic flux in the later stages of fermentation, thereby achieving efficient accumulation of acetic acid.
Claims
1. A high-temperature induced promoter, characterized in that, The high-temperature inducible promoter is P. icd Its nucleotide sequence is shown in SEQ ID NO.
1.
2. A recombinant vector, expression cassette, transgenic cell line, or recombinant bacterium containing the high-temperature inducible promoter of claim 1.
3. A recombinant expression vector, characterized in that, The recombinant expression vector includes the high-temperature induced promoter as described in claim 1.
4. A method for constructing the recombinant expression vector according to claim 3, characterized in that, Includes the following steps: Acetobacter pasteurellosis ( Acetobacter pasteurianus Using the TCBRC 103 genome as a template, the high-temperature induced promoter sequence described in claim 1 was amplified by PCR and ligated into plasmid pBBR1MCS2 to obtain the high-temperature induced promoter expression vector pBBR1MCS2-icd.
5. The construction method according to claim 4, characterized in that, The primer pair used for PCR amplification of the high-temperature induced promoter sequence was P. icd -F and P icd -R, the primer pair nucleotide sequences are shown in SEQ ID NO.3~4.
6. A recombinant bacterium for high acetic acid production, characterized in that, The recombinant bacteria include the recombinant expression vector and alcohol dehydrogenase gene as described in claim 3.
7. A method for preparing the recombinant bacteria according to claim 6, characterized in that, Includes the following steps: (1) With *Acetobacter pasteurellii* ( Acetobacter pasteurianus Using the genome of TCBRC 103 as a template, the nucleotide sequence of alcohol dehydrogenase AdhP was amplified by PCR, and the nucleotide sequence of alcohol dehydrogenase AdhP was ligated into the recombinant expression vector described in claim 3 to obtain the recombinant plasmid pBBR1MCS2-icd-AdhP. (2) The recombinant plasmid pBBR1MCS2-icd-AdhP was transferred into the host cell to obtain a recombinant bacterium with high acetic acid production.
8. The method for preparing recombinant bacteria according to claim 7, characterized in that, The nucleotide sequence of the alcohol dehydrogenase AdhP described in step (1) is shown in SEQ ID NO.
2.
9. The method for preparing recombinant bacteria according to claim 7, characterized in that, In step (1), the primer pair used for PCR amplification of the AdhP sequence is AdhP-F and AdhP-R, and the nucleotide sequences of the amplification primers are shown in SEQ ID NO.5~6.
10. The application of the high-yield recombinant acetic acid bacteria according to claim 6 and the recombinant bacteria prepared by the preparation method of any one of claims 7 to 9 in the fermentation production of acetic acid at high temperature.