BrCUC2 gene and application

Abstract

The application belongs to the field of plant genetic engineering, and relates to a BrCUC2 gene and application, wherein the nucleotide sequence of the BrCUC2 gene is shown as SEQ ID NO. 1. The application provides the BrCUC2 gene and application which can solve the problem of a molecular mechanism of a response of a white cabbage type winter rape to low-temperature stress and can cultivate a cold-resistant new variety (line).

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, and relates to a cold-resistant gene and its application, particularly the application of a BrCUC2 gene in enhancing the cold resistance of rapeseed. Background Technology

[0002] Rapeseed is an important oilseed crop widely cultivated globally, playing a crucial role in ensuring edible oil supply and promoting agricultural economic development. It also functions as a green manure and honey source, contributing to ecological construction and diversified agricultural development. However, intensified global climate change has led to frequent abiotic stresses such as low temperatures and drought, severely restricting rapeseed growth and causing a decline in yield and quality. Low temperature is a key stressor, with seedlings being highly sensitive to it. Low temperatures inhibit amylase and protease activity, delaying endosperm nutrient absorption, resulting in insufficient energy supply and stunted growth in seedlings. Simultaneously, it damages cell membrane integrity, triggering electrolyte leakage and reactive oxygen species (ROS) bursts, damaging biomolecules and causing seedling leaf wilting, root rot, and even death, threatening production. During the vegetative growth stage, rapeseed's sensitivity to low temperatures is slightly lower, but low temperatures still reduce photosynthetic efficiency, inhibit nutrient absorption, interfere with vernalization in winter rapeseed, leading to slow growth and exacerbating yield losses. Adaptive defense mechanisms during the seedling stage are particularly critical, which can enhance cold resistance by accumulating osmotic substances such as proline and activating antioxidant enzymes such as SOD and POD to maintain cellular homeostasis. Therefore, improving the cold resistance of winter rapeseed and elucidating the mechanism of cold resistance genes are crucial to ensuring its safe overwintering, reducing low-temperature damage, and increasing productivity and yield.

[0003] CUC (CUP-SHAPED COTYLEDON) genes are important transcription factor encoding genes belonging to the NAM superfamily. Their encoded proteins contain highly conserved NAC domains, are primarily located in the cell nucleus, and possess self-activation properties. During growth and development, they participate in apical meristem formation, organ boundary delineation, and leaf margin morphogenesis. Through a feedback regulatory loop with auxin, they determine the formation and distribution of leaf teeth and are crucial for the normal separation of lateral organs. The CUC gene promoter contains multiple stress-response elements, whose function is closely related to regulating apical meristem activity to resist low-temperature damage. The characteristics of CUC genes in Chinese rapeseed and their functions in low-temperature stress response remain largely unexplored. Summary of the Invention

[0004] In order to solve the above-mentioned technical problems in the background art, the present invention provides a BrCUC2 gene and its application that can solve the problem of the molecular mechanism of the response of Chinese cabbage-type winter rapeseed to low temperature stress and can be used to cultivate cold-resistant new varieties (lines).

[0005] To achieve the above objectives, the present invention adopts the following technical solution: A BrCUC2 gene, characterized in that: the nucleotide sequence of the BrCUC2 gene is shown in SEQ ID NO.1.

[0006] The BrCUC2 gene mentioned above regulates the low-temperature stress resistance of Chinese cabbage-type rapeseed.

[0007] The BrCUC2 gene positively regulates the low-temperature stress resistance of Chinese cabbage-type rapeseed.

[0008] The BrCUC2 gene has been used in screening, identifying, distinguishing, or breeding plants with cold-resistant traits, as previously described.

[0009] As previously described, the BrCUC2 gene is used in the screening, identification, differentiation, or breeding of rapeseed with cold-resistant traits.

[0010] As previously described, the BrCUC2 gene is used in the screening, identification, differentiation, or breeding of winter rapeseed of the Chinese cabbage type with cold-resistant traits.

[0011] Biological materials containing the BrCUC2 gene as described above are characterized in that: the biological material is an expression cassette, expression vector, host cell, cloning vector, or engineered bacteria.

[0012] The application of biomaterials in enhancing plant resistance to low-temperature stress, as previously described.

[0013] The aforementioned plants are Arabidopsis thaliana or rapeseed.

[0014] A method for enhancing the cold resistance of plants, characterized in that the method includes the following steps: 1) Obtain the BrCUC2 gene as described above; 2) Based on the BrCUC2 gene obtained in step 1), biological materials containing the BrCUC2 gene were obtained; 3) The biological material obtained in step 2) is transferred into plants to finally obtain plants with cold resistance traits.

[0015] The present invention has the following technical effects: Based on transcriptome sequencing data of Chinese rapeseed (Brassica napus), this invention identified a CUC family gene from Chinese rapeseed and named it BrCUC2. The nucleotide sequence of this gene is shown in SEQ ID NO.1. Molecular characterization analysis showed that the N-terminus of the BrCUC2 protein contains a highly conserved NAC domain. Tissue-specific expression analysis showed that this gene is highly expressed mainly in the meristematic tissues of the plant, especially at the growth cone. Abiotic stress response detection confirmed that the BrCUC2 gene has a significant response to low-temperature stress; further promoter function verification experiments showed that low-temperature stress can significantly enhance the expression activity of the reporter gene driven by the BrCUC2 promoter. After targeted editing of the BrCUC2 gene in Chinese rapeseed, the cold resistance of the transgenic edited plants was significantly weakened; compared with wild-type plants, the malondialdehyde (MDA) content in brCUC2-edited plants was significantly increased, while the activities of antioxidant enzymes such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) were significantly reduced. The above research results indicate that the BrCUC2 gene positively regulates the low-temperature stress resistance of Chinese cabbage-type rapeseed, and knocking out this gene significantly reduces the plant's cold resistance. This invention not only reveals the molecular regulatory mechanism of the BrCUC2 gene in the low-temperature stress response of Chinese cabbage-type winter rapeseed, but also provides important gene resources and technical support for breeding new germplasm of low-temperature resistant Chinese cabbage-type winter rapeseed and creating new cold-resistant varieties (lines). Attached Figure Description

[0016] Figure 1 This is a diagram showing the tissue expression analysis results of the BrCUC2 gene provided by this invention; Figure 2 These are the results of qPRC analysis of BrCUC2 gene expression levels under low temperature stress. Figure 3 This is a schematic diagram of the predicted results of the regulatory elements in the BrCUC2 promoter region; Figure 4 This is a GUS histochemical staining image of Arabidopsis thaliana plants overexpressing BrCUC2 under low-temperature treatment; Figure 5 This is a diagram showing the construction process and identification results of genetically modified rapeseed; Figure 6 These are phenotypic observation diagrams of transgenic lines and wild-type plants under low-temperature treatment; Figure 7 It is a statistical graph of MDA content, relative conductivity, and antioxidant enzyme (SOD, POD, and CAT) activities in transgenic lines and wild-type plants under low-temperature treatment. Figure 8 These are cell structure observation diagrams of transgenic lines and wild-type plants under low-temperature treatment; Figure 9These are tissue sections of transgenic lines and wild-type plants under low-temperature treatment. Detailed Implementation

[0017] This invention provides a BrCUC2 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0018] For example, the BrCUC2 gene provided by this invention regulates the low-temperature stress resistance of Chinese cabbage-type rapeseed, especially it can positively regulate the low-temperature stress resistance of Chinese cabbage-type rapeseed.

[0019] The application of the BrCUC2 gene provided by this invention in screening, identifying, distinguishing or cultivating plants with cold-resistant traits, wherein the plants are rapeseed, especially winter rapeseed of the Chinese cabbage type.

[0020] Based on the BrCUC2 gene described above, this invention also provides a biomaterial containing this gene, wherein the biomaterial is an expression cassette, expression vector, host cell, cloning vector, or engineered bacteria. An example is the application of this biomaterial in enhancing the resistance of plants to low-temperature stress, wherein the plant is Arabidopsis thaliana or rapeseed.

[0021] This invention also provides a method for enhancing the cold resistance of plants, namely, introducing the aforementioned BrCUC2 gene into plant cells through genetic transformation, targeting and editing the gene to achieve functional expression in the plant, and then screening and cultivating transgenic edited plants with stable cold resistance traits. Specifically, the method includes the following steps: 1) Obtain the BrCUC2 gene as described above; 2) Based on the BrCUC2 gene obtained in step 1), biological materials containing the BrCUC2 gene were obtained; 3) The biological material obtained in step 2) is transferred into plants to finally obtain plants with cold resistance traits.

[0022] Specifically, the technical solution provided by the present invention will be described in detail through the following experiments or embodiments: 1. Materials and Methods 1.1 Plant materials and growing conditions Plant materials: Chinese cabbage-type rapeseed varieties “Longyou 7” (hereinafter referred to as L7) and “Longyou 99” (hereinafter referred to as L99) and Arabidopsis thaliana, and genetic transformation material was Brassica napus-type rapeseed variety Westar (WT), all provided by the rapeseed research group of the State Key Laboratory of Arid Habitat Crops, Gansu Agricultural University.

[0023] Two varieties of winter rapeseed, Longyou 7 and Longyou 99, were selected. The former is a strongly cold-resistant variety, while the latter is a weakly cold-resistant variety. Healthy seeds were selected, surface-sterilized with sodium hypochlorite, and thoroughly rinsed with distilled water. The seeds were then germinated in petri dishes. After transplanting the seedlings into pots, they were cultured until the 7-leaf stage. A control group (CK) without low-temperature treatment was used. Seedlings were then treated at 4℃ and -4℃ for 3 h and 24 h, respectively, with three replicates for each treatment. Ultrastructural analysis and GUS staining were performed on seedling samples. Leaves, roots, and cones of rapeseed were collected, frozen in liquid nitrogen, and then stored at -80℃ for total RNA extraction and reverse transcription.

[0024] Vectors: tissue localization vector pBIB-BASTA-GWR-GUS, plant expression vectors pSuper1300 and pHSE401 were all provided by the State Key Laboratory of Arid Habitat Crop Science, Gansu Agricultural University.

[0025] Agrobacterium: Agrobacterium tumefaciens GV3101, provided by the State Key Laboratory of Arid Habitat Crops, Gansu Agricultural University.

[0026] Table 1 Primer Sequences Table 2 Real-time quantitative PCR reaction system Table 3 Real-time quantitative PCR reaction procedure 1.2 Screening and characterization of the BrCUC2 gene Total RNA was extracted from samples of Chinese rapeseed (L7 and L99) using the RNAout kit (Tiandz, Beijing, China), and then reverse transcribed into cDNA using the RevertAid first-strand cDNA synthesis kit (MBI, USA). A novel CUC gene named BrCUC2 was identified in a database of low-temperature treated Chinese rapeseed seedlings using specific primers (details of the primers used are shown in SEQ ID NO. 8 and SEQ ID NO. 9 in Table 1). The gene sequence was analyzed using the NCBI database.

[0027] Nucleotide sequence of the BrCUC2 gene (SEQ ID NO.1) ATGGACGAATGGGTGATCTCTAGGGTTTTCAAGAAACCCGGGTTAGCTAATACCGGAGGCTCAGCAGAAGCAAGTATTAGCGTTAGCAATGGTACTGGTACATCTAAAAAGACAAAAATACCCTCGAACATCTCCACAAACTACCGTGAACAACCAAG CTCTCCTTCCTCCGTCTCACTTCCTCCTCTCCTTGACCCCACCACAACCCTCGGCTACACCGACAGCAGCTGGTCCTACGACAGCCGTAGCACCAACACACCCGTCATAACCACCGCAATAACCGAGCACGTGTCCTGTTTCTCCACTGCCACTACTA CAACTGCCTTGGGCTTAGATGTTGACGTCGACTCATTCAACCATCTTCTACCGCCTGTGCCGCCGGGGTTTGACCCTTTTCCTCGCTTTGTCTCGAGAAACGTCTCGTCTCTATCTAACTTTAGGTCGTTCCAAGAGAACTTCAATCACTTTCCTTAC TATGGGTCGTCTTCTGCATCCACCATGACCACACCCGTTAACCTGCCTTCTTCCCACGGTGGCACCGGGATGAACTACTGGCTACAGACGACGGCGGAAGAGAACGAGACAAAGGCCGGTCTGCTTAACGGTGGACTTGATTGCGTATGGAATTACTAG 1.3 Expression analysis of the BrCUC2 gene This invention investigated the tissue-specific expression of the BrCUC2 gene in Chinese rapeseed (Brassica napus) and its response to various abiotic stresses. For abiotic stress, normally grown Chinese rapeseed (Brassica napus) at the seven-leaf stage was exposed to low-temperature environments of 4℃ and -4℃. Samples were collected at different time intervals (0, 3, and 24 h) for gene expression analysis. For precision, each stress treatment was repeated three times. It should be noted that qPCR was used for the BrCUC2 gene expression analysis. The reaction system and procedure are detailed in Tables 2 and 3. The primers (F and R) used in the reaction system shown in Table 2 are SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5 from Table 1, respectively.

[0028] 1.4 Starter Cistern Component Analysis The 2000 bp promoter sequence upstream of the start codon of the BrCUC2 gene was extracted using TBtools. Subsequently, cis-regulatory elements in the sequence were analyzed using the PlantCARE website (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ). Next, the BrCUC2 promoter was inserted into the tissue localization vector pBIB-BASTA-GWR-GUS via homologous recombination. Arabidopsis thaliana was transiently transformed with Agrobacterium tumefaciens strain GV3101, and GUS staining was performed 2 days later to assess promoter activity. Simultaneously, Arabidopsis thaliana plants with the BrCUC2 promoter were exposed to stress, while control plants were grown at room temperature. Samples were collected after treatment for GUS histochemical staining.

[0029] 1.5 Construction of Arabidopsis thaliana transgenic with the BrCUC2 gene (1) Preparation of inoculated bacterial solution: Select a single colony of Agrobacterium containing a tissue localization vector and place it in LB liquid medium containing rifampicin (Rif) and kanamycin (Kan). Incubate overnight at 28°C and 220 rpm to allow the Agrobacterium bacterial solution to reach OD500. 600 =1.2-1.6; Activate the Agrobacterium bacterial suspension in the 2 mL collection tube, expand the bacterial suspension to 50 mL in LB medium, centrifuge at 6000 rpm for 5 min, and then resuspend it evenly with 5% sucrose solution. OD 600 After adjusting the value to 0.8, add 3 / 10000 of surfactant (Silwet L-77) for later use.

[0030] (2) Select strong Arabidopsis thaliana plants, cut off the fully opened flowers and mature siliques before infection, immerse the entire inflorescence in a petri dish containing bacterial solution for 1 min, remove and wipe off excess bacterial solution, culture in the dark at 25℃ for 24 h, and then continue to culture under light. Infect again after one week, for a total of 3 infections. Harvest seeds from individual Arabidopsis plants after they mature. Place the harvested Arabidopsis seeds in a 4℃ incubator for vernalization for 3 days, disinfect and sterilize them with 75% anhydrous ethanol and 15% sodium hypochlorite, and then sow them in 1 / 2 MS medium containing the herbicide Basta (1 / 10000) to screen for resistant seedlings (the plants that survive are positive seedlings), and transplant them for cultivation. After the seedlings grow, cut the leaves of the Arabidopsis plants, extract the DNA from the leaves using a DNA extraction kit, perform PCR detection, and harvest seeds from mature Arabidopsis plants. After vernalization treatment of the harvested Arabidopsis thaliana seeds, they were seeded in 1 / 2 MS medium containing Basta to screen for homozygous transgenic Arabidopsis thaliana plants, thus obtaining homozygous transgenic Arabidopsis thaliana plants transgenic with the BrCUC2 gene.

[0031] 1.6 β-glucuronidase (GUS) staining Histochemical staining for GUS activity was performed by immersing herbicide-resistant (Basta) Arabidopsis plants in GUS staining solution with wild-type Arabidopsis as a control. After incubation at 37°C overnight, the plants were rinsed and soaked in 70% ethanol, and the GUS staining was observed by photographing.

[0032] 1.7 Construction of the BrCUC2 gene editing vector Following the target design principles, target sgRNAs were screened based on the CDS sequence of BrCUC2, and primers were designed (Table 4). Using plasmid pCBC-DT1T2 as a template, after PCR, the PCR product was purified and recovered, followed by enzyme digestion and ligation. The T4 enzyme ligation reaction and the BsaI digestion of the vector pHSE401 reaction were performed simultaneously. The reaction system and procedure are as follows (Table 5): E. coli DH5α were transformed, plated on LB medium containing Kans, and cultured overnight. The next day, colony PCR identification was performed, and positive clones were obtained by sequencing. Plasmids were then extracted. It should be noted that in Table 4, SEQ ID NO.10 and SEQ ID NO.11 are used in pairs; SEQ ID NO.12 and SEQ ID NO.13 are used in pairs for gene knockout; SEQ ID NO.14 and SEQ ID NO.16 are used in pairs for colony PCR identification; SEQ ID NO.14 and SEQ ID NO.15 are used in pairs for sequencing; and SEQ ID NO.17 and SEQ ID NO.18 are used in pairs for positive identification.

[0033] Table 4 Primer information for BrCUC2 gene editing vector construction Table 5 Reaction system and procedure for constructing gene editing vectors 1.8 Rapeseed genetic transformation (1) Preparation of explant hypocotyls and bacterial infection: In a clean bench, filter paper was moistened with M1 liquid medium, and the hypocotyls of Westar rape, which had been cultured in the dark for one week, were cut to 0.8-1 cm on the filter paper. The bacterial solution was obtained, centrifuged to obtain the precipitate, and the precipitate was resuspended with an equal volume of DM suspension. This process was repeated once. The bacterial solution was diluted 10 times with DM solution and then used to infect the explants. After 30 min of full infection, the explants were removed and transferred to M1 medium and cultured in the dark for 48 h.

[0034] (2) Induction of callus: After co-culturing for 48 h, the explants were transferred to M2 medium and cultured for 20 days in a culture room with alternating light and dark conditions of 16 h / 8 h at 24 ℃ to induce the formation of callus assemblages.

[0035] (3) Redifferentiation: Transfer the swollen callus tissue at both ends to M3 medium for redifferentiation. Use medium to subculture once every 2-3 weeks until adventitious shoots grow.

[0036] (4) The obtained adventitious buds are transferred to M4 rooting medium and cultured for 2-4 weeks to grow well-developed roots. The transformed seedlings are hardened off and transplanted into pots for culture one week later.

[0037] (5) Preparation of culture medium M0 medium: MS powder (Murashige and Skoog): 2.2 g / L, sucrose: 30 g / L, agar powder: 7.5 g / L.

[0038] M1 medium: MS powder: 4.43 g / L, glucose: 30 g / L, mannitol: 18 g / L, 2,4-D: 1 mg / L, kinetin KT: 0.3 mg / L, acetylsuccinone AS: 100 μM, agar powder: 7.5 g / L.

[0039] M2 medium: MS powder: 4.43 g / L, glucose: 30 g / L, mannitol: 18 g / L, 2,4-D: 1 mg / L, kinetin KT: 0.3 mg / L, AS: 100 μM, termethin, hygromycin, agar powder: 7.5 g / L.

[0040] M3 medium: MS powder: 4.43 g / L, glucose: 10 g / L, xylose: 0.25 g / L, 2,4-D: 1 mg / L, trans-Zeatin: 2 mg / L, indoleacetic acid (IAA): 0.1 mg / L, termethin, hygromycin, agar powder: 7.5 g / L.

[0041] M4 medium: MS powder: 4.43 g / L, glucose: 10 g / L, indolebutyrate (IBA): 1 mg / L, agar powder: 7.5 g / L.

[0042] DM medium: MS powder: 4.43 g / L, sucrose: 30 g / L, AS: 100 μM.

[0043] The prepared culture medium was adjusted to pH 5.8 and sterilized under high temperature and high pressure.

[0044] 1.9 PCR identification of transgenic lines Using a DNA extraction kit provided by TIANGEN, three cuc2 gene-edited plants that had differentiated into seedlings were selected for DNA extraction. Primers (SEQ ID NO. 6 and SEQ ID NO. 7 in Table 1) were designed approximately 200 bp upstream and downstream of the BrCUC2 target site. Using the DNA from the cuc2 gene-edited plants as templates, PCR amplification was performed according to the KOD Fx enzyme instructions. The amplification products were validated by gel electrophoresis, and after purification and recovery, the PCR products were sequenced.

[0045] 1.10 Measurement of physiological indicators The assays for SOD, POD, CAT, and MDA activities were performed using kits provided by Solarbio (Beijing, China).

[0046] 1.11 Determination and Calculation of Relative Conductivity The relative conductivity (REL) of plant leaves under gradient low-temperature stress of 0℃, -4℃, -8℃, -12℃, and -16℃ was determined using a DDS-307A conductivity meter (Shanghai Instrument & Electronics Scientific Instruments Co., Ltd.). Healthy leaves were collected, washed with deionized water, and leaf discs were prepared using a 1 cm diameter perforator. Three biological replicates were performed for each temperature gradient. The washing solution was discarded, and 10 ml of deionized water was added. The solution was allowed to stand at room temperature for 2 h, and the initial conductivity (C1) was measured. The leaves were then placed in low-temperature incubators at 0℃, -4℃, -8℃, -12℃, and -16℃ for 24 h, followed by a 2 h standing period to measure the conductivity (C2). Finally, the solution was boiled for 15 min, and the conductivity (C3) was measured. Calculation formula:

[0047] ×100 1.12 BrCUC2 knockout strains observed by transmission electron microscopy Fresh leaves from CUC2 knockout strains and wild-type Westar plants that have undergone room temperature and low temperature treatments were selected. Leaf tissues approximately 2 mm wide and 3 mm long were cut with a small blade and quickly placed in electron microscopy fixative (2.5% glutaraldehyde fixative) for fixation. The tissue was packed into the fixative with filter paper and stored at 4°C. The sample was rinsed three times (15 min each time) with 0.1 M phosphate buffer (pH 7.2). Then, it was dehydrated by gradient ethanol (30%, 50%, 70%, 80%, 85%, 90%, 95%, 100%, 15-20 min / gradient). The sample was then infiltrated with acetone:epoxy resin (2:1 → 1:1 → pure epoxy resin) at 37°C for 8-12 h each time. After infiltration, the sample was embedded in epoxy resin (polymerized at 60°C for 48 h). The ultrathin sections were stained with 2% uranium acetate-lead citrate double staining (room temperature, 15 min) and dried for electron microscopy.

[0048] 1.13 Paraffin section observation of BrCUC2 knockout strains (1) Sampling: Select fresh leaves of zat12 knockout strains and wild-type Westar after room temperature and low temperature treatment. Cut leaf tissues about 2 mm wide and 3 mm long with a small blade and quickly fix them in electron microscopy fixative (2.5% glutaraldehyde fixative). (2) Dewaxing treatment: After baking at 70℃ for 30 min, it is treated with xylene (I / II) for 10 min each, and finally soaked in 100% ethanol for 5 min to remove residual xylene. Then, it is treated with 100% ethanol (II) for 5 min to completely remove xylene residue. (3) Hydration treatment: The slices were sequentially hydrated with 95%, 85% and 75% ethanol in a gradient (5 min / gradient), and finally transferred to distilled water for later use; (4) Staining steps: First, stain with safranin for 1-2 hours, then rinse gently with running water, and then stain with fast green for 3-5 minutes; (5) Dehydration treatment: The product is dehydrated twice with anhydrous ethanol (5 min / time). (6) Transparency treatment: The sections were transparentized in steps with xylene (I / II) (5 min / time); (7) Sealing procedure: Apply a drop of neutral resin glue to the center of the paraffin section, and then place a coverslip to achieve a firm seal; (8) Microscopic analysis: Observe the sample and take pictures using a microscope.

[0049] 1.14 Statistical Analysis In each treatment, three plants were sampled from each of the three biological replicates. The mean and standard deviation (SD) for each treatment were calculated based on the data collected from these replicates. One-way analysis of variance (ANOVA) in SPSS v19.0 (SPSS Inc., Chicago, IL, USA) was used to assess the variance between the three edited lines and the control plants, with statistical significance set at P < 0.05 or P < 0.01.

[0050] 2. Results 2.1 BrCUC2 is strongly induced by low-temperature stress treatment To elucidate the response pattern of the BrCUC2 gene to abiotic stress, this invention used the cold-resistant variety Longyou 7 (L7) and the weakly cold-resistant variety Longyou 99 (L99) as experimental materials. Real-time quantitative PCR (qPCR) technology was employed to analyze the expression level of this gene in different tissues under low-temperature stress treatment. Figure 1 As shown in the figure. Expression profile analysis of leaves, growth cones, and roots revealed that, using leaves as a reference, BrCUC2 was significantly highly expressed in the growth cones of both varieties, with its expression level significantly higher in Longyou 7 than in Longyou 99. Specifically, the expression level of this gene in the growth cone of Longyou 7 was 12 times that in leaves, while in Longyou 99 it was 4.5 times. These results indicate that BrCUC2 exhibits expression specificity in different tissues of Chinese cabbage-type winter rapeseed, with the highest expression level in the growth cone, suggesting that it may play a key regulatory role in the development of the growth cone in Chinese cabbage-type winter rapeseed.

[0051] To further clarify the effect of low-temperature stress on BrCUC2 expression, two low-temperature gradients were set up: 4℃ and -4℃. Materials were treated for 3 h and 24 h, respectively, with room-temperature treatment serving as a control. The expression level of this gene in the growth cones was then detected. Figure 2 As shown in the data, the expression level of BrCUC2 showed a significant upward trend with decreasing treatment temperature and prolonged stress time, reaching a peak at -4℃ for 24 hours. Specifically, the expression level of this gene in Longyou 7 was 14 times that of the control, while in Longyou 99 it was 5 times, with the expression level in Longyou 7 being significantly higher than that in Longyou 99. In summary, there are significant differences in the expression of BrCUC2 in the growth cones of different cold-resistant varieties, and its expression level is positively correlated with the cold resistance of the variety. It is speculated that this gene may positively regulate the cold resistance of the growth cone of winter rapeseed (Brassica napus).

[0052] 2.2 Low temperature stress enhances BrCUC2 promoter activity To further elucidate the mechanism by which the BrCUC2 gene responds to stress, a 2000bp promoter fragment upstream of the BrCUC2 start codon was obtained using TBtools. Plant CARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) is used to predict regulatory elements within the promoter region, such as... Figure 3 As shown. The results indicated that the promoter region contained ABRE elements involved in abscisic acid and stress responses, TGA elements involved in auxin responses, and CAT-box elements involved in meristem expression. Tc-rich repeat sequences were involved in stress responses; ARE active elements were involved in anaerobic responses; Box4, GA-motif, GT1-motif, I-box, and TCT-motif active elements were involved in light responses; and multiple CAAT-box and CAT-box elements constituted the core promoter. To verify the expression pattern of BrCUC2, GUS tissue staining was performed on wild-type and transgenic Arabidopsis seedlings, as shown... Figure 4 As shown in the figure. The results indicate that GUS signaling is absent in wild-type Arabidopsis thaliana, but present in the leaf margins, stems, and growing points of transgenic Arabidopsis thaliana seedlings, suggesting that the BrCUC2 promoter cloned from rapeseed can drive the expression of downstream tissue-specific GUS reporter genes.

[0053] 2.3 Genetic transformation of rapeseed with the BrCUC2 gene To clarify the function of the BrCUC2 gene, this invention constructed an editing vector for this gene and designed two target sites targeting its CDS sequence, such as... Figure 5 A and Figure 5 B, of which Figure 5 A is a schematic diagram of the BrCUC2 gene editing structure; Figure 5 B is the BrCUC2 gene editing site. Using the rapeseed hypocotyl genetic transformation method, the editing vector was introduced into the rapeseed variety Westar, successfully obtaining BrCUC2 knockout mutant transgenic material. To verify the knockout effect of the transgenic material, samples were taken from the gene-edited seedlings and genomic DNA was extracted for PCR detection and identification (Table 1). Specifically, specific primers were designed with approximately 200 bp upstream and downstream of the BrCUC2 target site to amplify the extracted DNA by PCR, obtaining a 292 bp CUC2 gene fragment containing the target site. The PCR product was purified and sequenced. The results showed that, compared with the wild type, some gene-edited plants had base deletions or point mutations at the target site, such as... Figure 5 As shown in C ( Figure 5C represents the sequencing results of the BrCUC2 gene-edited plants, indicating that these plants are BrCUC2-positive knockout plants, i.e., brcuc2-KO plants.

[0054] 2.4 Identification of cold resistance in brcuc2-KO rapeseed plants After confirming a positive result, brcuc2-KO plants and wild-type (WT) plants were subjected to 0℃ low-temperature treatment for 4h, 8h, 12h, and 24h. (See [reference needed]) Figure 6 Phenotypic changes observed through photographs revealed no significant changes in the leaves of brcuc2-KO and wild-type plants after 4 hours of treatment. However, a clear distinction emerged after 8 hours of treatment at 0℃, with brcuc2-KO plants exhibiting wilting and drooping leaves. These changes became more pronounced with prolonged treatment. This further demonstrates the crucial role of BrCUC2 in the response of rapeseed to low-temperature stress.

[0055] 2.5 Physiological activity analysis of brcuc2-KO plants under low temperature stress This invention further measured various phenotypic indicators. The screened brcuc2-KO plants and wild-type plants were subjected to low-temperature treatment at 0℃ for 0h, 4h, 8h, 12h, and 24h, and leaf samples were collected to determine the malondialdehyde (MDA) content. The results showed that the MDA content of the gene knockout plants was significantly higher than that of the wild type at all treatment stages, reaching its highest level at 8h of treatment. Regarding relative conductivity, the relative conductivity of both brcuc2-KO and wild-type plants showed an increasing trend with decreasing treatment temperature, and the relative conductivity of brcuc2-KO plants was significantly higher than that of the wild type at all treatment stages. As for CAT, POD, and SOD activities, it was found that after low-temperature treatment, the activities of the three enzymes in both wild-type and gene knockout plants generally showed a trend of first increasing and then decreasing. At 12 hours of treatment, CAT activity in both gene knockout and wild-type plants reached its highest level, with wild-type CAT activity significantly higher than that in gene knockout plants. POD enzyme activity peaked at 8 hours of treatment, and then slowly declined with increasing treatment time, showing a significant difference. Among POD enzyme activities, the highest activity was observed at 12 hours of low-temperature treatment. In gene knockout plants, enzyme activity showed little change, with a slight decreasing trend at 12 hours of low-temperature treatment, exhibiting a significant difference from the wild-type. Figure 7 As shown in the figure. In summary, the activities of all three enzymes in BrCUC2 gene knockout plants were lower than those in wild-type plants.

[0056] 2.6 Ultracellular structural differences in brcuc2-KO plants under low temperature stress To reveal the changes in leaf tissue and cell structure of brcuc2-KO plants under low-temperature stress, this invention utilized transmission electron microscopy to analyze the ultrastructure of mesophyll cells from brcuc2-KO and wild-type control plants. Figure 8 As shown, the results indicated that, without low-temperature treatment, the ultrastructure of the mesophyll tissue in brcuc2-KO and wild-type plants showed no significant changes, with both possessing intact cell, chloroplast, and mitochondrial structures. However, after 0℃ low-temperature stress, the chloroplast morphology of brcuc2-KO plants was abnormal, exhibiting obvious plasmolysis, cell wall contraction and curling, cell membrane swelling, mitochondrial structure damage, and chloroplast lamellar disintegration. Furthermore, the plasmolysis and cell structure damage became more pronounced with prolonged low-temperature treatment. In contrast, no significant damage was observed to the ultrastructure of the mesophyll tissue in wild-type plants. The severe damage to brcuc2-KO plants further validates the crucial role of the BrCUC2 gene in the low-temperature stress response.

[0057] 2.7 Observation of tissue structure in brcuc2-KO plants under low temperature stress To further investigate the effects of the BrCUC2 gene on plants under low-temperature stress, this invention analyzed the leaf tissue structure of brcuc2-KO and wild-type plants. The results showed that, Figure 9 As shown, both wild-type and brcuc2-KO plants exhibit typical dicotyledonous leaf structures, including upper and lower epidermis, palisade tissue, spongy tissue, and vascular bundles. Under low-temperature stress, brcuc2-KO plants showed significant tissue structural damage, manifested as disordered epidermal cell arrangement, increased intercellular spaces and abnormal morphology in the spongy tissue, loose and deformed palisade tissue, and damaged vascular bundle structure. In contrast, wild-type plants maintained intact structures in all tissue layers, with orderly cell arrangement and regular morphology. In summary, under low-temperature stress, the cell structure and function of the epidermis, spongy tissue, palisade tissue, and vascular tissue in wild-type plants remained relatively stable, while brcuc2-KO plants, due to the suppression of regulatory gene function, showed significant damage to the cell structure of each tissue, manifested as cell deformation, rupture, metabolic disorders, and functional impairment, with a more severe degree of damage than the wild-type. These differences indicate that the BrCUC2 gene plays an important role in maintaining the stability of cell structure and function.

Claims

1. A BrCUC2 gene, characterized in that: The nucleotide sequence of the BrCUC2 gene is shown in SEQ ID NO.

1.

2. The BrCUC2 gene according to claim 1, characterized in that: The BrCUC2 gene regulates the low-temperature stress resistance of Chinese cabbage-type rapeseed.

3. The BrCUC2 gene according to claim 2, characterized in that: The BrCUC2 gene positively regulates the low-temperature stress resistance of Chinese cabbage-type rapeseed.

4. The application of the BrCUC2 gene as described in claim 1 in screening, identifying, distinguishing, or cultivating plants with cold-resistant traits.

5. The application of the BrCUC2 gene as described in claim 1 in screening, identifying, distinguishing, or cultivating rapeseed with cold-resistant traits.

6. The application of the BrCUC2 gene as described in claim 1 in screening, identifying, distinguishing, or cultivating winter rapeseed of the Chinese cabbage type with cold-resistant traits.

7. A biomaterial containing the BrCUC2 gene as described in claim 1, characterized in that: The biomaterial is an expression cassette, expression vector, host cell, cloning vector, or engineered bacteria.

8. The application of the biomaterial as described in claim 7 in enhancing plant resistance to low temperature stress.

9. The application according to claim 8, characterized in that: The plant in question is either Arabidopsis thaliana or rapeseed.

10. A method for enhancing the cold resistance of plants, characterized in that: The method for enhancing plant cold resistance includes the following steps: 1) Obtain the BrCUC2 gene as described in claim 1; 2) Based on the BrCUC2 gene obtained in step 1), biological materials containing the BrCUC2 gene were obtained; 3) The biological material obtained in step 2) is transferred into plants to finally obtain plants with cold resistance traits.

Images