A plant constitutive expression promoter and its application
By constructing recombinant expression vectors using the DNA sequences of SEQ ID NO.1-6 in rice, the problem of insufficient stability of constitutive promoters in rice genetic engineering was solved, and efficient gene expression and herbicide resistance were improved in various tissues of rice.
Patent Information
- Application Number
- CN202610401500.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-30
- Publication Date
- 2026-06-05
AI Technical Summary
The lack of constitutive promoters derived from rice that are efficiently and stably expressed in various tissues in current rice genetic engineering has affected the application effect of transgenic rice.
A plant constitutive expression promoter, selected from the DNA sequences of SEQ ID NO.1-6, is provided for constructing a recombinant expression vector and introducing it into a plant to regulate gene expression in various plant tissues.
This study achieved efficient and stable gene expression driving in various tissues of rice, cultivated ideal transgenic plant varieties, and improved the herbicide resistance of rice.
Smart Images

Figure CN122146704A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering, specifically to a plant constitutive expression promoter and its applications. Background Technology
[0002] Rice, as one of the world's most important food crops, feeds nearly half the world's population. Improving its yield, quality, and stress resistance has always been a core research focus in the field of agricultural biotechnology. With the rapid development of plant genetic engineering technology, targeted modification of rice gene expression patterns to cultivate superior varieties has become an important method. In this process, the promoter, as a key cis-regulatory element controlling gene transcription initiation and expression intensity, determines the gene expression intensity and spatiotemporal expression pattern within rice.
[0003] In plant gene expression systems, promoters are generally classified into three categories based on their expression patterns: constitutive promoters, inducible promoters, and tissue-specific promoters. Constitutive promoters can drive the continuous expression of target genes in almost all tissues, organs, and throughout the entire growth and developmental stage of a plant, without relying on specific environmental signals or developmental stage regulation. Inducible promoters initiate gene expression under the influence of specific environmental stimuli or activating factors, while tissue-specific promoters, under their regulation, generally result in the expression of exogenous genes only occurring in cells or tissues of certain specific origins.
[0004] Constitutive promoters can function without relying on specific environmental signals or developmental stages for regulation. This characteristic makes constitutive promoters an important tool in plant genetic engineering research, especially in gene function studies and the construction of transgenic crops, where they can ensure the effectiveness and stability of transgenic expression systems.
[0005] Currently, the most widely used constitutive promoters in plant genetic engineering are the CaMV 35S promoter and the ubiquitin promoter, both derived from Cauliflower Mosaic Virus (CaMV). The CaMV 35S promoter, in particular, possesses strong transcriptional driving capabilities and is widely used in the construction of gene expression vectors for dicotyledonous plants and some monocotyledonous plants. However, because this promoter is derived from a virus, its long-term stability in the rice genome has not been verified, thus affecting its application effectiveness. While the Ubiquitin promoter can be expressed in various rice tissues, its expression level is significantly influenced by the growth and development stage, potentially affecting the optimal expression of the gene at specific growth and developmental stages.
[0006] Therefore, discovering a constitutive expression promoter derived from rice that can be efficiently and stably expressed in all rice tissues is of great application value for breaking through the current bottlenecks in rice genetic engineering technology, promoting the molecular breeding process and commercial application of transgenic rice. Summary of the Invention
[0007] To address the aforementioned technical problems, this invention provides a plant constitutive expression promoter and its application. This plant constitutive expression promoter can regulate the strong expression of genes in various tissues of the plant. The promoter is derived from the natural plant genome and has efficient and stable transcriptional activity, making it suitable for various species and tissues.
[0008] Therefore, the present invention provides the following technical solution:
[0009] In a first aspect, the present invention provides a plant constitutive expression promoter in optional embodiments, wherein the plant constitutive expression promoter is selected from the DNA sequence shown in one of SEQ ID NO. 1-6.
[0010] Preferably, the DNA sequence of the plant constitutive expression promoter has at least 80% homology with the above-mentioned DNA sequence; or, the plant constitutive expression promoter is a mutant, allele, or derivative generated by adding, substituting, inserting, or deleting one or more nucleotides in the above-mentioned DNA sequence; or, the plant constitutive expression promoter has a product that hybridizes with the above-mentioned DNA sequence.
[0011] In this invention, these plant constitutive promoters have the same function as the DNA sequences described above, namely, driving the expression of target genes in plants.
[0012] Secondly, in an optional embodiment, the present invention provides an expression cassette containing the above-mentioned plant constitutive expression promoter, which is used to introduce the gene into the plant via in vivo or in vitro DNA manipulation techniques to control the expression intensity and spatiotemporal expression characteristics of the driven gene.
[0013] Thirdly, in optional embodiments, the present invention provides a recombinant expression vector comprising the aforementioned plant constitutive expression promoter; in the recombinant expression vector, the plant constitutive expression promoter is linked upstream of the gene sequence to be expressed in the vector. Preferably, the gene to be expressed is the GUS gene, and the vector is pCAMBIA1305. This recombinant expression vector is obtained by constructing the promoter PosHT3-0 / 1 / 2 / 3 / 4 / 5 in pCAMBIA1305, and linking the promoter PosHT3-0 / 1 / 2 / 3 / 4 / 5 upstream of the GUS gene, denoted as pCAMBIA1305-PosHT3-0 / 1 / 2 / 3 / 4 / 5.
[0014] Fourthly, in optional embodiments, the present invention provides a host bacterium comprising the aforementioned plant constitutive expression promoter, the aforementioned expression cassette, or the aforementioned recombinant expression vector. Preferably, the host bacterium is Agrobacterium tumefaciens.
[0015] Fifthly, in optional embodiments, the present invention provides a transformant comprising the above-described plant constitutive expression promoter, the above-described expression cassette, the above-described recombinant expression vector, or the above-described host bacteria. The transformant is preferably a transgenic cell, callus tissue, or plant.
[0016] In a sixth aspect, the present invention provides, in optional embodiments, the application of the above-mentioned plant constitutive expression promoter in the cultivation of genetically engineered plants, the application comprising: linking or recombining the above-mentioned plant constitutive expression promoter to the upstream of the gene sequence to be expressed, and cultivating genetically engineered plants with the target genome expressed in a shaped manner; the plant is a monocotyledonous plant, the monocotyledonous plant including rice, wheat, corn, barley, sorghum or oats, preferably rice.
[0017] Furthermore, the DNA sequence of the plant constitutive expression promoter provided by this invention can be linked to a plant binary expression vector to replace the constitutive promoter. Moreover, the DNA sequence of this plant constitutive expression promoter can be linked to a desired target gene to construct a recombinant plant expression vector. After transformation, this constitutive promoter can drive the expression of the target gene in the plant.
[0018] In a seventh aspect, the present invention, in optional embodiments, provides an application of the above-mentioned plant constitutive expression promoter in enhancing the herbicide resistance of rice, the application including:
[0019] (1) The above-mentioned plant constitutive expression promoters were linked to rice herbicide resistance genes to construct an overexpression vector;
[0020] (2) Transform the overexpression vector from step (1) into Agrobacterium and screen for positive Agrobacterium;
[0021] (3) After removing the shells and sterilizing the rice seeds, the embryos were separated and inoculated into the callus culture medium to obtain primary callus, and the primary callus was pre-cultured.
[0022] (4) Mix the pre-cultured callus tissue from step (3) with the positive Agrobacterium tumefaciens solution from step (2) for infection;
[0023] (5) The infected callus tissue was transferred to a co-culture medium lined with sterile filter paper for culture;
[0024] (6) After co-culture, the callus tissue was transferred to the differentiation medium and cultured under light to induce shoot differentiation. When the differentiated shoots grew to 2-3 cm, they were transferred to the rooting medium to induce root growth.
[0025] The nucleotide sequence shown in SEQ ID NO.1 is as follows:
[0026]
[0027] The nucleotide sequence shown in SEQ ID NO.2 is as follows:
[0028]
[0029] The nucleotide sequence shown in SEQ ID NO.3 is as follows:
[0030]
[0031] The nucleotide sequence shown in SEQ ID NO.4 is as follows:
[0032]
[0033] The nucleotide sequence shown in SEQ ID NO.5 is as follows:
[0034] cgaaaatcgggttgagaacaagtagagggacccaaagtgaacttattcccaaggaaaatgaatttatggcaataatgtattttacgatttgctccagaatttgtatgttttctcacaagaagtgcgtataggatagcgaatttcacatttaccctacaaattctggagcaaatcgtaaaatacattatgcgtaatatagagagaaacatgcctaatattccatccatacggtatcctatgttaagacaagaacatgcctaatatgcctaatatagagagaaacaaatactatgaaaaaaaacaatagtataggctttgtttagttcacacaaaaattaaaagtttgattaaaattgaaacaatgtgacggaaaagttgaaagtttgtgtgtaggaaagttttgatataatgaaaaagttggaagtttgaagaattattttggaactaaacacggcgtcaaacttatttggatcctgacacttaaacgcggaattcggcccaaatagtacaagtgcccacgccgctgaacaggcccaccagcccatataacatatgccacgtcaccgatccgtggtgctgagctctccaaccaaccagcgacgagcacacggatcgtgtgctttctacggcctatcactagccgtcggatccgatcgcgatcccgaaacctttcctcaaacggtcacaagaaaccgcctcggtccacgcgtccactgcccccccgcaacccacgctctccagccccgcgcctataaaaatccccccacctcccctcctccctctcactgttcgcctttccacgccagtttggtcgctctcgatttcgatttcccccaaatccaccgcaagagaaagccaagtc。
[0035] The nucleotide sequence shown in SEQ ID NO.6 is as follows:
[0036] acaagaacatgcctaatatgcctaatatagagagaaacaaatactatgaaaaaaaacaatagtataggctttgtttagttcacacaaaaattaaaagtttgattaaaattgaaacaatgtgacggaaaagttgaaagtttgtgtgtaggaaagttttgatataatgaaaaagttggaagtttgaagaattattttggaactaaacacggcgtcaaacttatttggatcctgacacttaaacgcggaattcggcccaaatagtacaagtgcccacgccgctgaacaggcccaccagcccatataacatatgccacgtcaccgatccgtggtgctgagctctccaaccaaccagcgacgagcacacggatcgtgtgctttctacggcctatcactagccgtcggatccgatcgcgatcccgaaacctttcctcaaacggtcacaagaaaccgcctcggtccacgcgtccactgcccccccgcaacccacgctctccagccccgcgcctataaaaatccccccacctcccctcctccctctcactgttcgcctttccacgccagtttggtcgctctcgatttcgatttcccccaaatccaccgcaagagaaagccaagtc。
[0037] The nucleotide sequence shown in SEQ ID NO.7 is as follows:
[0038] aattcggcccaaatagtacaagtgcccacgccgctgaacaggcccaccagcccatataacatatgccacgtcaccgatccgtggtgctgagctctccaaccaaccagcgacgagcacacggatcgtgtgctttctacggcctatcactagccgtcggatccgatcgcgatcccgaaacctttcctc aaacggtcacaagaaaccgcctcggtccacgcgtccactgcccccccgcaacccacgctctccagccccgcgcctataaaaatccccccacct cccctcctccctctcactgttcgcctttccacgccagtttggtcgctctcgatttcgatttcccccaaatccaccgcaagagaaagccaagtc.
[0039] Compared with the prior art, the present invention has the following beneficial effects:
[0040] The plant constitutive expression promoter provided by this invention, after genetic recombination, can regulate gene expression in plants and has significant value in practical applications. This promoter can be used to genetically modify crop varieties, such as by regulating the expression of target genes in plants, thereby cultivating ideal transgenic plant varieties. Attached Figure Description
[0041] Figure 1 This is a schematic diagram of the PosHT3-0 promoter constructed in the pCAMBIA1305 vector plasmid in Embodiment 1 of the present invention, wherein, Figure 1 A is a gel electrophoresis image of the PosHT3-0 promoter amplification. Figure 1 Image B is a gel electrophoresis result of pCAMBIA1305-PosHT3-0 double enzyme digestion. Figure 1 C is a schematic diagram of the pCAMBIA1305-PosHT3-0 vector, which uses the PosHT3-0 promoter to drive the expression of the Gus gene located downstream of it;
[0042] Figure 2 This is a schematic diagram of GUS staining results in different parts of transgenic rice with GUS gene expression driven by the PosHT3-0 promoter in Example 2 of the present invention. The Gus gene is expressed in the roots (Figure A), leaves (Figure B), stems (Figure C), leaf sheaths (Figure D), and flowers (Figure E) of the transgenic plant. The scale bar in the figure is 2 mm.
[0043] Figure 3This is the pCAMBIA1305 expression vector used in Example 3 of this invention for double enzyme digestion identification of the PosHT3 series promoters fused with the vector; M represents the marker, and from top to bottom, they represent 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp respectively. Wells 1 to 7 represent samples: PosHT3-0, PosHT3-1, PosHT3-2, PosHT3-3, PosHT3-4, PosHT3-5, and PosHT3-6 respectively;
[0044] Figure 4 This is a schematic diagram illustrating the detection of the activity of various truncated promoters in the PosHT3 series using GUS enzyme activity assay in Example 3 of the present invention.
[0045] Figure 5 This is a schematic diagram of GUS staining results of various parts of transgenic rice with GUS gene expression driven by the PosHT3-1 promoter in Example 4 of the present invention. The Gus gene is expressed in the root (A), leaf (B), stem (C), leaf sheath (D) and flower (E) of the transgenic plant. The scale bar in the figure is 2 mm.
[0046] Figure 6 This is a schematic diagram showing the results of real-time quantitative PCR detection of the expression levels of the PosHT3-0 and PosHT3-1-driven GUS genes in roots, stems, and leaves in Example 5 of the present invention.
[0047] Figure 7 This image shows the growth of transgenic rice plants in Example 6 of the present invention, in which PosHT3-1 and PosHT3-5 drive the expression of the OsALS gene, before and after herbicide application. Detailed Implementation
[0048] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
[0049] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0050] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0051] Example 1
[0052] This embodiment provides a method for preparing the promoter PosHT3-0 containing an enzyme cleavage site, including the following steps:
[0053] Based on the whole genome sequence of the rice variety Nipponbare provided in NCBI, amplification primers were designed according to the promoter sequence of the PosHT3-0 gene. Restriction enzyme sites were also designed based on the characteristics of the selected vector and the target gene. Specifically, the primers are: forward primer PosHT3 FP-0: TCTAGATctggaagcttcggcgtgagg, primer tctggaagcttcggcgtgagg, restriction enzyme site (TCTAGA); reverse primer PosHT3 RP-0: AAGCTTTgacttggctttctcttgcggtg, primer gacttggctttctcttgcggtg, restriction enzyme site (AAGCTT).
[0054] The forward and reverse primers were synthesized by Hefei Youkang Biotechnology Co., Ltd.
[0055] Using DNA from the rice variety Nipponbare as a template, the promoter PosHT3-0 was amplified using forward and reverse primers, following the amplification procedure according to a standard PCR system:
[0056] Pre-denaturation at 95℃ for 5 min; denaturation at 90℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 2 min, 35 cycles; finally extension at 72℃ for 5 min.
[0057] The target fragment amplified by PCR was recovered. The target fragment length was 2362 bp. Figure 1 As shown in Figure A, the fragment was ligated into the blunt-Simple T vector (purchased from Transgene, mixed according to the instructions). After transformation of *E. coli* XL-Blue competent cells using the heat shock method to activate the competent cells, the target fragment was then transferred into the activated competent cells. Positive clones were obtained through colony PCR screening. Plasmids were extracted from single clones via shaking and verified by double digestion with XbaI and HindIII. Figure 1 As shown in B, the identified positive clones were sequenced for verification, thus confirming that the correct positive clone was the desired promoter PosHT3-0, whose nucleotide sequence is shown in SEQ ID NO.1. The promoter length includes 2280 bp upstream of the transcription start site (TSS) and 81 bp downstream.
[0058] Plasmids were extracted from the prepared positive clones and digested with XbaI and HindIII to recover the PosHT3-0 promoter fragment. Simultaneously, pCAMBIA1305 was linearized using XbaI and HindIII, and pCAMBIA1305 was recovered. The PosHT3-0 fragment and the pCAMBIA1305 fragment were ligated using a fast ligase (purchased from NEB) to obtain the plant expression vector pCAMBIA1305-PosHT3-0, which fused the PosHT3-0 promoter with the GUS gene (see [link to documentation]). Figure 1 C), the plant expression vector pCAMBIA1305-PosHT3-0 was transformed into Agrobacterium tumefaciens EHA105 using the freeze-thaw method.
[0059] Example 2
[0060] This embodiment provides a method for driving the expression of the GUS reporter gene in rice using the PosHT3-0 promoter, specifically as follows:
[0061] (1) After removing the husks from mature seeds, soak the seeds in 70% alcohol for 1 min, discard the alcohol, and then soak the seeds in a 50% sodium hypochlorite solution containing 1 drop of Tween 20 (the effective chlorine concentration of the original solution is greater than 4%) for 40 min (150 r / min). Then discard the sodium hypochlorite and wash the seeds 5 times with sterile water until the solution is clear and has no sodium hypochlorite odor. Soak the seeds in sterile water overnight, and use a scalpel to peel off the aleurone layer of the pretreated seeds to remove the embryo. Inoculate the embryo onto the callus induction medium. After dark culture at 30℃ for 11 days, separate the callus from the endosperm and embryo. Pre-culture the primary callus tissue that is in good condition and dividing vigorously for 3-5 days before using it for Agrobacterium transformation. Agrobacterium tumefaciens transformed with the recombinant expression vector prepared in Example 1 was subjected to Agrobacterium-mediated genetic transformation. The genetic transformation, transformant selection, and transgenic plant regeneration were performed according to the methods proposed by Yongbo Duan (Yongbo Duan, Chenguang Zhai, et al. An efficient and high-throughput protocol for Agrobacterium mediated transformation based on phosphomannose isomerase positive selection in Japonica rice (Oryza sativa L.)[J]. Plant Cell Report, 2012.DOI 10.1007 / s00299-012-1275-3.). Fifteen pCAMBIA1305-PosHT3-0 plants (PosHT3-0::GUS transgenic rice plants) were obtained.
[0062] (2) Following the method proposed by Jefferson (Jefferson RA et al. GUS fusion: β-Glucuronidase as a sensitive and versatile gene fusion marker in higher plant[J].EMBO J., 1987, 6:3901-3907), the tissue to be stained was vacuum-sealed and then immersed in the staining solution for 24 hours at 37°C. For destaining, 95% ethanol was used at 37°C until the negative control material turned white. After staining the PosHT3-0::GUS transgenic plant tissue, the roots of the transgenic plant ( Figure 2 A), Leaf ( Figure 2 B), stem ( Figure 2 C) Leaf sheath ( Figure 2 D), Flower ( Figure 2The expression in E) indicates that PosHT3-0 is a constitutive promoter.
[0063] Example 3
[0064] To find the constitutive promoters with optimal activity, the applicant conducted numerous truncation and validation experiments on this series of promoters using different methods. The following describes some typical stage lengths as examples. Based on the whole genome sequence of the rice variety Nipponbare provided in NCBI, and using the primers in Table 1 (forward primers were PosHT3 FP-1 / 2 / 3 / 4 / 5 / 6, and reverse primers were all PosHT3 RP-0), the truncated promoter fragments -1996~+81, -1478~+81, -1086~+81, -780~+81, -535~+8, and -290~+81 were cloned and named PosHT3-1, PosHT3-2, PosHT3-3, PosHT3-4, PosHT3-5, and PosHT3-6, respectively. The promoter sequences are shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7.
[0065]
[0066] Promoter fragments of different lengths were inserted between the XbaI and HindIII sites of the pCAMBIA1305 vector to construct fusion expression vectors for the GUS gene driven by each truncated promoter, named PosHT3-1::GUS, PosHT3-2::GUS, PosHT3-3::GUS, PosHT3-4::GUS, PosHT3-5::GUS, and PosHT3-6::GUS, respectively.
[0067] The recombinant plasmids PosHT3-0::GUS, PosHT3-1::GUS, PosHT3-2::GUS, PosHT3-3::GUS, PosHT3-4::GUS, PosHT3-5::GUS, and PosHT3-6::GUS were verified by double digestion with XbaI and HindIII, and the results are as follows: Figure 3 As shown in the figure. The above expression vectors were introduced into Agrobacterium and used for rice genetic transformation, yielding 20-30 positive transgenic plants from each vector. Two to four single-copy insert lines were selected from each vector for subsequent promoter activity analysis.
[0068] Ten-day-old seedlings of T1 generation transgenic plants from each vector were collected, and their GUS protein activity was measured. Results are as follows: Figure 4As shown, the applicant discovered that the activity of the promoter varied significantly with different lengths. Specifically, when the promoter was truncated from -2280 to -1996, the GUS activity increased from 8876.10 pmol 4-MU / min / mg protein to 10790.17 pmol 4-MU / min / mg protein. Subsequently, when the promoter was truncated from -1996 to -1478 and -1086, respectively, the GUS activity decreased from 10790.17 pmol 4-MU / min / mg protein to 7872.38 pmol 4-MU / min / mg protein. Further truncation to -780 and -535 resulted in a continuous decrease in GUS activity. When the promoter was truncated to -290, the GUS activity dropped sharply to 889.32 pmol 4-MU / min / mg protein, essentially losing its driving ability. This indicates that different truncation methods have a significant impact on the activity of this promoter, and can even lead to its inactivation. Overall, the PosHT3-1 promoter has the highest activity. When the PosHT3-0 promoter is truncated to -535 (i.e., PosHT3-5), its activity is about half that of the PosHT3-1 promoter. When it is truncated further, it is essentially inactive.
[0069] Example 4
[0070] As can be seen from the experiment in Example 3, PosHT3-1 has the highest activity among the PosHT3 series promoters. Therefore, the promoter activity of PosHT3-1 is further analyzed.
[0071] Fifteen pCAMBIA1305-PosHT3-1 plants (PosHT3-1::GUS transgenic rice plants) were subjected to GUS staining. Following the method proposed by Jefferson et al. (Jefferson RA et al. GUS fusion: β-Glucuronidase as a sensitive and versatile gene fusion marker in higher plant[J]. EMBO J., 1987, 6:3901-3907), the tissues to be stained were vacuum-sealed and then immersed in the staining solution for 24 hours at 37°C. Destaining was performed by treating with 95% ethanol at 37°C until the negative control material turned white. After staining the PosHT3-1::GUS transgenic plant tissues, staining was performed on the roots of the transgenic plants (… Figure 5 A), stem ( Figure 5 B), Leaf Figure 5 C) Leaf sheath ( Figure 5 D), Flower ( Figure 5 E) Callus tissue ( Figure 5 PosHT3-1 was expressed in F), and the GUS staining results are shown in [F1]. Figure 5 .
[0072] Example 5
[0073] Quantitative PCR (RT-qPCR) detection of PosHT3-1 promoter activity
[0074] GUS staining and quantitative activity analysis indicated that both PosHT3-0 and PosHT3-1 are constitutive promoters. To verify the relative activity of PosHT3-0 and PosHT3-1, RNA was extracted from 10-day-old transgenic seedlings, reverse transcribed into cDNA, and real-time quantitative PCR (RT-qPCR) was used to detect changes in GUS gene expression driven by PosHT3-0 and PosHT3-1. Transgenic plants with GUS expression driven by Ubiquitin (UBI) were used as controls.
[0075] The total RNA extraction kit from Tiangen Plant Materials Co., Ltd. (Beijing) (TIANGEN, centrifuge column type, DP432) was used. The obtained RNA was used for cDNA reverse transcription according to the following procedure: 5 μL RNase-Free ddH2O, 2 μL 5×gDNA buffer, and 3 μL RNA were added to an RNase-free centrifuge tube and incubated at 42℃ for 3 min, then placed on ice. To the above reaction solution, 5 μL RNase-Free ddH2O, 2 μL FQ-RT Primer Mix, 2 μL 10×Fast RT Buffer, and 1 μL RTEnzyme Mix were added sequentially and mixed thoroughly. The mixture was incubated at 42℃ for 15 min, then at 95℃ for 3 min, and finally placed on ice. This yielded cDNA.
[0076] RT-qPCR was performed using the SuperReal real-time quantitative PCR kit (TIANGEN, SYBR Green, FP205) from Tiangen Biotech (Beijing). The rice ACTIN gene was used as an internal control to quantify the amount of RNA template used. Two... –ΔΔCT (ΔCT = CT target gene – CT internal reference gene; ΔΔCT = ΔCT treated gene – ΔCT control gene) The obtained signals and data were processed. Each gene was tested in triplicate. The quantitative primers used in this experiment were:
[0077] Actin-FP, 5'-CCTGACGGAGCGTGGTTAC-3'; and Actin-RP, 5'-CCAGGGCGATGTAGGAAAGC-3' were used for ACTIN amplification;
[0078] GUS-FP, 5'-TACGGCAAAGTGTGGGTCAATAATCA-3' and GUS-RP, 5'-CAGGTGTTCGGCGTGGTGTAGAG-3' are used for GUS amplification.
[0079] like Figure 6 As shown, the expression levels of the GUS gene in the roots, stems, and leaves of PosHT3-0 and PosHT3-1 transgenic plants were detected, with the GUS expression level driven by the UBI promoter as a reference (set as expression level 1). The results showed that both PosHT3-0::GUS and PosHT3-1::GUS transgenic plants exhibited good expression activity, with the latter showing significantly stronger expression than both the former and the UBI promoter. GUS expression levels were high in the roots, stems, and leaves. This result indicates that PosHT3-0 and PosHT3-1, especially PosHT3-1, are constitutively strong promoters capable of driving efficient gene expression in different tissues.
[0080] Example 6
[0081] The potential applications of PosHT3-1 and PosHT3-5 promoters in driving functional gene expression
[0082] To further verify the function and application potential of the PosHT3-1 promoter in driving gene expression, overexpression vectors encoding the ALS S627N target gene of imidazolinone herbicides, driven by the optimally lengthped PosHT3-1 promoter and its truncated promoter PosHT3-5, were constructed and named PosHT3-1::OsALS and PosHT3-5::OsALS, respectively. These vectors were transformed into Agrobacterium and then genetically transformed into rice, yielding 5–10 T0 positive plants from each vector. To further evaluate the effect of promoter activity differences on herbicide resistance phenotype, herbicide spraying experiments were conducted on the obtained T1 transgenic plants.
[0083] Herbicide-resistant transgenic rice was transplanted into the soil. When the plants reached the 3-4 leaf stage, they were sprayed with methoxyfenozide at a field-recommended concentration of 4 times. Results showed that before herbicide application, all transgenic plants grew normally. After spraying, plants carrying PosHT3-1::OsALS continued to grow normally without showing obvious phytotoxicity symptoms; however, plants carrying PosHT3-5::OsALS showed obvious phytotoxicity symptoms such as leaf yellowing and wilting 7 days after spraying, and died completely by day 14. Figure 7This result indicates that the optimal promoter length PosHT3-1 has stronger transcriptional activity than its shorter version PosHT3-5, and can more effectively drive the expression of downstream ALS genes, thereby conferring higher herbicide tolerance to rice, which in turn can lead to the breeding of rice varieties with higher herbicide tolerance.
[0084] Those skilled in the art should immediately recognize that by linking the constitutive promoter of the present invention to genes for different traits such as drought resistance, salt tolerance, and flood resistance, the corresponding genes can be expressed efficiently, thereby enabling the cultivation of rice varieties with better traits.
[0085] In summary, the PosHT3 series promoters, preferably the PosHT3-0 to PosHT3-5 promoters, and more preferably the PosHT3-1 promoter of optimal length, can serve as promoter elements driving strong gene expression and show higher application value in herbicide-resistant breeding and related genetic engineering applications.
[0086] Although the principles of the present invention have been described in detail above with reference to preferred embodiments, those skilled in the art should understand that the above embodiments are merely illustrative explanations of the present invention and are not intended to limit the scope of the present invention. The details in the embodiments do not constitute a limitation on the scope of the present invention. Any obvious changes, such as equivalent transformations or simple substitutions, based on the technical solutions of the present invention without departing from the spirit and scope of the present invention fall within the protection scope of the present invention.
Claims
1. A plant constitutive expression promoter, characterized in that, The plant constitutive expression promoter is selected from the DNA sequence shown in one of SEQ ID NO. 1-6.
2. The plant constitutive expression promoter according to claim 1, characterized in that, The DNA sequence of the plant constitutive expression promoter has at least 80% homology with the DNA sequence of claim 1; or, The plant constitutive expression promoter is a mutant, allele, or derivative generated by adding, substituting, inserting, or deleting one or more nucleotides in the DNA sequence of claim 1; or, The plant constitutive expression promoter has a product that hybridizes with the DNA sequence of claim 1.
3. An expression box, characterized in that, The plant constitutive expression promoter contained in claim 1 or 2 is used to be introduced into a plant via in vivo or in vitro DNA manipulation techniques to control the expression intensity and spatiotemporal expression characteristics of the driven gene.
4. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the plant constitutive expression promoter as described in claim 1 or 2; In the recombinant expression vector, the plant constitutive expression promoter is linked upstream of the gene sequence to be expressed in the vector.
5. A host bacterium, characterized in that, It includes the plant constitutive expression promoter of claim 1 or 2, the expression cassette of claim 3, or the recombinant expression vector of claim 4.
6. A transformant, characterized in that, It comprises the plant constitutive expression promoter of claim 1 or 2, the expression cassette of claim 3, the recombinant expression vector of claim 4, or the host bacterium of claim 5.
7. The application of a plant constitutive expression promoter as described in claim 1 or 2 in the cultivation of genetically engineered plants, characterized in that, The application includes: genetically linking or recombining the plant constitutive expression promoter of claim 1 or 2 upstream of the gene sequence to be expressed, and cultivating genetically engineered plants with the target genome expressed in a standardized manner.
8. The application according to claim 7, characterized in that, The plant is a monocotyledonous plant, including rice, wheat, corn, barley, sorghum, or oats.
9. The application of a plant constitutive expression promoter as described in claim 1 or 2 in improving plant growth characteristics.
10. The application of the plant constitutive expression promoter according to claim 1 or 2 in improving the herbicide resistance of rice, characterized in that, The applications include: (1) Connect the plant constitutive expression promoter described in claim 1 or 2 to the rice herbicide resistance gene to construct an overexpression vector; (2) Transform the overexpression vector from step (1) into Agrobacterium and screen for positive Agrobacterium; (3) After removing the shells and sterilizing the rice seeds, the embryos were separated and inoculated into the callus culture medium to obtain primary callus, and the primary callus was pre-cultured. (4) Mix the pre-cultured callus tissue from step (3) with the positive Agrobacterium tumefaciens solution from step (2) for infection; (5) The infected callus tissue was transferred to a co-culture medium lined with sterile filter paper for culture; (6) After co-culture, the callus tissue was transferred to the differentiation medium and cultured under light to induce shoot differentiation. When the differentiated shoots grew to 2-3 cm, they were transferred to the rooting medium to induce root growth.