Application of protein taant1-4d and related biological materials in regulating ear type traits of plants

Abstract

The application discloses protein TaANT1-4D and application of biological materials related to the protein in regulation of ear type traits of plants, and aims to solve the technical problem of how to regulate the ear type traits of plants.The amino acid sequence of the protein TaANT1-4D provided by the application is shown in sequence 2 in the sequence listing.Experiments prove that knocking out TaANT1-4D in a wheat variety Fielder can significantly shorten the ear length, reduce the number of spikelets, the grain length and the thousand-grain weight.Therefore, the protein TaANT1-4D has important application value in regulation of the ear type traits of wheat and has a broad prospect in cultivation of wheat varieties.

Description

Technical Field

[0001] This invention belongs to the field of mutation or genetic engineering, specifically relating to the application of protein TaANT1-4D and related biomaterials in regulating plant spike type traits. Background Technology

[0002] Wheat ears are mainly composed of spikelets that grow alternately on both sides of the rachis. Each spikelet produces a variable number of florets, of which 3-5 florets eventually form grains. Wheat is a grain crop primarily harvested for its grains; therefore, the development of wheat ear morphology is closely related to grain yield. If both ear length and the number of spikelets per ear can be increased simultaneously, it is expected to improve yield per plant. For example, some researchers have reported using gene editing technology to edit the TaMYB72 gene in wheat. They found that compared to the wild type, this gene-edited mutant significantly improved yield-related traits such as ear length, number of grains per ear, grain length, and thousand-grain weight, positively regulating wheat yield. Therefore, using gene editing technology to discover genes related to ear morph development in wheat can provide potential genes for future wheat variety improvement. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to use gene editing to knock out the TaANT1-4D gene and thereby regulate the spike type trait of wheat.

[0004] To address the aforementioned technical problems, the present invention first provides the application of proteins or biological materials related to said proteins.

[0005] The application of the protein or related biomaterials provided by this invention can be any of the following:

[0006] A1) The application of proteins or biomaterials related to said proteins in regulating plant spike-like traits.

[0007] A2) The use of proteins or biomaterials related to said proteins in the preparation of products that regulate plant spikelet traits.

[0008] A3) The use of proteins or biomaterials related to said proteins in plant breeding and / or the preparation of plant breeding products;

[0009] The biological material is a substance that regulates the expression of the gene encoding the protein or a substance that regulates the content of the protein.

[0010] The protein is TaANT1-4D, and is any one of the following:

[0011] B1) The amino acid sequence of the protein is shown in sequence 2.

[0012] B2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein described in B1), which has more than 80% identity with the protein shown in B1) and can regulate plant spike type traits.

[0013] B3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2.

[0014] In the above applications, the indicators for plant breeding may include the spikelet type trait. The purpose of plant breeding may include regulating the spikelet type trait of the plant.

[0015] In the above applications, the protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Poly-Arg tag, Strep-tag II tag, Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0016] In the above applications, identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0017] In the above applications, the 80% or more of identity can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0018] In the above applications, the protein may be derived from wheat.

[0019] In the above applications, the substance can regulate the expression of the protein-coding gene or regulate the content of the protein in at least one of the following six aspects: 1) regulation at the transcriptional level of the coding gene; 2) post-transcriptional regulation of the coding gene (i.e., regulation of splicing or processing of the primary transcript of the coding gene); 3) regulation of RNA transport of the coding gene (i.e., regulation of mRNA transport of the coding gene from the nucleus to the cytoplasm); 4) regulation of translation of the coding gene; 5) regulation of mRNA degradation of the coding gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the coding gene).

[0020] In the above applications, the substance may specifically be any of the following:

[0021] C1) Nucleic acid molecules that inhibit, reduce, or downregulate the expression of the gene encoding the protein.

[0022] C2) expresses the gene encoding the nucleic acid molecule described in C1).

[0023] C3) contains the expression cassette of the gene described in C2).

[0024] C4) A recombinant vector containing the gene described in C2), or a recombinant vector containing the expression cassette described in C3).

[0025] C5) Recombinant microorganisms containing the gene described in C2), or recombinant microorganisms containing the expression cassette described in C3), or recombinant microorganisms containing the recombinant vector described in C4).

[0026] C6) A transgenic plant cell line containing the gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4).

[0027] C7) Transgenic plant tissue containing the gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4).

[0028] C8) A transgenic plant organ containing the gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0029] The transgenic plant is a plant obtained through biological methods such as recombinant DNA technology in genetic engineering.

[0030] Furthermore, in the biological material, the nucleic acid molecule in C1) may specifically be a gRNA that targets the protein-coding gene.

[0031] The target sequence of the gRNA may be nucleotides 430-451 of sequence 3 in the sequence listing and / or nucleotides 680-701 of sequence 3 in the sequence listing.

[0032] Furthermore, in the biological material, the recombinant microorganism in C5) can specifically be yeast, bacteria, algae, and fungi.

[0033] Furthermore, the recombinant microorganism may be Agrobacterium. The Agrobacterium may be Agrobacterium tumefaciens.

[0034] Furthermore, in the biological material, the plant tissue described in C7) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and / or anthers.

[0035] Furthermore, in the biological material, the transgenic plant organs described in C8) can be the roots, stems, leaves, flowers, fruits, and seeds of the transgenic plant.

[0036] The present invention also provides a method for regulating the spike-type trait of a plant, the method comprising regulating the agronomic traits of the target plant through step S.

[0037] The present invention also provides a method for cultivating plants with altered spikelet characteristics, including obtaining plants with altered spikelet characteristics through step S.

[0038] Step S includes knocking out, inhibiting, reducing, or downregulating the expression of the gene encoding the protein in the target plant, and / or the activity and / or content of the protein; the target plant contains the gene encoding the protein.

[0039] Step S can be achieved through gene knockout or gene silencing.

[0040] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0041] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0042] Step S includes introducing a gene knockout vector into the target plant targeting nucleotides 430-451 and / or nucleotides 680-701 of sequence 3 in the sequence listing.

[0043] The target plant mentioned above may be wheat.

[0044] Summary of the invention: The encoding gene may be a DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing.

[0045] Specifically, step S may involve deleting cytosine deoxyribonucleotide C at position 435 of SEQ ID NO.3 and inserting adenine deoxyribonucleotide A between positions 695 and 696.

[0046] In the above text, the wheat spike type trait can be selected from at least one of the following:

[0047] D1) Regulation of plant spike length traits

[0048] D2) Regulates the number of spikelets per spike in plants.

[0049] D3) regulates plant grain length traits.

[0050] D4) regulates the grain weight trait in plants.

[0051] The grain weight can be the weight of 1,000 grains.

[0052] In the above text, the plant is any one of the following: E1) dicotyledonous plants, E2) monocotyledonous plants, E3) grasses, E4) wheat.

[0053] The wheat mentioned can be Fielder.

[0054] Experiments have shown that editing the TaANT1-4D gene in wheat spikelets (WT) can shorten spike length and significantly reduce the number of spikelets per spike, grain length, and thousand-grain weight. Therefore, the protein TaANT1-4D has important application value in regulating wheat spike type traits and has broad prospects in wheat variety breeding. Attached Figure Description

[0055] Figure 1 Genotypic analysis of TaANT1-4D gene knockout mutants.

[0056] Figure 2 Analysis of ear type and agronomic traits of TaANT1-4D gene knockout mutant. Detailed Implementation

[0057] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0058] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0059] The following examples used Prism 8.0.2 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA test was used. P < 0.05 (*) indicates a significant difference, and P < 0.01 (**), P < 0.001 (***), and P < 0.0001 (****) indicate a highly significant difference.

[0060] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention.

[0061] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0062] Example 1: Knocking out the wheat TaANT1-4D gene alters wheat spike type traits

[0063] 1. Wheat TaANT1-4D gene knockout

[0064] The wheat Fielder D subgroup contains the genomic gene of TaANT1-4D, sequence 3 in the sequence listing. In sequence 3, positions 1-248 are 5'UTR, positions 249-558, 647-1205, 1802-1884, 2033-2041, 2122-2210, 2299-2372, 2456-2506, 2618-2694, and 3290-3930 are exons, positions 3931-4194 are 3'UTR, and the rest are introns.

[0065] The wheat TaANT1-4D genome sequence (SEQ ID NO.3, 4194bp) is as follows:

[0066]

[0067] The nucleic acid sequence (SEQ ID NO.1, 1896bp) of the coding sequence (CDS) of the wheat TaANT1-4D gene is sequence 1 in the sequence listing, as follows:

[0068]

[0069] The amino acid sequence of the protein TaANT1-4D encoded by the wheat TaANT1-4D gene is sequence 2 (SEQ ID NO.2, 631aa) in the sequence listing, as follows:

[0070] .

[0071] 1.1 Construction of TaANT1-4D gene knockout expression vector

[0072] 1.1.1 Primer Design and Amplification

[0073] Gene editing target design was performed on the target gene TaANT1-4D. Two target sites were selected: T1 (SgRNA Target1) and T2 (SgRNA Target2). The sequence of T1 is 5'-CCGCTCCACCTCCTGGC TACTA-3' (corresponding to nucleotides 430 to 451 of SEQ ID NO. 3), and the sequence of T2 is 5'-ACTT CTTGGGTGGCGGCAATGG-3' (corresponding to nucleotides 680 to 701 of SEQ ID NO: 3). The genomic positions of T1 and T2 in TaANT1-4D are as follows: Figure 1 As shown.

[0074] The forward primer TaANT1-4D-F and reverse primer TaANT1-4D-R were designed and synthesized. Using the intermediate vector pMETaU6.1 as a template, PCR amplification was performed, and the 818 bp target band PCR product was recovered. This PCR product contains an sgRNA expression cassette targeting T1 and an sgRNA expression cassette targeting T2, and is named sgRNA1-TaU6.1-snRNA2-sgRNA2. The nucleotide sequence of this PCR product is SEQ ID NO: 4. bp 1-15 is the BsaI restriction site and its protective bases; bp 16-37 is the T1 sequence; bp 38-62 is the regulatory sequence; bp 63-127 is the gRNA scaffold; bp 128-412 is the regulatory sequence; bp 413-774 is the wheat U6 promoter; bp 775-796 is the T2 sequence; and bp 797-818 is the BsaI restriction site and its protective bases. The primer sequences are as follows:

[0075] TaANT1-4D-F:5'-ccgaggtctcgggcgTAGTAGCCAGGAGGTGGAGCGGgtttcagagctatgctggaaac-3';

[0076] TaANT1-4D-R: 5'-acctcggtctccaaacCCATTGCCGCCACCCAAGAAGTcaagtctgatgcagcaagc-3'.

[0077] The specific sequence of SEQ ID NO: 4 (814bp) is as follows:

[0078] 5’-CCGAGGTCTCGGGCGTAGTAGCCAGGAGGTGGAGCGGGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTTTCGTTTTGCATTGAGTTTTCTCCGTCGCATGTTTGCAGTTTTATTTTCCGTTTTGCATTGAAATTTCTCCGTCTCATGTTTGCAGCGTGTTCAAAAAGTACGCAGCTGTATTTCACTTATTTACGGCGCCACATTTTCATGCCGTTTGTGCCAACTATCCCGAGCTAGTGAATACAGCTTGGCTTCACACAACACTGGTGACCCGCTGACCTGCTCGTACCTCGTACCGTCGTACGGCACAGCATTTGGAATTAAAGGGTGTGATCGATACTGCTTGCTGCTACCAAGCCCGTTATTCTGACAGTTCTGGTGCTCAACACATTTATATTTATCAAGGAGCACATTGTTACTCACTGCTAGGAGGGAATCGAACTAGGAATATTGATCAGAGGAACTACGAGAGAGCTGAAGATAACTGCCCTCTAGCTCTCACTGATCTGGGCGCATAGTGAGATGCAGCCCACGTGAGTTCAGCAACGGTCTAGCGCTGGGCTTTTAGGCCCGCATGATCGGGCTTTGTCGGGTGGTCGACGTGTTCACGATTGGGGAGAGCAACGCAGCAGTTCCTCTTAGTTTAGTCCCACCTCGCCTGTCCAGCAGAGTTCTGACCGGTTTATAAACTCGCTTGCTGCATCAGACTTGACTTCTTGGGTGGCGGCAATGGGTTTCAGAGCTATGCTGGAAAC-3’。

[0079] The amplification system is as follows:

[0080] system Dosage pMETaU6.1 vector plasmid 100ng TaANT1-4D-F 1μL TaANT1-4D-R 1μL KOD One PCR mix 25μL <![CDATA[ddH2O]]> Up to 50 μL

[0081] The PCR program is as follows:

[0082]

[0083] 1.1.2 Ligation of PCR products with gene editing vectors

[0084] The gene-editing backbone vector pLGY-E003 (WPA1 encodes a vWA domain protein that regulates wheat plant architecture, ISSN 2214-5141, https: / / doi.org / 10.1016 / j.cj.2024.05.008.) was digested with BsaI and the vector was recovered from the gel. The PCR product was ligated to the gene-editing backbone vector pLGY-E003 (the vector recovered from BsaI digestion) to obtain the recombinant plasmid pLGY-E003-TaANT1-4D-sgRNA. The ligation reaction was performed in a PCR instrument under the following conditions: 37℃ for 5 min, 16℃ for 10 min, for a total of 60 cycles; then 16℃ for 1 h. pLGY-E003-TaANT1-4D-sgRNA can produce Cas9 and sgRNA targeting T1 and T2.

[0085] The reaction system is shown below:

[0086] system Dosage pLGY-E003 50ng PCR products 300ng 10×T4 ligase buffer 1μL BSA 1μL T4 ligase 0.5μL BsaI 0.5μL <![CDATA[ddH2O]]> Up to 10 μL

[0087] 1.1.3 Agrobacterium transformation and positive clone screening

[0088] a) Agrobacterium-mediated transformation

[0089] The recombinant plasmid pLGY-E003-TaANT1-4D-sgRNA was transformed into the Agrobacterium tumefaciens strain EHA105 to obtain recombinant Agrobacterium EHA105 / pLGY-E003-TaANT1-4D-sgRNA containing the recombinant plasmid pLGY-E003-TaANT1-4D-sgRNA.

[0090] Wheat Fielder (recipient) embryonic scutes were infected with recombinant Agrobacterium EHA105 / pLGY-E003-TaANT1-4D-sgRNA. The embryos were then transferred to an induction medium and cultured at 22-23°C in the dark to induce embryogenic callus. The embryogenic callus was then transferred to a rooting medium and cultured at 22-23°C for 3-4 weeks under 12h light / 12h dark conditions to obtain T0 generation regenerated seedlings with good rhizome growth, i.e., T0 generation transgenic wheat.

[0091] The formulations of the relevant culture media are as follows:

[0092] Callus induction medium (1L): 100mL MS Macro salts (×10), 1mL L7 Micro salts (×1000), 10mL FeNaEDTA (×100), 1mL MS vitamins (×1000), 100mg inositol, 0.5g glutamine, 100mg casein, 1.95g MES, 40g maltose. Mix well and adjust the pH to 5.7. Add 2g of plant gel and sterilize at 121℃ for 15min. After the medium cools to 55℃, add the filtered and sterilized reagents according to the stock solution ratio, including 0.25mg 2,4-D, 1mg Picloram, and 80mg Timentin.

[0093] Regeneration medium (1L): 100mL L7 Macro salts (×10), 1mL L7 Micro salts (×1000), 10mL FeNaEDTA (×100), 5mL Vitamins / inositol (×200), 100mg inositol, 30g maltose. Mix well and adjust the pH to 5.7. Add 2g of plant gel and sterilize at high temperature. After the medium cools to 55℃, add the filtered and sterilized reagents according to the stock solution ratio, including 0.05mg 2,4-D, 80mg Timentin, and 2.5mg Zeatin. The screening medium is the regeneration medium with 1.25mg glufosinate added.

[0094] MS Macro salts (×10): 16.5 g / L ammonium nitrate, 19.0 g / L potassium nitrate, 1.7 g / L potassium dihydrogen phosphate, 3.7 g / L magnesium sulfate heptahydrate, 4.4 g / L calcium chloride dihydrate. Mix well, incubate at 121°C for 15 min, and store at 4°C.

[0095] L7 Macro salts (×10): 2.5 g / L ammonium nitrate, 15.0 g / L potassium nitrate, 2.0 g / L potassium dihydrogen phosphate, 3.5 g / L magnesium sulfate heptahydrate, 4.5 g / L calcium chloride dihydrate. Mix well, incubate at 121°C for 15 min, and store at 4°C.

[0096] L7 Micro salts (×1,000): 15.0 g / L manganese sulfate, 5.0 g / L boric acid, 7.5 g / L zinc sulfate heptahydrate, 0.75 g / L potassium iodide, 0.25 g / L sodium molybdate dihydrate, 0.025 g / L copper sulfate pentahydrate, 0.025 g / L cobalt chloride hexahydrate. Sterilize by filtration and store at 4°C.

[0097] Vitamins / inositol (×200): 40.0g / l inositol, 2.0g / l vitamin B1 hydrochloride, 0.2g / l vitamin B6, 0.2g / l niacin, 0.2g / l calcium pantothenate, 0.2g / l vitamin C. Filtered for sterilization, store at 4℃.

[0098] b) Identification of positive plants

[0099] Ten T0 generation transgenic wheat plants were randomly selected for PCR testing. The specific steps are as follows:

[0100] 1) Total DNA was extracted from the leaves of 10 T0 generation transgenic wheat seedlings using the CTAB genomic DNA extraction method. The DNA content in the leaves of each T0 generation transgenic wheat was approximately 200 ng / μL.

[0101] 2) Use PCR technology to obtain fragment sequences, including gene editing target sites, from each T0 generation of transgenic wheat.

[0102] The PCR primers were: forward primer: 5'-GAAGCGTTTTCGTCTGTGTTTGT-3' and reverse primer: 5'-ACTGCAGATGCATCAGAGCAAG-3'.

[0103] The reaction system consisted of 20 μL of 10 μL 2×Phanta Max Master Mix (Dye Plus), 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, 1 μL of genomic DNA from 10 generation of wheat transgenic Ta ANT1-4d, and 8.0 μL of ddH2O.

[0104] Reaction program: 94℃ pre-denaturation for 3 min; 95℃ denaturation for 3 sec; 60℃ annealing for 30 sec; 35 cycles.

[0105] 3) Sequencing method to detect mutants.

[0106] The PCR products were sequenced, and the sequencing results were compared with the TaANT1-4D nucleotide sequence of the recipient plants to detect the mutation type. T0 plants were self-crossed for two consecutive generations to obtain the T2 generation TaANT1-4D gene knockout homozygous mutant wheat ant1d-m1. Compared with wild-type Fielder wheat, the A and B subgenomes of ant1d-m1 remained unchanged. The region corresponding to the TaANT1-4D gene in the D subgenome underwent the following changes: cytosine deoxyribonucleotide C at position 435 of SEQ ID NO.3 was deleted, and adenine deoxyribonucleotide A was inserted between positions 695 and 696, thereby knocking out the TaANT1-4D gene in the Fielder wheat genome (see...). Figure 1 ).

[0107] 1.2 Analysis of spikelet type traits in T2 generation TaANT1-4D knockout wheat

[0108] Harvesting Step 1.1: Obtain ant1d-m1 seeds and plant them together with wheat Fielder seeds in a greenhouse at a temperature of 25°C and a light intensity of 350 μmol photons m -2 s -1 Cultivate under conditions of 60-70% humidity until maturity, and investigate the number of spikelets per spikelet of the main spike of 5 plants in each line. Figure 2 (b) Main ear length ( Figure 2 c), grain length ( Figure 2 c) and thousand-grain weight. Spikelet count: After the above wheat seeds matured, the number of spikelets per spike in the main spike of gene knockout wheat ant1d-m1 and wild-type Fielder was counted. The results are as follows: Figure 2 As shown in Figure d, the number of spikelets per spike in the gene knockout wheat ant1d-m1 decreased by 28% compared with the wild type, showing a significant difference.

[0109] Spike length statistics: After the above wheat seeds matured, the spike length of the main spike was counted for gene knockout wheat ant1d-m1 and wild-type Fielder. The spike length of the main spike of 5 individual plants from each line was measured, and the results are as follows: Figure 2 As shown in Figure d, the spike length of the knockout wheat ant1d-m1 decreased by 14.3% compared with the wild type, which was not significantly different.

[0110] Grain length statistics: After the wheat seeds matured, the seeds harvested from each plant were dried at 37℃ for one week. After the seeds reached constant weight, the grain length of the gene knockout wheat ant1d-m1 and wild-type Fielder was measured. At least 60 seeds were measured from each line. The grain length measurement results are as follows: Figure 2 As shown in Figure d, the seed length of wheat ant1d-m1 with gene knockout decreased by 2.9% compared with wild type, which is a significant difference.

[0111] 1000-grain weight calculation: After the wheat seeds matured, seeds harvested from individual plants were dried at 37℃ for one week until the seeds reached constant weight. The 1000-grain weight of seeds from the gene knockout wheat ant1d-m1 and wild-type Fielder was then measured. The weight of 200 seeds was randomly measured from each line to generate the 1000-grain weight. Results are as follows: Figure 2 As shown in Figure d, the thousand-grain weight of the gene knockout wheat ant1d-m1 decreased by 22.3% compared to the wild type.

[0112] Figure 2 In the image, a is a photo of wheat during the seedling stage, b is a photo of wheat at maturity, c is a photo of wheat ears and grains, and d is a statistical result of the number of spikelets per ear, ear length, grain length, and thousand-grain weight.

[0113] The results showed that the TaANT1-4D gene knockout line had a phenotype of shorter spike length, fewer spikelets, and smaller grains. The protein TaANT1-4D has important application value in regulating wheat spike traits (such as spike length, number of spikelets, and grain size).

[0114] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of a protein or a biomaterial related to said protein, characterized in that, The application is any one of the following: A1) The application of proteins or biomaterials related to said proteins in regulating plant spike-like traits. A2) The use of proteins or biomaterials related to said proteins in the preparation of products that regulate plant spikelet traits. A3) The use of proteins or biomaterials related to said proteins in plant breeding and / or the preparation of plant breeding products; The biological material is a substance that regulates the expression of the gene encoding the protein or a substance that regulates the content of the protein. The protein is TaANT1-4D, and is any one of the following: B1) The amino acid sequence of the protein is shown in sequence 2. B2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein described in B1), which has more than 80% identity with the protein shown in B1) and can regulate plant spike type traits. B3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2.

2. The application according to claim 1, characterized in that, The protein is derived from wheat.

3. The application according to claim 1 or 2, characterized in that, The biomaterial is any one of the following: C1) Nucleic acid molecules that inhibit, reduce, or downregulate the expression of the gene encoding the protein described in claim 1 or 2. C2) expresses the gene encoding the nucleic acid molecule described in C1). C3) contains the expression cassette of the gene described in C2). C4) A recombinant vector containing the gene described in C2), or a recombinant vector containing the expression cassette described in C3). C5) Recombinant microorganisms containing the gene described in C2), or recombinant microorganisms containing the expression cassette described in C3), or recombinant microorganisms containing the recombinant vector described in C4). C6) A transgenic plant cell line containing the gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4). C7) Transgenic plant tissue containing the gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4). C8) A transgenic plant organ containing the gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

4. The application according to claim 3, characterized in that, B1) The nucleic acid molecule is a gRNA that targets the protein-coding gene described in claim 1.

5. A method for regulating spike-type traits in plants, characterized in that, The method includes regulating the agronomic traits of the target plant through step S, wherein step S includes S1 and / or S2; wherein S1 is to inhibit, reduce or downregulate the expression of the gene encoding the protein of claim 1 or 2 in the target plant, and S2 is to inhibit, reduce or downregulate the activity and / or content of the protein of claim 1 or 2; wherein the target plant contains the gene encoding the protein of claim 1 or 2.

6. A method for cultivating plants with altered spikelet type traits, comprising obtaining plants with altered spikelet type traits through step S, wherein step S comprises knocking out or inhibiting or reducing or downregulating the expression of the gene encoding the protein of claim 1 or 2 in the target plant, and / or the activity and / or content of the protein of claim 1 or 2; the target plant contains the gene encoding the protein of claim 1 or 2.

7. The method as described in claim 5 or 6, characterized in that, Step S includes introducing a gene knockout vector into the target plant targeting nucleotides 430-451 and / or nucleotides 680-701 of sequence 3 in the sequence listing.

8. The method as described in claim 5 or 6, characterized in that, The target plant is wheat.

9. The application as described in any one of claims 1-4 or the method as described in any one of claims 5-8, characterized in that, The wheat spike type trait being regulated is selected from at least one of the following: D1) Regulation of plant spike length traits D2) Regulates the number of spikelets per spike in plants. D3) regulates plant grain length traits. D4) regulates the grain weight trait in plants.

10. The application as described in any one of claims 1-4 or the method as described in any one of claims 5-8, characterized in that, The plant is any one of the following: E1) Dicotyledons E2) Monocotyledons E3) Gramineae plants E4) Wheat.

Images