Ethanol-responsive genetically engineered alcohol relief probiotic and construction method and application thereof

By constructing an ethanol-responsive genetically engineered hangover-relieving probiotic EcN-EC and combining it with layer-by-layer self-assembly coating technology, the problems of low efficiency in decomposing ethanol and acetaldehyde and difficulty in intestinal colonization of existing hangover-relieving probiotics have been solved, achieving intelligent responsiveness and efficient hangover relief effects.

CN121343863BActive Publication Date: 2026-05-22INST OF BIOMEDICAL ENG CHINESE ACAD OF MEDICAL SCI
View PDF 7 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-19
Publication Date
2026-05-22

AI Technical Summary

Technical Problem

Existing probiotics for detoxifying alcohol have limited efficiency in breaking down ethanol and acetaldehyde, and lack the ability to respond to the concentration of alcohol in the body, leading to the decline of the bacterial community and the waste of metabolic resources. Traditional genetically engineered bacteria continuously express enzymes, increasing the burden on the bacterial cells and making it difficult to become the dominant intestinal flora.

Method used

Ethanol-responsive genetically engineered probiotic EcN-EC was constructed. By introducing the ethanol-responsive element AlcR transcription unit and the ethanol-metabolizing enzyme hADH1B-hALDH2 transcription unit, intelligent responsive expression to alcohol was achieved. Layer-by-layer self-assembly coating technology was used to improve the colonization ability of the bacteria in the intestine.

Benefits of technology

It achieves rapid and efficient decomposition of ethanol and its toxic metabolite acetaldehyde after alcohol ingestion, reduces the metabolic stress on bacteria, enhances intestinal colonization, forms a stable alcohol metabolism capacity, reduces the amount of ethanol entering the bloodstream, and has a highly effective hangover cure and good biosafety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121343863B_ABST
    Figure CN121343863B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering, in particular to an ethanol-responsive genetically engineered alcoholism-relieving probiotic, a construction method and application thereof. The probiotic provided by the present application introduces an "ethanol-responsive" regulation mechanism, so that the strain can specifically induce the efficient expression of human alcohol dehydrogenase 1B (hADH1B) and human acetaldehyde dehydrogenase 2 (hALDH2) when sensing the presence of ethanol in the body, thereby realizing the on-demand and efficient decomposition of ethanol and its toxic metabolite acetaldehyde. Compared with the continuous expression of traditional engineering bacteria, this intelligent regulation mode can better simulate the natural metabolic rhythm of the human body, solve the problem of bacterial metabolism, improve the alcoholism-relieving efficiency, reduce the metabolic pressure of the bacterial cells, and is expected to achieve better alcoholism-relieving effect and higher biological safety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to ethanol-responsive genetically engineered alcohol-reducing probiotics, their construction methods, and applications. Background Technology

[0002] In recent years, with the continuous increase in alcohol consumption, health problems caused by excessive ethanol intake have received increasing attention. In terms of acute effects, a single instance of excessive drinking can cause immediate symptoms of intoxication such as headache, nausea, and vomiting, but can also lead to acute alcohol poisoning, severe pancreatitis, and trigger emergencies such as arrhythmia and gastric mucosal bleeding, even endangering life in severe cases. In the long term, chronic alcohol intake is a major contributing factor to the development of alcoholic liver disease, which typically progresses from initial alcoholic fatty liver to alcoholic hepatitis, liver fibrosis, and ultimately cirrhosis and even liver cancer. Furthermore, long-term alcohol consumption significantly increases the risk of various chronic diseases such as hypertension, cardiomyopathy, stroke, and digestive tract cancers, and is also closely related to decreased immune function, nervous system damage, and nutritional metabolic disorders. In common settings such as social gatherings and business banquets, alcohol intake is difficult to avoid. Therefore, how to quickly alleviate intoxication and reduce the burden on the body after consuming a lethal amount of alcohol in a short period has become a pressing practical problem that needs to be addressed. The ability of the human body to metabolize ethanol varies significantly among individuals. A considerable number of people have low activity of alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH), leading to the accumulation of ethanol and its toxic metabolite acetaldehyde in the body. This not only exacerbates acute and chronic health damage but also significantly increases the severity of discomfort after drinking. Currently, various intervention products are available on the market, including antioxidants, liver-protecting drugs, and anti-inflammatory agents. However, their application is mostly focused on liver protection and damage repair, with limited effectiveness in providing immediate relief after acute drinking. Furthermore, some drugs have significant side effects and are limited to certain populations.

[0003] Against this backdrop, the "probiotic hangover remedy" technology route based on microbial intervention has gradually demonstrated its potential and become a research hotspot. In recent years, numerous related patents have emerged in this field, dedicated to exploring the application of probiotics in alleviating alcohol-related health problems. For example, publication number CN117987307A proposes a strain of *Lactobacillus acidophilus* derived from wine mash, which exhibits good ethanol tolerance and can alleviate acute alcoholic liver injury; publication number CN117801991A uses a probiotic postbiotic composition of *Bifidobacterium animalis* subsp. *lactosporum* ProSci-246 to alleviate post-drinking discomfort; and publication number CN114426942A reports the use of genetically engineered recombinant *Lactococcus lactis* to express ADH and ALDH for direct ethanol decomposition. Alcohol and acetaldehyde; Publication No. CN116622559A selects a strain of Lactobacillus casei that produces acetaldehyde dehydrogenase and combines it with traditional food and medicine ingredients to achieve the dual effects of relieving hangovers and protecting the liver; Publication No. CN120210079A is the first to use a probiotic composition with Lactobacillus reuteri Care360 and Lactobacillus paracasei STB as core strains to survive in the intestines and produce a large amount of alcohol dehydrogenase and acetaldehyde dehydrogenase, thereby effectively decomposing alcohol and its metabolite acetaldehyde.

[0004] However, existing strains and technologies still have significant limitations. The hangover-detoxifying efficacy of naturally selected strains (such as *Lactobacillus acidophilus* and *Lactobacillus casei*) largely relies on the bacterial cell's own metabolic characteristics or limited enzyme activity, often exhibiting limited efficiency in breaking down ethanol and acetaldehyde. While traditional genetically engineered bacteria (such as recombinant *Lactococcus lactis*) can directly express key enzymes, their expression is usually constitutive (continuous), lacking responsiveness to in vivo alcohol concentrations, potentially wasting metabolic resources and increasing bacterial load. Existing hangover-detoxifying probiotics continuously produce alcohol dehydrogenase and acetaldehyde dehydrogenase, placing an extremely high metabolic burden on the probiotics, which is highly detrimental to their becoming the dominant flora in the gut, and may even lead to flora decline and loss. Overall, existing solutions still have room for improvement in terms of both "efficiency" and "intelligence" in hangover detoxification. Summary of the Invention

[0005] The purpose of this invention is to provide an ethanol-responsive genetically engineered probiotic for detoxification, its construction method, and its application, thereby addressing the problems existing in the prior art. The ethanol-responsive genetically engineered probiotic EcN-EC provided by this invention produces a small amount of AlcR protein under normal conditions, which does not affect the inherent expression of EcN metabolism in the gut microbiota *Escherichia coli* probiotic strain. It can instantly metabolize ingested alcohol, and upon alcohol ingestion, it can sense its presence and induce rapid and large-scale expression of hADH1B and hALDH2, generating the ability to degrade alcohol. More importantly, since alcohol has a killing effect on ordinary bacteria, the probiotic of this invention can rapidly produce alcohol-metabolizing enzymes (human alcohol dehydrogenase 1B (hADH1B) and human acetaldehyde dehydrogenase 2 (hALDH2)) upon sensing the presence of alcohol. This characteristic will give the probiotic a survival advantage in an alcoholic environment, thereby further becoming the dominant flora in the gut, ultimately forming a stable alcohol metabolism capacity, reducing the amount of ingested ethanol entering the bloodstream, and achieving the function of detoxification.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides an ethanol-responsive genetically engineered probiotic for relieving hangovers, EcN-EC, which uses Escherichia coli probiotic strain EcN as the substrate bacteria and introduces a recombinant vector containing the ethanol-responsive element AlcR transcription unit and the ethanol-metabolizing enzyme hADH1B-hALDH2 transcription unit.

[0008] The nucleic acid sequence of the ethanol-responsive element AlcR transcription unit is shown in SEQ ID NO.2;

[0009] The nucleic acid sequence of the ethanol metabolizing enzyme hADH1B-hALDH2 transcription unit is shown in SEQ ID NO.3.

[0010] Preferably, the base plasmid of the recombinant vector is p15A-Ptet-dacA-KanR; the nucleic acid sequence of p15A-Ptet-dacA-KanR is shown in SEQ ID NO.1.

[0011] This invention provides a method for constructing the above-mentioned ethanol-responsive genetically engineered probiotic for relieving hangovers, EcN-EC, by introducing a recombinant vector containing the ethanol-responsive element AlcR transcription unit and the ethanol-metabolizing enzyme hADH1B-hALDH2 transcription unit into the Escherichia coli probiotic strain EcN to obtain the ethanol-responsive genetically engineered probiotic for relieving hangovers, EcN-EC.

[0012] Preferably, the base plasmid of the recombinant vector is p15A-Ptet-dacA-KanR; the nucleic acid sequence of p15A-Ptet-dacA-KanR is shown in SEQ ID NO.1.

[0013] However, even the most advanced engineered bacteria must overcome the digestive tract barrier to reach the intestines and exert their effects. Orally administered probiotics need to withstand the erosion of gastric acid, bile salts, and other intestinal digestive fluids to successfully reach the terminal ileum and colon to colonize and exert their efficacy. Current probiotic intestinal delivery technologies mainly include drying and encapsulation. Drying primarily involves spray drying and freeze drying to prepare bacterial powder for intestinal delivery after forming a bacterial suspension. However, these methods fail to effectively protect the bacteria, directly exposing them to digestive fluids, which significantly affects the number of bacteria that can reach the terminal ileum and colon, resulting in insufficient colonization. Furthermore, the harsh drying processes, such as spray drying, can directly damage the probiotics. Encapsulation involves using certain processes to encapsulate a larger number of bacteria in microcapsules for intestinal delivery. Encapsulating a large number of probiotics in a small space at once can greatly affect their exchange with external substances, leading to a significant decrease in their activity. Furthermore, the microcapsules formed by encapsulation are tens to hundreds of micrometers in size, which is much larger than the mesh pores of the intestinal mucus layer. They cannot penetrate the mucus layer and can only be physically blocked on the outer layer or quickly flushed out by intestinal contents, resulting in a "passing through the intestines" phenomenon. The explosive release of probiotic microcapsules in the colon can also lead to an excessively high local bacterial concentration, which is not conducive to competition with the original intestinal flora, or it can stimulate the host's immune system and be quickly swept away.

[0014] Layer-by-layer self-assembly coating technology for bacteria provides engineered probiotics with robust "armor." This technology can form a nanoscale protective film on the surface of individual bacteria, effectively resisting the invasion of digestive juices and significantly increasing the proportion of live bacteria reaching the intestines. Layer-by-layer self-assembly technology fundamentally solves the two major challenges of "preservation" and "colonization," bringing a qualitative leap to probiotic therapy.

[0015] Therefore, the present invention proposes the following technical solution:

[0016] This invention provides the application of the above-mentioned ethanol-responsive genetically engineered alcohol-relieving probiotic EcN-EC in the preparation of products for relieving acute alcohol poisoning.

[0017] This invention provides a product for relieving acute alcohol poisoning, the product comprising the above-mentioned ethanol-responsive genetically engineered alcohol-relieving probiotic EcN-EC.

[0018] Preferably, the product for relieving acute alcohol poisoning further includes a coating agent; the coating agent includes polylysine and carboxymethyl inulin.

[0019] Preferably, the dosage form of the product for relieving acute alcohol poisoning includes granules, powders, and oral liquids.

[0020] This invention provides a method for preparing the above-mentioned product for relieving acute alcohol poisoning, characterized by comprising the following steps:

[0021] (1) The ethanol-responsive genetically engineered alcohol-reducing probiotic EcN-EC was resuspended in polylysine solution to obtain cell 1;

[0022] (2) Bacterial cells 1 were resuspended in carboxymethyl inulin solution to obtain bacterial cells 2;

[0023] (3) Repeat steps (1) and (2) once to obtain the product for relieving acute alcohol poisoning.

[0024] Preferably, the concentration of polylysine in the polylysine solution is 2 mg / mL; and the concentration of carboxymethyl inulin in the carboxymethyl inulin solution is 2 mg / mL.

[0025] The present invention discloses the following technical effects:

[0026] This invention proposes an engineered probiotic for alleviating acute alcohol poisoning—an ethanol-responsive genetically engineered alcohol-relieving probiotic, EcN-EC. This probiotic utilizes the Escherichia coli probiotic strain EcN (Escherichia coli Nissle 1917) and undergoes genetic engineering, transforming it with the alcohol-responsive plasmid p15A-EC to construct EcN-EC. EcN-EC can induce the expression of human alcohol dehydrogenase 1B (hADH1B) and human acetaldehyde dehydrogenase 2 (hALDH2) in response to environmental ethanol. The probiotic provided by this invention innovatively introduces an "ethanol-responsive" regulatory mechanism. Therefore, this strain can specifically induce the efficient expression of hADH1B and hALDH2 upon sensing the presence of ethanol in the body, thereby achieving on-demand and efficient decomposition of ethanol and its toxic metabolite acetaldehyde. This intelligent regulation mode (regulation element circuit), compared with the continuous expression of traditional engineered bacteria, can better simulate the natural metabolic rhythm of the human body, solve the problem of bacterial metabolism, improve the efficiency of detoxification, and reduce the metabolic pressure on the bacteria themselves, which is expected to achieve better detoxification effect and higher biosafety.

[0027] This invention also provides an oral formulation for relieving acute alcohol poisoning. In the preparation process, a single genetically engineered alcohol-relieving probiotic, EcN-EC, undergoes layer-by-layer self-assembly coating. Poly-L-lysine (PLL) is used as coating material 1, and carboxymethyl inulin (CMI) is used as coating material 2. First, positively charged PLL is deposited onto the negatively charged surface of the genetically engineered alcohol-relieving probiotic EcN-EC using electrostatic attraction to form EcN-EC@P, thereby reversing the surface charge from negative to positive. Then, negatively charged CMI is deposited onto its surface to form EcN-EC@PC. This process is repeated to form EcN-EC@PCPC, creating a multi-layered single-bacterial coating that enables intestinal delivery and colonization, allowing the alcohol-relieving function to be maintained for a relatively long time. Inulin was chosen because of its colon-targeting properties; it requires specific inulin-degrading bacteria in the gut to break it down. However, the Escherichia coli probiotic strain EcN itself cannot degrade inulin, thus preventing premature release at the beginning of the digestive tract that could lead to bacterial death. Modified carboxymethyl inulin allows it to carry a negative charge, enabling layer-by-layer self-assembly through electrostatic interactions. Polylysine, a coating material with excellent host compatibility, carries a positive charge after removing the outer layer of carboxymethyl inulin. This charge attracts the negatively charged intestinal mucosa of the host's intestinal cells, resulting in strong adhesion and further enhancing bacterial colonization. Layer-by-layer self-assembly constructs a dense and uniform nanoscale protective layer on the surface of a single genetically engineered probiotic strain, EcN-EC@PCPC, providing excellent gastric acid resistance while ensuring normal metabolic exchange of bacteria, greatly improving the arrival rate of live bacteria. After layer-by-layer self-assembly, the size of the single genetically engineered probiotic strain EcN-EC@PCPC is 1-3μm, which has a very strong ability to penetrate barriers. The special coating material also provides strong adhesion to the intestinal mucosal barrier, enabling intelligent targeting. The genetically engineered probiotic strain EcN-EC@PCPC in the layer-by-layer self-assembly has a uniform distribution of individual microorganisms, and the lower concentration of bacterial solution can effectively avoid the problem of poor colonization in the original intestinal flora due to excessive density competition, while also avoiding the host immune system clearance caused by excessive local concentration.

[0028] In summary, this invention addresses the cutting-edge needs in the field of hangover-relieving probiotics. By constructing intelligent engineered bacteria with ethanol-responsive capabilities, it overcomes the limitations of existing strains in terms of hangover-relieving efficiency and regulatory mechanisms. Simultaneously, by optimizing the layer-by-layer self-assembly coating process, it aims to solve the technical bottleneck of oral delivery of live bacteria. The combination of these two innovations lays a solid technical foundation for developing next-generation, highly efficient, intelligent, and stable hangover-relieving microecological preparations. Attached Figure Description

[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0030] Figure 1 Preparation process of EcN-EC, a genetically engineered probiotic for relieving hangovers;

[0031] Figure 2 Statistical graph of fluorescence intensity of EcN-EC, a genetically engineered probiotic for detoxifying alcohol, induced by different concentrations of ethanol;

[0032] Figure 3 A statistical chart illustrating the competitive survival advantages of genetically engineered alcohol-curing probiotics EcN-EC and EcN-com.

[0033] Figure 4 The image shows a statistical graph of fluorescence intensity for each layer of the self-assembled coating. Specifically, EcN-EC represents the genetically engineered probiotic EcN-EC for alcohol detoxification; EcN-EC@P represents the first layer of the genetically engineered probiotic EcN-EC for alcohol detoxification; EcN-EC@PC represents the second layer of the genetically engineered probiotic EcN-EC for alcohol detoxification; EcN-EC@PCP represents the third layer of the genetically engineered probiotic EcN-EC for alcohol detoxification; and EcN-EC@PCPC represents the fourth layer of the genetically engineered probiotic EcN-EC for alcohol detoxification.

[0034] Figure 5 The image shows a statistical diagram of the Zeta potential of each layer in the self-assembled coating. Specifically, EcN-EC represents the genetically engineered probiotic EcN-EC for alcohol detoxification; EcN-EC@P represents the first layer of the genetically engineered probiotic EcN-EC for alcohol detoxification; EcN-EC@PC represents the second layer of the genetically engineered probiotic EcN-EC for alcohol detoxification; EcN-EC@PCP represents the third layer of the genetically engineered probiotic EcN-EC for alcohol detoxification; and EcN-EC@PCPC represents the fourth layer of the genetically engineered probiotic EcN-EC for alcohol detoxification.

[0035] Figure 6 In vivo fluorescence pattern of mouse intestinal colonization;

[0036] Figure 7 This is a statistical graph of the integral fluorescence intensity in mice.

[0037] Figure 8 A statistical chart showing the time to intoxication for different treatment groups;

[0038] Figure 9 A statistical chart showing the recovery time of different treatment groups;

[0039] Figure 10 A statistical graph showing serum ethanol concentrations in different treatment groups;

[0040] Figure 11 A statistical graph showing serum acetaldehyde concentrations in different treatment groups;

[0041] Figure 12 Statistical graph of serum alanine aminotransferase activity in different treatment groups;

[0042] Figure 13 A statistical graph showing the serum aspartate aminotransferase activity of different treatment groups. Detailed Implementation

[0043] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0044] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0045] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0046] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0047] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0048] Example 1

[0049] This embodiment provides a method for preparing the genetically engineered probiotic EcN-EC for relieving hangovers. The preparation process is as follows: Figure 1 As shown, it is abbreviated as EcN-EC, which contains the recombinant plasmid p15A-EC.

[0050] 1. Preparation of recombinant plasmids for genetically engineered probiotics:

[0051] In this embodiment, the recombinant plasmid p15A-EC has a vector backbone of p15A-Ptet-dacA-KanR, containing a kanamycin resistance gene. After cleaving the 52nd base with XmnI / PdmI restriction enzyme, the artificially synthesized ethanol response element AlcR transcription unit-ethanol metabolite hADH1B-hALDH2 transcription unit was inserted using the Gibson Assembly method to obtain the p15A-EC recombinant plasmid. The plasmid map of this recombinant plasmid is shown below. Figure 1 The left side of the figure shows that two sequences have 40 bp homologous sequences at both ends, which can be used by the Gibson Assembly's T5 exonuclease to form specific sticky ends; the homologous sequences are the lowercase underlined portion (forearm) and uppercase underlined portion (hindarm) of the nucleotide sequence shown in SEQ ID NO.1.

[0052] The nucleic acid sequence of the vector backbone p15A-Ptet-dacA-KanR is shown in SEQ ID NO.1, as follows:

[0053] ggagtgtatac tggcttactatgttggcactgatgagggtgtcagtgaagtGCTTCATGTGGCAGGAG AAAAAAGGCTGCACCGGTGCGTC

[0054] The nucleic acid sequence of the ethanol-responsive element AlcR transcription unit is shown in SEQ ID NO.2, as follows:

[0055] tggcttactatgttggcactgatgagggtgtcagtgaagt ctttgccacg TTTATGGCTAGCTCAGTC CTAGGTACAATGCTAGC atgcgtacctgacgat cgtacgcttaggctacgtagctag The ethanol-responsive element AlcR transcriptional unit is the AlcR gene from *Emericella nidulans*; the promoter is the synthetic promoter J23114 (uppercase with an underline); the ribosome binding site is the synthetic sequence B0032 (uppercase), which expresses the AlcR protein; the Gibson Assembly homologous sequence is the lowercase with an underline. The AlcR gene can undergo structural changes upon binding to ethanol or acetaldehyde, interact with specific promoter sequences, and induce the expression of downstream proteins.

[0056] The nucleic acid sequence of the ethanol-metabolizing enzyme hADH1B-hALDH2 transcription unit is shown in SEQ ID NO.3, as follows:

[0057] atgcgtacctgacgatcgtacgcttaggctacgtagctag cgatgctagcTGCGGAGCCGCATATGCGCCGCATCGGCATCCGCATATGCGTGCGGAACCGCATATGCGTGCGGAGCCGCATATGCGCCGCATCGGCATCCGCATATGCGTGCGGAACCGCATATGCGTGCGGAGCCGCAtatatattatatatatatatat[tttacggctagctcagtcctaggtacaatgctagc]atcg TCTAGAGAAAGAGGAGAAATACTAG gcttcatgtggcaggagaaaaaaggctgcaccggtgcgtc The promoter of the ethanol metabolite hADH1B-hALDH2 transcription unit is Palc×7, which is the uppercase portion of the sequence. It is a 7-fold repeat sequence from the core functional region of the AlcR promoter of *Emericella nidulans*, which can bind to the activated AlcR gene and induce the expression of the downstream hADH1B and hALDH2 genes. There is also a synthetic promoter J23110 that can maintain a small amount of inherent hADH1B and hALDH2 expression to cope with the transient degradation of ethanol. It is the lowercase portion within square brackets in the sequence. The ribosome binding site is the synthetic sequence B0034, which is the uppercase underlined portion of the sequence. The GibsonAssembly homologous sequence is the lowercase underlined portion.

[0058] The above fragments are chemically synthesized. Gibson Assembly reaction: Take 4 μL each of the following three fragment mixtures (p15A-Ptet-dacA-KanR fragment mixture, AlcR transcription unit fragment mixture, and hADH1B-hALDH2 transcription unit fragment mixture) at a concentration of 50 ng / μL, and mix them to obtain a mixture with a total DNA volume of 150 ng (i.e., the p15A-Ptet-dacA-KanR fragment, AlcR transcription unit fragment, and hADH1B-hALDH2 transcription unit fragment are mixed in a mass ratio of 1:1:1, resulting in a total DNA volume of 150 ng in the mixture). Add 4 μL of 5×Gibson buffer, 0.5 μL of T5 exonuclease (10 U / μL), 0.5 μL of Phusion polymerase (2 U / μL), and 1 μL of T4 ligase (400 U / μL), and add enzyme-free water to a final volume of 20 μL; incubate at 50°C for 30 minutes. After 10 minutes, the enzyme was inactivated by heating at 65°C for 10 minutes; the reaction product was transformed into DH5α competent cells, plated on kanamycin-resistant plates, and cultured overnight at 37°C; single clones were picked and plasmids were extracted, and the recombinant plasmid p15A-EC was obtained by enzyme digestion verification and sequencing confirmation.

[0059] 2. Preparation and production of genetically engineered probiotic for relieving hangovers, EcN-EC:

[0060] Bacterial culture: Single colonies of the probiotic strain Escherichia coli EcN (Escherichia coli Nissle 1917) were picked from fresh plates and inoculated into 10 mL of LB broth. The culture was incubated overnight at 37°C with shaking at 200 rpm for 12 hours. The next day, the overnight culture was transferred to fresh LB broth at a volume ratio of 1:100 and incubated under the same conditions until the bacterial OD reached the target value. 600 Reaching 0.5 (approximately 3 hours).

[0061] Cell cooling and harvesting: Incubate the bacterial culture at 4°C on ice for 30 minutes, then aliquot it into pre-cooled centrifuge tubes and centrifuge at 4°C and 2000×g for 10 minutes to collect the cells.

[0062] CaCl2 treatment and preparation of competent cells: Discard the supernatant, add 1 mL of pre-cooled 100 mM CaCl2 solution, and gently resuspend the cells. Then incubate again at 4°C on ice for 30 minutes.

[0063] Aliquoting and storage: After centrifugation at 4℃ for 5 minutes, discard the supernatant, resuspend the bacterial cells in pre-cooled CaCl2 solution, and aliquot 100μL into pre-cooled sterile centrifuge tubes to obtain Escherichia coli probiotic strain EcN competent cells for transformation.

[0064] Add plasmid DNA: Take a tube of 100 μL of Escherichia coli probiotic strain EcN competent cells, add 5 μL of p15A-EC recombinant plasmid, mix gently, and incubate on ice for 30 minutes.

[0065] Heat shock treatment: Place the centrifuge tubes in a 42°C water bath for a precise 90-second heat shock, then quickly return them to ice and let them stand for 2 minutes.

[0066] Resuscitation culture: Add 1 mL of antibiotic-free LB medium to the tube, mix well, and incubate at 37°C and 200 rpm for 60 minutes to allow the cells to recover and express the resistance gene, thus obtaining the resuscitated genetically engineered alcohol-reducing probiotic EcN-EC bacterial solution.

[0067] Spreading and Cultivation: Take 100 μL of the revived genetically engineered alcohol-reducing probiotic EcN-EC and spread it on an LB agar plate containing 5 μg / mL kanamycin antibiotic. After the bacterial solution is absorbed by the plate, invert the plate and incubate at 37℃ for 12 hours, observing the transformation results. Pick the successfully transformed colonies and transfer them to 10 mL of LB medium, which is the genetically engineered alcohol-reducing probiotic EcN-EC, ready for use.

[0068] 3. Preparation of genetically engineered probiotic EcN-EC@PCPC for relieving hangovers:

[0069] Preparation of coating solutions: (1) Coating solution 1: Dissolve 80 mg of polylysine in 40 mL of a solution containing 0.5 M sodium chloride and 20 mM 2-morpholine ethanesulfonic acid to make a polylysine solution with a concentration of 2 mg / mL, and precisely adjust the pH to 6; (2) Coating solution 2: Dissolve 80 mg of carboxymethyl inulin in 40 mL of a solution containing 0.5 M sodium chloride and 20 mM 2-morpholine ethanesulfonic acid to make a carboxymethyl inulin solution with a concentration of 2 mg / mL, and precisely adjust the pH to 6.

[0070] Layer-by-layer self-assembly of EcN-EC, a genetically engineered probiotic for relieving hangovers: (1) Take 10 mL of LB medium containing EcN-EC and transfer the overnight culture to fresh LB medium at a volume ratio of 1:100. Incubate at 37°C and 200 rpm with shaking until the bacterial culture reaches OD. 600 Reaching 0.5 (approximately 3 hours), centrifuge at 2000×g for 10 minutes, collect the bacterial cells, and wash twice with a solution containing 0.5M sodium chloride and 20mM 2-morpholine ethanesulfonic acid (pH 6). (2) Take the above coating solution 1 to resuspend the bacterial cells, incubate at 37℃ and 200rpm for 60 minutes with shaking, centrifuge at 2000×g for 10 minutes, collect the bacterial cells and wash (the first layer of the genetically engineered alcohol-reducing probiotic EcN-EC). (3) Take the above coating solution 2 to resuspend the bacterial cells, incubate at 37℃ and 200rpm for 60 minutes with shaking, centrifuge at 2000×g for 10 minutes, collect the bacterial cells and wash (the second layer of the genetically engineered alcohol-reducing probiotic EcN-EC). (4) Repeat steps (2) and (3) once more (the third and fourth layers of the genetically engineered alcohol-reducing probiotic EcN-EC) to form a multi-layer self-assembled coating of polylysine-carboxymethyl inulin-polylysine-carboxymethyl inulin on the surface of the genetically engineered alcohol-reducing probiotic EcN-EC. (5) The bacterial culture was resuspended in a solution containing 0.5M sodium chloride and 20mM 2-morpholine ethanesulfonic acid (pH 6) to obtain 10mL of bacterial culture. 0.5mL of 1.0% calcium chloride solution was added, and the culture was incubated at 37℃ and 200rpm for 10 minutes with shaking. The culture was then centrifuged at 2000×g for 10 minutes. The bacterial cells were collected and washed twice with a solution containing 0.5M sodium chloride and 20mM 2-morpholine ethanesulfonic acid (pH 6). The culture was then resuspended again with a solution containing 0.5M sodium chloride and 20mM 2-morpholine ethanesulfonic acid (pH 6) to obtain the genetically engineered alcohol-reducing probiotic EcN-EC@PCPC.

[0071] 4. Ethanol-induced enhanced expression of EcN-EC, a genetically engineered probiotic for relieving hangovers:

[0072] A sequence with the same active element but a read frame of enhancement green fluorescent protein (eGFP) was added after the hADH1B-hALDH2 transcription unit of the ethanol metabolite in the p15A-EC recombinant plasmid, as shown in SEQ ID NO.4. Specifically, p15A-EC-EGFP was constructed using the same method as in the step "Preparation of Genetically Engineered Probiotic Recombinant Plasmid". Subsequently, the genetically engineered alcohol-clearing probiotic EcN-EC-EGFP was prepared using the same method as in "Preparation and Production of Genetically Engineered Alcohol-Clearing Probiotic EcN-EC".Subsequently, different concentrations of ethanol solution were used to induce an increase in eGFP expression. The fluorescence intensity of eGFP was measured under a confocal laser microscope to reflect the content of hADH1B and hALDH2. Meanwhile, the Escherichia coli probiotic strain EcN was used as a control group (Ctrl).

[0073] Depend on Figure 2 It was found that the fluorescence intensity was 0 in the Ctrl group without plasmid transfection. The genetically engineered alcohol-reducing probiotic EcN-EC-EGFP, in the absence of alcohol, exhibited basal expression due to the presence of a synthetic promoter, producing a small amount of green fluorescence. With increasing ethanol concentration, the intensity of induced green fluorescence further increased, showing a dose-response relationship. The amount of induced green fluorescence reached its maximum at a 2.0% ethanol concentration; further increases in ethanol concentration did not change the fluorescence intensity or slightly decreased it. This indicates that ethanol can effectively induce the expression of hADH1B and hALDH2.

[0074] 5. Verification of the effectiveness of the competitive advantage for survival:

[0075] A plasmid containing the ethanol-responsive element AlcR transcription unit of p15A-hADH1B-hALDH2 was constructed. In this plasmid, the ethanol-metabolizing enzyme hADH1B-hALDH2 transcription unit was modified by replacing the synthetic promoter J23110 and the ethanol-responsive promoter Palc×7 with the artificially synthesized constitutive promoter J23100. The nucleotide sequence is shown in SEQ ID NO. 5, specifically ttgacggctagctcagtcctaggtacagtgctagc, meaning the synthetic promoter J23110 and the ethanol-responsive promoter Palc×7 in the nucleic acid sequence of the ethanol-metabolizing enzyme hADH1B-hALDH2 transcription unit were replaced with the constitutive promoter J23100. Downstream, the same constitutive promoter J23100 as the ethanol-metabolizing enzyme hADH1B-hALDH2 transcription unit (nucleotide sequence shown in SEQ ID NO. 5) was used. As shown in ID NO. 6, specifically, ttgacggctagctcagtcctaggtacagtgctagc) expresses mCherry red fluorescent protein, that is, the constitutive promoter J23100 is added before the sequence encoding mCherry red fluorescent protein, and the sequence encoding mCherry red fluorescent protein is as shown in SEQ ID NO.As shown in Figure 6, specifically, p15A-EC-mCherry was constructed using the same method as in the step "Preparation of Recombinant Plasmids for Genetically Engineered Probiotics". Subsequently, it was transformed into the Escherichia coli probiotic strain EcN to construct the genetically engineered bacterium EcN-com, using the same method as in "Preparation and Production of Genetically Engineered Probiotic for Resolving Alcohol Consumption EcN-EC".

[0076] A survival competitive advantage verification experiment was conducted using genetically engineered bacteria EcN-com and genetically engineered probiotics for hangover relief EcN-EC to demonstrate that the genetically engineered probiotics for hangover relief EcN-EC have superior adaptability. The steps are as follows:

[0077] (1) The culture medium used in the survival competitive advantage efficacy verification process was: 50 mL M9 minimum culture medium (Na2HPO4·7H2O 12.8 g, KH2PO4 3.0 g, NaCl 0.5 g, NH4Cl 1.0 g, glucose 4.0 g, MgSO4·7H2O 0.24 g and CaCl2·2H2O 0.011 g, adjusted to 1 L).

[0078] (2) The culture conditions for verifying the effectiveness of survival competitive advantage are: 37℃, 200rpm shaking culture.

[0079] (3) Validation process of survival competitive advantage: Hour 0: Mix the two strains (genetically engineered EcN-com and genetically engineered alcohol-reducing probiotic EcN-EC) that have been pre-cultured to mid-log phase at a ratio of 1:1, and initially inoculate with OD 600 =0.05 Immediately collect zero-time samples (T0); 0-12 hours: Monitor the initial competition between the two strains under ethanol-free conditions, sampling time points: 0, 4, 8, and 12 hours; 12-24 hours: Add ethanol to a final concentration of 2% (v / v) at 12 hours (the proportion at 12 hours is measured immediately after induction) to monitor the rapid response of the induced strain, sampling time points: 16, 20, and 24 hours; 24-36 hours: Replace with fresh ethanol-free medium by centrifugation at 24 hours to observe the recovery ability of the strains under stress-free conditions, sampling time points: 28, 32, and 36 hours; 36-48 hours: Add ethanol again to a final concentration of 2% (v / v) at 36 hours (the proportion at 36 hours is measured immediately after induction) to assess the reproducible responsiveness of the system, sampling time points: 40, 44, and 48 hours; 48-72 hours: Maintain ethanol-free conditions until the end of the experiment to monitor the stability of the competitive pattern, sampling time points: 52, 56, 60, 64, 68, and 72 hours.

[0080] (4) Method for detecting the effectiveness of survival competitive advantage: Take 100 μL of culture medium and dilute it appropriately to 10. 6 -10 7 Cells / mL, prepare microscope slides. Bright-field imaging: total cell count (≥500 cells / sample). Fluorescence imaging: eGFP-positive cell count (488nm excitation / 510nm emission), ≥10 independent fields of view for each parallel sample analysis. Inducible proportion = eGFP-positive cells / total cells. Perform triple replicates to plot the survival advantage competition between the genetically engineered alcohol-curing probiotic EcN-EC and the genetically engineered bacterium EcN-com (EcN-EC vs EcN-com).

[0081] (5) Results of survival competitive advantage effectiveness test: by Figure 3It can be seen that, initially, the EcN-EC / EcN-com ratio was slightly less than 1. During the first 12 hours of ethanol induction, both bacteria maintained a certain logarithmic growth, and the ratio did not change significantly, indicating no competitive pressure. After the first ethanol induction, the proportion of the genetically engineered alcohol-dissolving probiotic EcN-EC began to increase. The expression level of ethanol-metabolizing enzymes in the induced EcN-EC strain increased by more than 10-fold under ethanol induction, exceeding that of the constitutive EcN-com strain, allowing it to adapt to the ethanol environment more quickly, reaching approximately 2.5-fold after ethanol induction. Subsequently, after changing to a fresh culture medium, the growth of the EcN-com strain slightly recovered, but the proportion remained above 2-fold. After a second ethanol induction at 36 hours, the proportion of the genetically engineered alcohol-dissolving probiotic EcN-EC strain increased significantly, reaching 5.5-fold at 48 hours. This was followed by a competitive steady state lasting up to 72 hours. Although the proportion of the genetically engineered alcohol-reducing probiotic EcN-EC fluctuated, it remained above 3.5 times, indicating that the inducible strains with ethanol responsiveness have a greater survival advantage in the ethanol-adapted environment than the constitutive strains without responsiveness.

[0082] 6. Verification of the effectiveness of layer-by-layer self-assembly coating:

[0083] Fluorescein isothiocyanate-labeled polylysine (FITC-PLL) was used to replace polylysine for coating, and anthocyanin 5-labeled carboxymethyl inulin (Cy5-CMI) was used to replace carboxymethyl inulin for coating. The coating process was the same as the layer-by-layer self-assembly in the "Preparation of EcN-EC@PCPC" step. The fluorescence intensity of each coating layer was measured under a confocal fluorescence microscope. The above-mentioned ordinary polylysine and carboxymethyl inulin were used for layer-by-layer self-assembly coating, and the zeta potential of each coating layer was measured using a Malvern particle size analyzer. The changes in zeta potential were used to further verify the layer-by-layer self-assembly.

[0084] Depend on Figure 4 It can be seen that both FITC-labeled polylysine and Cy5-labeled carboxymethyl inulin produce fluorescence after coating, and the fluorescence intensity increases with the number of coating layers, with the fluorescence intensity increasing by about 2 times, indicating that the layer-by-layer self-assembly coating is successful. Figure 5 The Zeta potential further illustrates that the coating principle is due to electrostatic deposition. As the number of coating layers increases, the surface charge of the genetically engineered alcohol-curing probiotic EcN-EC changes accordingly, exhibiting periodic charge changes. The surface of the uncoated EcN-EC is negatively charged. The first layer of polylysine carries a positive charge, causing EcN-EC to become positively charged. The second layer of carboxymethyl inulin carries a negative charge and then becomes negatively charged again.

[0085] 7. Genetically engineered probiotic EcN-EC@PCPC colonization in vivo:

[0086] To evaluate the survival and colonization ability of the engineered probiotic EcN-EC@PCPC for relieving hangovers in the gut, the fluorescence content was measured in vitro in mice using in vitro imaging based on the basal expression fluorescent protein characteristics of EcN-EC-eGFP. Six female Balb / c mice were each administered 100 μL of uncoated EcN-EC (with an effective viable count of 102) by gavage. 8 CFU), genetically engineered alcohol-clearing probiotic EcN-EC@Alg microcapsules encapsulated with sodium alginate (Alg) (effective live bacteria count of 10). 8 CFU), and genetically engineered alcohol-reducing probiotics EcN-EC@PCPC (effective live bacteria count of 10) after layers of self-assembly coating. 8 CFU was used to image mice using an in vivo IVIS imaging system 3 hours later, and the fluorescence was quantitatively analyzed.

[0087] The preparation process of EcN-EC@Alg microcapsules is as follows: Activated genetically engineered EcN-EC probiotic suspension is mixed with cooled 20 mg / mL sodium alginate solution at a volume ratio of 1:4. The mixture is gently stirred with a magnetic stirrer to avoid vigorous stirring and generating bubbles, resulting in a sodium alginate mixture containing probiotics. The mixture is then drawn up using a 31G insulin syringe and vertically dripped into a beaker containing 20 mg / mL CaCl2 solution. Upon falling into the CaCl2 solution, a gel film immediately forms on the surface of the droplet, which then forms a gel bead and sinks in the solution. The mixture is allowed to stand for 30 minutes to allow for full cross-linking and solidification, resulting in a more stable internal structure. The gel beads are then filtered through a sterile sieve or gauze and collected. The mixture is gently rinsed twice with sterile physiological saline to remove residual CaCl2 solution and incompletely cross-linked sodium alginate from the surface.

[0088] Depend on Figure 6 It can be seen that the genetically engineered probiotic EcN-EC without layer-by-layer self-assembly coating has poor colonization in the intestine, with only a small number successfully colonizing. The EcN-EC@Alg microcapsules encapsulated with sodium alginate showed a higher colonization rate than the uncoated EcN-EC. The genetically engineered probiotic EcN-EC@PCPC, with its layer-by-layer self-assembly coating using polylysine and carboxymethyl inulin, effectively colonized the intestine in larger quantities, showing better colonization than the EcN-EC@Alg microcapsules. Figure 7Fluorescence integral statistics show that the fluorescence intensity of the genetically engineered alcohol-reducing probiotic EcN-EC@PCPC, after layer-by-layer self-assembly, is approximately 5 times stronger than that of the uncoated colonized strain, and twice that of the EcN-EC@Alg microcapsules. This indicates that layer-by-layer self-assembly effectively enhances the colonization ability of the genetically engineered alcohol-reducing probiotic EcN-EC in the intestines.

[0089] 8. Verification of the efficacy of genetically engineered hangover-relieving probiotic EcN-EC@PCPC in alleviating acute hangovers:

[0090] Animals: SPF-grade healthy male BALB / c mice, 9 weeks old, weighing 25±2g.

[0091] Number and Grouping: Twenty-five mice were randomly divided into five groups of five each: negative control group, blank control group, EcN-EC group, EcN-EC@PCPC group, and EcN-p15A group. The negative control group received saline solution; the blank control group received saline solution and baijiu (Chinese liquor); the EcN-EC group received EcN-EC bacterial culture and baijiu; the EcN-EC@PCPC group received EcN-EC@PCPC bacterial culture and baijiu; and the EcN-p15A group received EcN-p15A bacterial culture and baijiu.

[0092] Preparation and administration of bacterial culture: After the genetically engineered probiotic EcN-EC for alcohol detoxification was cultured on a large scale, it was coated to prepare genetically engineered probiotics EcN-EC, EcN-EC@PCPC, and EcN-p15A (containing the vector backbone p15A-Ptet-dacA-KanR Escherichia coli probiotic strain EcN). All three were resuspended in sterile physiological saline to the target concentration: 5 × 10⁻⁶. 9 CFU / mL (approximately 5 × 10⁻⁶) 7 (CFU / g BW, calculated based on 0.1 mL per 10 g mouse) is used as a stock solution for drug administration.

[0093] Dosage regimen: Mice were fasted for 3 hours before the experiment but allowed free water, and fasted and withheld water for the last hour to ensure uniform gastrointestinal status. Administered via gavage, with a uniform volume of 0.01 mL / g BW for all gavages. Each group of mice received the drug as described above. Two hours after gavage administration of the test substance, commercially available Erguotou (56% vol) was diluted to 50% vol with physiological saline. Based on preliminary experiments, a dose of 5.5 g / kg BW was determined to induce stable, moderate intoxication.

[0094] Behavioral observations: Intoxication latency period: the time from the end of alcohol gavage to the first disappearance of the righting reflex in mice. Intoxication sleep duration: the time from the disappearance of the righting reflex to the first spontaneous recovery of the righting reflex in mice. Observations and records were conducted blinded by one researcher who was unaware of the group assignments.

[0095] Sample Collection and Indicator Detection: Four hours after behavioral observation, mice were anesthetized via gavage, and blood samples were collected. The eyeballs were enucleated, and blood was drawn from the retro-orbital venous plexus. The blood was centrifuged at 3000×g for 15 min at room temperature to obtain serum. Detection Indicators: ALT levels in the serum of each group of mice were measured using an alanine aminotransferase (ALT / GPT) assay kit. AST levels in the serum of each group of mice were measured using an aspartate aminotransferase (AST / GOT) assay kit. Ethanol concentration in the serum was measured using an ethanol content detection kit. Acetaldehyde concentration in the serum was measured using an acetaldehyde content detection kit.

[0096] Depend on Figure 8 and Figure 9 It can be seen that the negative control group remained conscious throughout the process. The blank control group had the fastest onset of intoxication (the onset time is the time point of intoxication, i.e., the intoxication latency period, with the initial time point calculated from the time of alcohol administration), averaging 560 seconds, and a recovery time (the recovery time is the time point of recovery, i.e., the intoxication latency period plus the duration of intoxicated sleep, with the initial time point calculated from the time of alcohol administration) of 12680 seconds. The situation was similar for the EcN-p15A group (EcN-p15A group), which only contained the backbone of the recombinant plasmid without complete function, with an onset time of 520 seconds and a recovery time of 13250 seconds. This indicates that the Escherichia coli probiotic strain EcN and its plasmid backbone do not possess alcohol-detoxifying functions. The genetically engineered hangover-relieving probiotic EcN-EC, without coating, had an average intoxication time of 1590 seconds and a recovery time of 10170 seconds. In contrast, the genetically engineered hangover-relieving probiotic EcN-EC@PCPC, with its layered self-assembly coating, had an average intoxication time of 4580 seconds and a recovery time of 8170 seconds. In conclusion, the genetically engineered hangover-relieving probiotic EcN-EC@PCPC has a delaying effect on central nervous system depression caused by alcoholism and can accelerate the relief of central nervous system depression.

[0097] Depend on Figure 10 It was found that the serum ethanol level in the negative control group was 2.6 μmol / L. The serum ethanol levels in the blank control group and the EcN-p15A group were similar, at 315.6 μmol / L and 315.0 μmol / L, respectively. The serum ethanol level in the EcN-EC group was 271.2 μmol / L, and the serum ethanol level in the EcN-EC@PCPC group was 192.6 μmol / L. The EcN-EC@PCPC group effectively reduced the concentration of ethanol entering the bloodstream. Figure 11The results showed that the serum acetaldehyde level in the negative control group was 1.42 μg / mL, and in the blank control group it was 3.50 μg / mL. The serum acetaldehyde concentration in the EcN-p15A group was slightly lower than that in the blank control group at 3.31 μg / mL, the serum acetaldehyde level in the EcN-EC group was 2.75 μg / mL, and the serum acetaldehyde level in the EcN-EC@PCPC group was 2.038 μg / mL. The EcN-EC@PCPC group effectively reduced the acetaldehyde level in the blood. Acetaldehyde is an important source of alcoholic liver toxicity, and reducing the acetaldehyde level can effectively reduce liver damage caused by alcohol consumption.

[0098] Depend on Figure 12 and Figure 13 The results showed that the serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities in the negative control group were 23.0 U / L and 63.0 U / L, respectively; in the blank control group, they were 211.6 U / L and 205.8 U / L, respectively; in the EcN-p15A group, they were close to those in the blank control group, at 209.8 U / L and 199.4 U / L, respectively; in the EcN-EC group, they were both 120.6 U / L; and in the EcN-EC@PCPC group, they were 60.4 U / L and 71.0 U / L, respectively. In conclusion, the genetically engineered alcohol-reducing probiotic EcN-EC@PCPC reduces liver damage caused by excessive alcohol consumption by decreasing the entry of ethanol and acetaldehyde into the bloodstream.

[0099] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An ethanol-responsive genetically engineered probiotic for relieving hangovers, EcN-EC, characterized in that, The ethanol-responsive genetically engineered alcohol-reducing probiotic EcN-EC uses Escherichia coli probiotic strain EcN as the substrate bacteria and introduces a recombinant vector containing the ethanol-responsive element AlcR transcription unit and the ethanol-metabolizing enzyme hADH1B-hALDH2 transcription unit. The nucleic acid sequence of the ethanol-responsive element AlcR transcription unit is shown in SEQ ID NO.2; The nucleic acid sequence of the ethanol metabolizing enzyme hADH1B-hALDH2 transcription unit is shown in SEQ ID NO.

3.

2. The ethanol-responsive genetically engineered hangover-relieving probiotic EcN-EC according to claim 1, characterized in that, The basic plasmid of the recombinant vector is p15A-Ptet-dacA-KanR; the nucleic acid sequence of p15A-Ptet-dacA-KanR is shown in SEQ ID NO.

1.

3. The method for constructing the ethanol-responsive genetically engineered alcohol-reducing probiotic EcN-EC as described in claim 1, characterized in that, A recombinant vector containing the ethanol-responsive element AlcR transcription unit and the ethanol-metabolizing enzyme hADH1B-hALDH2 transcription unit was introduced into the Escherichia coli probiotic strain EcN to obtain the ethanol-responsive genetically engineered alcohol-reducing probiotic EcN-EC.

4. The construction method according to claim 3, characterized in that, The basic plasmid of the recombinant vector is p15A-Ptet-dacA-KanR; the nucleic acid sequence of p15A-Ptet-dacA-KanR is shown in SEQ ID NO.

1.

5. The use of the ethanol-responsive genetically engineered alcohol-relieving probiotic EcN-EC as described in claim 1 or 2 in the preparation of products for relieving acute alcohol poisoning.

6. A product for relieving acute alcohol poisoning, characterized in that, The product for relieving acute alcohol poisoning includes the ethanol-responsive genetically engineered alcohol-relieving probiotic EcN-EC as described in claim 1 or 2.

7. The product for relieving acute alcohol poisoning according to claim 6, characterized in that, The product for relieving acute alcohol poisoning also includes a coating agent; the coating agent includes polylysine and carboxymethyl inulin.

8. The product for relieving acute alcohol poisoning according to claim 7, characterized in that, The dosage forms of the products used to relieve acute alcohol poisoning include granules, powders, and oral liquids.

9. The method for preparing the product for relieving acute alcohol poisoning according to claim 7, characterized in that, Includes the following steps: (1) The ethanol-responsive genetically engineered alcohol-reducing probiotic EcN-EC was resuspended in polylysine solution to obtain cell 1; (2) Bacterial cells 1 were resuspended in carboxymethyl inulin solution to obtain bacterial cells 2; (3) Repeat steps (1) and (2) once to obtain the product for relieving acute alcohol poisoning.

10. The preparation method according to claim 9, characterized in that, The concentration of polylysine in the polylysine solution is 2 mg / mL; the concentration of carboxymethyl inulin in the carboxymethyl inulin solution is 2 mg / mL.

Citation Information

Patent Citations

  • Recombinant lactococcus lactis, microcapsule and application thereof

    CN114426942A

  • Lactobacillus casei for producing acetaldehyde dehydrogenase, anti-alcohol probiotic composition and preparation method thereof

    CN116622559A

  • Probiotic metagen composition for relieving uncomfortable symptoms after drinking and application of probiotic metagen composition

    CN117801991A

  • Lactobacillus acidophilus capable of relieving acute alcoholic liver injury and application of lactobacillus acidophilus

    CN117987307A

  • Probiotic composition for relieving acute drunkenness as well as preparation method and application thereof

    CN120210079A